Skip to main content
The Journal of Prevention of Alzheimer's Disease logoLink to The Journal of Prevention of Alzheimer's Disease
. 2021 Jun 17;8(4):483–494. doi: 10.14283/jpad.2021.33

Tauroursodeoxycholic Acid Attenuates Diet-Induced and Age-Related Peripheral Endoplasmic Reticulum Stress and Cerebral Amyloid Pathology in a Mouse Model of Alzheimer's Disease

T Ochiai 1,2, T Nagayama 1, K Matsui 1, K Amano 1, T Sano 1, Tomoko Wakabayashi 1,3,f, Takeshi Iwatsubo 1,g
PMCID: PMC12280779  PMID: 34585224

Abstract

Background

Obesity and diabetes are well-established risk factors of Alzheimer's disease (AD). In the brains of patients with AD and model mice, diabetes-related factors have been implicated in the pathological changes of AD. However, the molecular mechanistic link between the peripheral metabolic state and AD pathophysiology have remained elusive. Endoplasmic reticulum (ER) stress is known as one of the major contributors to the metabolic abnormalities in obesity and diabetes. Interventions aimed at reducing ER stress have been shown to improve the systemic metabolic abnormalities, although their effects on the AD pathology have not been extensively studied.

Objectives

We examined whether interventions targeting ER stress attenuate the obesity/diabetes-induced Aβ accumulation in brains. We also aimed to determine whether ER stress that took place in the peripheral tissues or central nervous system was more important in the Aβ neuropathology. Furthermore, we explored if age-related metabolic abnormalities and Aβ accumulation could be suppressed by reducing ER stress.

Methods

APP transgenic mice (A7-Tg), which exhibit Aβ accumulation in the brain, were used as a model of AD to analyze parameters of peripheral metabolic state, ER stress, and Aβ pathology in the brain. Intraperitoneal or intracerebroventricular administration of taurodeoxycholic acid (TUDCA), a chemical chaperone, was performed in high-fat diet (HFD)-fed A7-Tg mice for ∼1 month, followed by analyses at 9 months of age. Mice fed a normal diet were treated with TUDCA by drinking water for 4 months and intraperitoneally for 1 month in parallel, and analyzed at 15 months of age.

Results

Intraperitoneal administration of TUDCA suppressed ER stress in the peripheral tissues and ameliorated the HFD-induced obesity and insulin resistance. Concomitantly, Aβ levels in the brain were significantly reduced. In contrast, intracerebroventricular administration of TUDCA had no effect on the Aβ levels. Peripheral administration of TUDCA was also effective against the age-related obesity and insulin resistance, and markedly reduced amyloid accumulation.

Conclusions

Interventions that target peripheral ER stress might be beneficial therapeutic and prevention strategies against brain Aβ pathology associated with metabolic overload and aging.

Key words: ER stress, Aβ, obesity, diabetes, Alzheimer's disease

Introduction

A growing body of evidence suggests that a certain proportion of the causative factors of dementia (1), and also those of Alzheimer's disease (AD) (2), may be attributable to lifestyle-related risks. Therefore, it may be possible to prevent AD by identifying and reducing those risk factors (3). Epidemiological and biological evidence that support the association of obesity and type 2 diabetes mellitus (T2DM) with AD is increasingly accumulating. In particular, meta-analyses of prospective cohort studies showed that the presence of diabetes increases the risk of AD by ∼1.5 times (4, 5). Various biological mechanisms have been suggested to explain the link between these lifestyle-related risks and AD: pathological conditions such as chronic inflammation, hyperglycemia, insulin resistance, and vascular complications underlie cognitive dysfunctions (6, 7). Notably, it has been established that peripheral insulin resistance is associated with higher amyloid plaque loads in the brains of patients with AD (8). This has been recapitulated in the mouse models of AD, in which the degrees of diet-induced insulin resistance and metabolic abnormalities correlated well with brain Aβ accumulation, and moreover, the effects were reversible (9, 10, 11, 12, 13). Because Aβ accumulation is considered to play a causative role in the pathophysiology of AD (14), deterioration of the peripheral metabolic state may adversely affect both the pathological and symptomatic manifestations of AD. However, it remains unresolved what kind of molecular abnormalities observed in the pathophysiology of diabetes are causative to the AD pathogenesis in the brain.

One of the key factors that plays a central role in the pathogenesis of obesity and diabetes is the endoplasmic reticulum (ER) stress. Metabolic overload, e.g., high-fat diet (HFD) feeding and overnutrition, is a primary cause of obesity and T2DM, in which the action of insulin on peripheral tissues is attenuated. ER stress due to metabolic overload is considered to be a major culprit in the insulin resistance in metabolic organs, e.g., liver and adipose tissue (15). Under the ER stress conditions, accumulation of misfolded proteins and loss of homeostasis in the ER are initially detected by sensor proteins. This results in the activation of three major unfolded protein response (UPR) signaling pathways, i.e., IRE1-XBP1, PERK-eIF2α-ATF4, and ATF6, which in turn induce the expression of chaperone proteins and repress overall protein translations (16). Several mechanisms that link UPR to insulin resistance through direct inhibition of the insulin signaling pathway have been postulated. It has been shown that IRE1-dependent activation of JNK1 phosphorylates serine residues of insulin receptor substrate 1 (IRS-1) and attenuates insulin receptor signaling (17, 18).

Molecular signatures of ER stress and UPR activation have also been documented in postmortem AD brains (19, 20, 21, 22). Accumulation of Aβ and tau, pathogenic proteins in AD, has been proposed to cause ER stress, leading to synaptic dysfunction and neurodegeneration (22, 23, 24). These observations have highlighted ER stress as a common pathophysiological feature of the metabolic disorders and AD. However, the question as to whether ER stress elevated in the peripheral tissues or in the central nervous system is causative to the AD changes, remains elusive.

ER stress can be suppressed in vivo by administration of chemical chaperones, e.g. tauroursodeoxycholic acid (TUDCA) and 4-phenyl butyric acid (4-PBA). Treatment with TUDCA and 4-PBA has been shown to improve the systemic metabolic abnormalities in obesity/diabetes models, e.g., ob/ob mice and HFD-fed mice (25, 26, 27, 28), supporting the notion that ER stress is causally involved in the pathogenesis of metabolic disorders. Given the correlation between metabolic status and AD pathology, interventions targeting ER stress induced by metabolic overload may also be a potential preventive target for the concomitant worsening of AD pathology.

In this study, we investigated the effects of metabolic improvement by administration of TUDCA on the HFD-induced increase in ER stress and exacerbation of AD pathophysiology in mice overexpressing the amyloid precursor protein (APP) in the brain (A7-Tg mice). Peripheral administration of TUDCA counteracted HFD-induced ER stress and metabolic abnormalities in the periphery, and decreased Aβ levels in the brain, whereas direct brain administration of TUDCA had no effect. Furthermore, age-related exacerbation of ER stress and metabolic abnormalities also were improved by TUDCA, resulting in a marked suppression of brain amyloid accumulation. These results support the view that interventions targeting peripheral ER stress might be effective in reducing Aβ accumulation in the brain caused by obesity and diabetes that are associated with metabolic overload or by aging.

Materials and Methods

Mice

A7 transgenic mice (A7-Tg) overexpressing human APP695 harboring KM670/671NL and T714I familial AD mutations under the control of the Thy-1.2 promoter were backcrossed and maintained on a C57BL/6J background (11). Mice were maintained on a 12 h light/dark cycle and provided ad libitum access to water. In the experiments with a high-fat diet, mice were fed standard chow diet (CRF-1, Oriental Yeast Co., Ltd.) until 3 months of age. Thereafter, they were either maintained on the standard chow or switched to a high-fat diet (HFD32, CLEA Japan Inc.) containing 32% fat. The animal care and experimental procedures were approved by the animal experiment committee of The University of Tokyo Graduate School of Medicine.

TUDCA treatment

We performed three TUDCA administration experiments. In the first experiment, 8-month-old HFD-fed A7-Tg mice were intraperitoneally administered TUDCA (250 mg/kg, Merck) or saline twice per day for 30 days, as previously reported (25). In the second experiment, 7- to 8-month-old HFD-fed A7-Tg mice received intracerebroventricular administration of TUDCA (10 µg/day) or phosphate buffered saline (PBS) for 28 days, in accordance with previous reports (29, 30). For intracerebroventricular administration of TUDCA, cannulas (ALZET Brain Infusion Kit 3, ALZET Osmotic Pumps) were stereotaxically implanted into the lateral ventricle (from bregma: anteroposterior -0.5 mm, mediolateral -1.1 mm, dorsoventral -2.5 mm) under anesthesia (0.3 mg/kg of medetomidine, 4.0 mg/kg of midazolam, and 5.0 mg/kg of butorphanol). Then a catheter tube was connected to an osmotic minipump flow moderator (model 2004, ALZET Osmotic Pumps). The minipump was inserted in a subcutaneous pocket on the dorsal surface of the mouse, and the incision was closed. In the third experiment, TUDCA was administered by drinking water to 11-month-old A7-Tg mice for 120 days. The concentration of TUDCA was increased gradually to avoid taste aversion (1 mg/mL for 60 days, 3 mg/mL for 7 days, 5 mg/mL for 14 days, 6.5 mg/mL for 39 days). For the last 31 days, TUDCA was administered intraperitoneally (250 mg/kg) twice per day, 6 days per week, in parallel.

Antibodies

The following antibodies were used: anti-phospho-eIF2α (3398, Cell Signaling Technology (CST)), anti- eIF2α (5324, CST), anti-phospho-JNK (4668, CST), anti-JNK (9258, CST), anti-phospho-PERK (3179, CST), anti-PERK (3192, CST), anti-BiP (610978, BD biosciences), anti-CHOP (ab11419, Abcam), anti-Human APP (C) (18961, IBL), anti-ADAM10 (ab124695, Abcam), anti-BACE1 (5606, CST), anti-α-tubulin (DM1A, Merck), anti-LC3B (3868, CST), anti-Beclin1 (612113, BD biosciences), anti-Sirt1 (2028, CST), anti-PGC-1α (SC-518025, Santa Cruz Biotechnology), anti-Aβ (82E1, IBL), peroxidase-conjugated AffiniPure anti-rabbit IgG (111-035-003, Jackson ImmunoResearch), and peroxidase-conjugated AffiniPure anti-Mouse IgG (515-035-003, Jackson ImmunoResearch).

Metabolic measurements

Blood glucose was measured using Glutest sensor (Sanwa Kagaku Kenkyusho Co., LTD.). For an insulin tolerance test (ITT), 3-hour-fasted mice were intraperitoneally injected with human insulin (Humulin R, Eli Lilly) at 0.75 U/Kg body weight, and blood glucose levels were measured every 20 min for 120 min.

Western blot analysis

Epididymal adipose tissues or periovarian adipose tissues were obtained and weighed. Brains were harvested, dissected into the hypothalamus, hippocampus, and cerebral cortex. These tissue samples were snap frozen in liquid nitrogen and stored at -80 °C until use. Tris-buffered saline (TBS)-soluble fractions were obtained as the supernatant from homogenizing tissues in a 1:10 (w/v) volume of TBS and centrifuging at 347,600 x g for 20 min at 4 °C. TBS-insoluble pellets were homogenized in a 1:10 (w/v) volume of 2% Triton X-100 (TX) in TBS and centrifuged at 347,600 x g for 20 min at 4 °C and supernatants were saved as TX-soluble fractions. RIPA-soluble fcations were obtained as the supernatant from homogenizing tissues in a 1:10 (w/v) volume of RIPA buffer (1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS) in TBS) and centrifuging at 17,800 x g for 30 min at 4 °C. Protein concentration was determined with BCA protein assay kit (Takara Bio Inc.). All the buffers were supplemented with cOmplete protease inhibitor and PhosSTOP phosphatase inhibitor cocktails (Merck). TBS-, TX-, and RIPA-soluble fractions were used for immunoblotting.

For immunoblotting, samples were separated by SDS-polyacrylamide gel electrophoresis under a reducing condition using a Tris-Glycine gel system, transferred to polyvinylidene difluoride membranes (Merck), and incubated with antibodies. The immunoblots were developed using ImmunoStar reagents (Wako) and SuperSignal (Thermo Fisher), and visualized by LAS-4000 mini (Fujifilm).

ELISA quantitation of Aβ

For the measurement of soluble and insoluble Aβ, the TBS-soluble and SDS-insoluble/formic acid-soluble fractions were used, respectively. For extraction of the insoluble fraction, brains were homogenized in a 1:10 (w/v) volume of RIPA buffer, centrifuged at 347,600 x g for 20 min at 4 °C. Resulting pellets were homogenized in a 1:10 (w/v) volume of 2% SDS in TBS, incubated for 30 min at 37 °C and centrifuged at 347,600 x g for 20 min at 20 °C. SDS-insoluble pellets were dissolved in 70% formic acid using a sonicator (Branson), centrifuged at 347,600 x g for 20 min at 4 °C and supernatants were desiccated by Speed-Vac followed by resuspension in dimethyl sulfoxide (DMSO). Levels of Aβ were quantitated by BNT77/BA27 or BNT77/BC05 Human/Rat β Amyloid ELISA kit (Wako). Prior to the measurement of soluble Aβ, an equal volume of 1 M guanidine hydrochloride was added and incubated for 30 min at room temperature.

Immunohistochemical analysis and morphometry

Mouse brains were fixed with 4% paraformaldehyde in PBS for 24 h, dehydrated, and embedded in paraffin. Serial sections were cut at 4-µm thickness. Deparaffinized sections were treated with microwave (700 W) in citrate buffer pH 6.0 for 20 min, followed by digestion with 100 µg/ml proteinase K (Worthington) in TBS for 6 min at 37 °C. After blocking by incubation with 10% calf serum in TBS, the sections were incubated with an anti-Aβ antibody 82E1 and then a biotinylated anti-mouse IgG antibody (Vector Laboratories), followed by visualization by avidin-biotin complex method (ABC elite, Vector Laboratories) using diaminobenzidine as chromogen. The percentage area covered by Aβ immunoreactivity in the parietal cortex/cingulate gyrus, hippocampus, and piriform cortex was measured using Image J software (NIH) as previously described (31).

Quantitative reverse transcription PCR

Total RNA was isolated using TRIzol Plus RNA Purification Kit and PureLink RNA Mini kit (Thermo Fisher). RNA purity and concentration were measured by NanoDrop (ThermoFisher). Total RNA was reverse-transcribed into cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO). Real-time PCR was performed with LightCycler 480 system (Roche) using THUNDERBIRD SYBR qPCR Mix (TOYOBO). Threshold cycle values were normalized to Gapdh. The primer pairs used in this study are as follows: 5′- AACGACCCCTTCATTGAC -3′ and 5′- GAAGACACCAGTAGACTCCAC -3′ for Gapdh; 5′- AAGCTATTTCAGTCCCCAGTGG -3′ and 5′- AAGAGCAACCCGAACATGAC -3′ for Map1lc3a; 5′- GACGTGGAGAAAGGCAAGATTG -3′ and 5′- TTGAGCGCTTTTGTCCACTG -3′ for Becn1; 5′- TTGACCGATGGACTCCTCAC -3′ and 5′-AACAAAAGTATATGGACCTATCCGC -3′ for Sirt1.

Statistical analysis

Quantitative data were analyzed statistically by unpaired t test for two-group data, or one-way ANOVA followed by Tukey's multiple comparisons test for three-group data using GraphPad Prism 7. In figures, all data are represented by mean ± SEM. Statistical significance is indicated by *p < 0.05, ** p < 0.01, and *** p < 0.001.

Results

Intraperitoneal administration of TUDCA attenuated diet-induced peripheral ER stress and improved systemic metabolic abnormalities in A7-Tg mice

To study the link between the peripheral metabolic state and brain AD pathology, we have used A7-Tg mice expressing human APP harboring the Swedish and Austrian mutations in neurons. A7-Tg mice develop progressive Aβ deposition in the brain starting at ∼12 months of age, and we have previously shown that inducing obesity/diabetes by feeding HFD accelerates amyloid pathology in the brains of A7-Tg mice (11). Furthermore, HFD-induced acceleration of Aβ pathology was reversibly suppressed in dietary intervention experiments that switched from HFD to normal diet (ND) either starting at the age of 9 months (11) or 15 months (Figure S1), as the systemic metabolic abnormalities were improved. These results indicate that metabolic improvement is effective in reversing the HFD-induced Aβ deposition.

We investigated the effects of mitigating ER stress on metabolic state and consequently amyloid pathology using a chemical chaperone TUDCA, which has been shown to be effective in improving HFD-induced metabolic abnormalities (25). TUDCA was intraperitoneally administered to HFD-fed A7-Tg mice for 30 days starting at 8 months of age (Figure 1a). HFD feeding increased body weights and wet weights of adipose tissues compared to normal diet (ND) feeding, whereas TUDCA treatment significantly alleviated HFD-induced obesity in A7-Tg mice (Figure 1b–d). HFD-fed A7-Tg mice exhibited significant hyperglycemia, which was associated with a decreased insulin sensitivity as shown by the insulin tolerance test (ITT) (Figure 1e–g). Administration of TUDCA also improved the impaired glucose metabolism to a level comparable to that of ND-fed mice (Figure 1e–g). These data suggest that TUDCA could ameliorate diet-induced obesity and diabetes-like metabolic abnormalities in A7-Tg mice.

Figure 1.

Figure 1

Intraperitoneal administration of TUDCA improved diet-induced metabolic abnormalities and reduced peripheral ER stress

(a) Schematic diagram of the study design. Male A7-Tg mice were fed with normal diet (ND) or high-fat diet (HFD) from 3 months of age, and TUDCA (250 mg/kg) or saline (vehicle) was administered intraperitoneally twice per day for 30 days from 8 months of age. (b) The time course of body weight changes during TUDCA treatment. (c–d) Body weight (c) and adipose tissue wet weight (d) on day 31 after starting TUDCA treatment. (e–g) Changes in the blood glucose levels (e) and area under the curve (AUC) (f) during the insulin tolerance test (ITT) on day 15 or 16, and blood glucose levels before the test (g). (h–i) Immunoblot analyses of phosphorylation levels of eIF2a and JNK in the RIPA-soluble fractions of liver (h) and adipose tissue (i) (upper panels). The ratios of phosphorylation to total protein content were measured by densitometry (lower panels). Data are mean ± SEM (ND: n = 8, HFD: n = 5, HFD-TUDCA: n = 6). *, p < 0.05; **, p < 0.01; ***, p < 0.001, one-way ANOVA with Tukey's post-hoc test.

Previous studies have shown that TUDCA treatment ameliorates insulin resistance and abnormal glucose metabolism via the reduction of ER stress in the liver and adipose tissue of obese mice (25, 28). We therefore examined the effects of HFD feeding and TUDCA treatment on UPR in the liver and adipose tissues in A7-Tg mice. HFD feeding induced phosphorylation of eIF2α and JNK in the liver, which was significantly decreased by TUDCA treatment, in HFD-fed A7-Tg mice (Figure 1h). In the adipose tissue, phospho-eIF2α showed an increasing trend with HFD feeding, which was not inhibited by TUDCA treatment (Figure 1i). On the other hand, phospho-JNK was markedly increased by HFD and decreased significantly by TUDCA treatment, as in the liver (Figure 1i).

Intraperitoneal administration of TUDCA prevented the HFD-induced exacerbation of Aβ accumulation in brains

We next examined the effects of TUDCA on HFD-induced exacerbation of Aβ pathology in the cerebral cortices of A7-Tg mice. As we previously reported (11), HFD-feeding significantly increased the levels of both Aβ40 and Aβ42 at 9 months of age (Figure 2a). Administration of TUDCA reduced the Aβ levels in the HFD group to a similar level to that of control ND group, indicating that the effect of metabolic overload on Aβ pathology was totally reversed by TUDCA (Figure 2a). The levels of APP fragments were not altered by HFD feeding, whereas the levels of CTFβ, a carboxy-terminal fragment produced upon β-cleavage, were decreased by TUDCA treatment (Figure 2b). Although the protein levels of ADAM10 and BACE1, corresponding to α- and β-secretases, respectively, did not change in any of the experimental groups (Figure 2c), the reduced levels of CTFβ might be related to the inhibitory effect of TUDCA on Aβ production.

Figure 2.

Figure 2

Intraperitoneal administration of TUDCA prevented the HFD-induced increase of brain A∼ accumulation

(a) The levels of TBS-soluble Aβ40 and Aβ42 in the cerebral cortices of 9-month-old A7-Tg mice in the three experimental groups indicated in Figure 1a (ND, HFD, and HFD-TUDCA) were analyzed by ELISA. (b) Immunoblot analyses of full-length APP (APP FL), APP-CTFa, APP-CTFβ, and α-tubulin in the TX-soluble fractions of cerebral cortex. The lower graph shows the results of densitometry. The amount of protein was expressed as a relative value to the ND group. (c) Immunoblot and densitometric analyses of ADAM10 and BACE1 in the TX-soluble fraction of cerebral cortex. (d) Immunoblot analyses of peIF2α, pJNK, total eIF2α, total JNK, Grp78/BiP, CHOP, and α-tubulin in the TBS-soluble fractions of cerebral cortex (left panels). The right panel shows the results of densitometry. The levels of peIF2α and pJNK were normalized to total eIF2α and JNK, respectively; those of Grp78/BiP and CHOP were normalized to α-tubulin. Data are mean ± SEM (ND: n = 8, HFD: n = 5, HFD-TUDCA: n = 6). *, p < 0.05; **, p < 0.01; ***, p < 0.001, one-way ANOVA with Tukey's post-hoc test.

To investigate the relationship between changes in Aβ levels and ER stress in the brain, we analyzed the expression of ER stress marker proteins phospho-eIF2α, phospho-JNK, Grp78/Bip, and CHOP in the cerebral cortex. In contrast to the peripheral tissues, no increase in the expression of ER stress marker proteins was observed upon HFD feeding in the cerebral cortices (Figure 2d), and TUDCA treatment did not alter the levels of any of these proteins (Figure 2d). We also examined the mRNA expression of TNFα in the hippocampus to investigate the possibility that TUDCA treatment affects inflammatory signals in the brain. The results showed that there was no significant difference in relative expression levels among the ND (1.000 ± 0.151), HFD (0.866 ± 0.115), and HFD-TUDCA (1.070 ± 0.176) groups. These results suggest that metabolic improvement through reduction of the peripheral ER stress by TUDCA may prevent HFD-induced exacerbation of Aβ pathology in brains.

Intracerebroventricular administration of TUDCA had no effect on the HFD-induced increase in Aβ levels in the cerebral cortex of A7-Tg mice

Previous studies have shown that TUDCA is able to cross the blood-brain barrier and exert the effects on the central nervous system tissues (32, 33). This suggests that the effects of intraperitoneally administered TUDCA on Aβ pathogenesis may be due to either an indirect effect of TUDCA in the periphery or a direct effect of TUDCA translocated to the brain. To examine the latter possibility, we directly administered TUDCA into the cerebral ventricules (i.c.v.) of HFD-fed A7-Tg mice for 28 days (Figure 3a).

Figure 3.

Figure 3

Intracerebroventricular administration of TUDCA did not affect ER stress and Aβ levels in HFD-fed A7-Tg mice

(a) Schematic diagram of the study design. Female A7-Tg mice were fed with HFD from 3 months of age, and TUDCA (10 µg/day) or PBS (vehicle) was intracerebroventricularly administered using ALZET Osmotic Pumps for 28 days from 7–8 months of age. (b-d) Body weight (b), adipose tissue wet weight (c), and blood glucose levels (d) on day 28 after starting TUDCA treatment. (e-f) Immunoblot and densitomeric analyses of phosphorylation levels of eIF2α and JNK in the RIPA-soluble fractions of liver (e) and adipose tissue (f). (g) Immunoblot and densitomeric analyses of phosphorylation levels of eIF2α and JNK, and the levels of Grp78/BiP, CHOP in the TBS-soluble fractions of cerebral cortex. The results were analyzed as in Figure 2d. (h) The levels of TBS-soluble Aβ40 and Aβ42 in the cerebral cortices at 9 months of age were analyzed by ELISA. Data are mean ± SEM (HFD: n = 8, HFD-TUDCA: n = 9). *, p < 0.05, unpaired t-test.

Intraventricular administration of TUDCA decreased the blood glucose levels, but did not improve the HFD-induced obesity (Figure 3b–d). No change in UPR of the liver or adipose tissue of HFD-fed A7-Tg mice were observed (Figure 3e–f). In addition, UPR in the cerebral cortex also was not altered by intraventricular administration of TUDCA (Figure 3g). To confirm whether TUDCA reached effective concentrations in the brain, we evaluated the ER stress markers in the hypothalamus and found that the levels of phospho-JNK and Grp78/BiP were significantly reduced (Figure S2). Given that HFD-induced hypothalamic ER stress is known to affect the peripheral metabolic state (26, 34), this reduction of ER stress by intraventricular administration of TUDCA might have resulted in a decrease in blood glucose levels. Under these conditions, intraventricular administration of TUDCA did not reduce the levels of Aβ40 and Aβ42 in HFD-fed A7-Tg mice (Figure 3h). Taken together with the fact that HFD feeding did not enhance ER stress in the brain (Figure 2d), we reasoned that the central effect of TUDCA did not contribute much to the suppression of Aβ levels in the cerebral cortex of HFD-fed A7-Tg mice, and speculated that the effect on ER stress in the periphery was more important.

Peripheral administration of TUDCA improved age-related ER stress and metabolic abnormalities in A7-Tg mice

Both in humans and animal models, increasing adiposity and insulin resistance have been documented as the characteristics of aging. Furthermore, age-related decline in the UPR has also been suggested (35). We therefore wondered whether aging-related ER stress and the associated metabolic abnormalities might have contributed to the aggravation of amyloid pathology in the brain. To test this hypothesis, we examined the effects of TUDCA in A7-Tg mice raised on normal diet. Because A7-Tg mice require a long period of time, i.e., >12 months, by the accumulation of amyloid plaques, a long-term administration method was adopted. We administered TUDCA orally (1–6.5 mg/ml in drinking water) starting at 11 months of age and intraperitoneally in parallel starting at 14 months of age, and analyzed the mice at 15 months (Figure 4a).

Figure 4.

Figure 4

Peripheral administration of TUDCA improved age-related metabolic abnormalities and reduced peripheral ER stress

(a) Schematic diagram of the study design. TUDCA was administered to 11-month-old male A7-Tg mice by drinking water for 120 days with a gradual increase in concentration to avoid taste aversion (1 mg/ml for 60 days, 3 mg/ml for 7 days, 5 mg/ml for 14 days, 6.5 mg/ml for 39 days). For the last 31 days, TUDCA (250 mg/kg) or saline was administered intraperitoneally twice per day, 6 days per week, in parallel. (b-c) Body weight (b) and adipose tissue wet weight (c) on day 120 after starting TUDCA treatment. (d-f) Changes in the blood glucose levels (d) and area under the curve (AUC) (e) during ITT on day 97 or 100, and blood glucose levels before the test (f). (e-f) Immunoblot and densitometric analyses of phosphorylation levels of eIF2α and JNK in the RIPA-soluble fractions of liver (g) and adipose tissue (h). Data are mean ± SEM (ND: n = 8, ND-TUDCA: n = 7). *, p < 0.05; **, p < 0.01; ***, p < 0.001, unpaired t-test.

TUDCA treatment significantly decreased body weight and wet weight of adipose tissue in these aged mice (Figure 4b–c). Insulin sensitivity also was improved as demonstrated by the ITT, but blood glucose levels were not significantly decreased by TUDCA treatment (Figure 4d–f). Notably, the metabolic status of TUDCA-treated 15-month-old A7-Tg mice (body weight: 33.6 ± 1.0 g, adipose tissue wet weight: 0.73 ± 0.06 g, area under the curve (AUC) for ITT: 8691 ± 374 mg/dl) was improved to levels equivalent to those in 9-month-old ND-fed A7-Tg mice (body weight: 31.8 ± 1.1 g, adipose tissue wet weight: 0.76 ± 0.10 g, AUC for ITT: 9755 ± 599 mg/dl, see Figure 1).

We next examined the ER stress in the peripheral tissues of these mice. In contrast to the results of HFD-fed A7-Tg mice (Figure 1), TUDCA treatment on 15-month-old A7-Tg mice did not alter the expression of UPR markers in the liver (Figure 4g). In contrast, the levels of phospho-JNK were significantly decreased, and phospho-eIF2α also showed a decreasing trend in the adipose tissue (Figure 4h). These results suggest that ER stress in adipose tissue, rather than that in liver, contributed to the age-related metabolic abnormalities, which can be ameliorated by TUDCA treatment.

Peripheral administration of TUDCA reduced amyloid deposition in the brain of 15-month-old A7-Tg mice

We then evaluated the effects of TUDCA on age-dependent amyloid accumulation in the brains of 15-month-old A7-Tg mice. Biochemical analyses revealed that the levels of insoluble Aβ40 and Aβ42 in the cerebral cortex were significantly decreased by TUDCA treatment (Figure 5a). Immunohistochemical analyses showed that Aβ plaques were significantly reduced in the piriform and cerebral cortices (Figure 5b–c). Aβ deposition in the hippocampus also showed a tendency to decrease (Figure 5d). Analyses of proteins related to Aβ production in the brains of this experimental group showed that TUDCA treatment caused a downward trend in the level of CTFβ, but no significant change was observed (Figure S3a). The UPR activities of the cerebral cortex was not changed by TUDCA treatment (Figure 5e). Overall, the reduction of peripheral ER stress and improvement of metabolism during aging by TUDCA treatment also attenuated the formation of amyloid pathology in the brain.

Figure 5.

Figure 5

Peripheral administration of TUDCA reduced amyloid deposition in 15-month-old A7-Tg mice

(a) The levels of SDS-insoluble/formic acid-soluble Aβ40 and Aβ42 in the cerebral cortices of 15-month-old A7-Tg mice. (b-d) Immunohistochemical analyses of 15-month-old A7-Tg mouse brains using an anti-Aβ (82E1) antibody. Representative images of brain regions including the piriform cortex (b), parietal cortex and cingulate gyrus (c), and hippocampus (d) are shown. The accompanying graphs represent the quantitative results of amyloid deposition in percentage of the area covered by Aβ immunoreactivity (e) Immunoblot and densitomeric analyses of phosphorylation levels of eIF2α and JNK, and the levels of Grp78/BiP, CHOP in the RIPA-soluble fractions of cerebral cortex. Data are mean ± SEM (ND: n = 8, ND-TUDCA: n = 7). *, p < 0.05; ***, p < 0.001, unpaired t-test. Scale bars: 1.0 mm.

TUDCA treatment caused dietary restrictionlike expression changes both in the peripheral tissues and brain

The effects of TUDCA observed in this present study, i.e., inhibition of metabolic abnormalities and amyloid pathology associated with obesity/T2DM and aging, were similar to those caused by dietary restriction (11, 12, 13). Because dietary restriction has been documented to ameliorate the age-related abnormalities in several species through increased sirtuin expression and authophagy (36, 37), we investigated the expression of Sirt1 and genes related to autophagy, e.g. Map1lc3a and Becn1, in 15-months-old A7-Tg mice.

In the liver, peripheral TUDCA treatment showed a tendency to increase Sirt1 mRNA (Figure S3b). In adipose tissue, mRNA expression of Becn1 and Sirt1 was increased, and Map1lc3a showed an increasing trend (Figure S3c). In the hippocampus, TUDCA treatment increased the mRNA expression levels of Map1lc3a, Becn1, and Sirt1 (Figure S3d). Furthermore, protein expression analysis showed that the LC3B-II/LC3B-I ratio, which indicates activation of autophagy, and the levels of Sirt1 and its substrate, PGC-1α (Figure S3e) were increased in the cerebral cortex of 15-month-old A7-Tg mice. Taken together, we reasoned that reducing ER stress in the peripheral tissues by systemic administration of TUDCA has effects that mimic dietary restriction both on the peripheral tissues and the brain, which in turn might reduce brain Aβ accumulation.

Discussion

Besides causing metabolic disturbances systemically, HFD feeding has been shown to promote Aβ accumulation in the brain in mouse models of AD (9, 11, 12). Here, we showed for the first time that intraperitoneal administration of TUDCA ameliorates not only the metabolic abnormalities caused by HFD, but also the concomitant increase in brain Aβ pathology, in A7-Tg mice. The most probable mechanism of TUDCA action would be that its chaperone activity reduced ER stress in the peripheral tissues, thereby ameliorating metabolic abnormalities such as obesity and insulin resistance, and consequently alleviating brain amyloid pathology. This hypothesis is consistent with the previous observations that Aβ accumulation is reversibly suppressed when HFD-dependent peripheral metabolic abnormalities are improved by dietary switching (11, 12, 13). Importantly, we showed that even under continuous HFD feeding, TUDCA treatment improved metabolism and lowered Aβ to a level similar to that in the ND diet group.

Since TUDCA is a brain-penetrating compound that has been shown to be neuroprotective through its anti-apoptotic effects (33, 38), another possibility for the mechanism of action is that central ER stress may have been targeted to reduce Aβ levels. Some studies in human AD postmortem brains have reported findings suggestive of increased ER stress, and the link between Aβ-induced toxicity and ER stress has been reported in various experimental models (39, 40). Thus, central ER stress may be augmented as a feedback mechanism for the pathological progression of AD, which may further contribute to the exacerbation of AD pathology. Furthermore, metabolic overload has been suggested to increase brain ER stress, especially in the hypothalamus, the latter being exposed to peripheral circulation (26, 34). Several studies have reported HFD-dependent UPR enhancement in brain regions including the hippocampus and cerebral cortex (41, 42). In our experiment, HFD feeding increased ER stress in the liver and adipose tissue, which was lowered by TUDCA. However, neither HFD feeding nor TUDCA treatment altered the UPR signaling activities in the cerebral cortex. Our results may have differed from those previously reported due to multiple factors, e.g., differences in the nutritional composition of the diet, the rearing environment, and the rate of pathological progression that varies among model animals. Nevertheless, our data may suggest that the cerebral cortex is less prone to elevated ER stress due to metabolic overload. Furthermore, even in conditions where the UPR activity was not increased, the Aβ pathology was exacerbated by HFD feeding. Thus, it may be reasonable to speculate that cortical ER stress is not the major culprit for the HFD-induced Aβ accumulation. Moreover, the finding that central administration of TUDCA did not alter brain Aβ levels supports the lack of interdependence between ER stress in the brain and HFD-induced Aβ accumulation. Although the UPR in the hypothalamus was significantly reduced, it cannot be ruled out that TUDCA diffused into the cerebral cortex in this administration paradigm may not have reached a sufficient concentration to exert an effect on AD pathology.

Aging is the greatest risk factor of AD. In our study, TUDCA ameliorated not only the diet-dependent but also the age-related metabolic deterioration, and suppressed amyloid accumulation. In 15-month-old A7-Tg mice, unlike HFD-fed A7-Tg mice, TUDCA did not alter the expression of UPR marker proteins in the liver, but reduced the levels of phospho-JNK and phspho-eIF2α in adipose tissues. It has been documented that diet-induced obese mice had a greater infiltration of macrophages and more pro-inflammatory immune cells in the liver than in aged obese mice, whereas adipose tissues showed similar levels of cytokine changes (43), which is consistent with our findings, prompting us to speculate that suppression of stress in the adipose tissue may have ameliorated the age-related, systemic metabolic deterioration.

In a series of studies using APP/PS1 mice, Rodrigues et al. have shown that treatment with TUDCA reduced Aβ production, suppressed amyloid accumulation, and prevented cognitive impairments (44, 45, 46). However, a reduction in amyloid deposits by TUDCA has been observed in APP/PS1 mice at a young age, without significant changes in body weight (45). Furthermore, it has previously been reported that intraperitoneal administration of TUDCA to young lean mice did not affect peripheral metabolic parameters (25). These results do not support the hypothesis that the inhibitory effect of TUDCA on Aβ accumulation is due to amelioration of the systemic metabolic abnormalities. However, it should be noted that ER stress might have been upregulated only in the brains of AD model mice that overexpress presenilin 1 together with APP, including APP/PS1 mice, raising serious concerns about its use in the study of ER stress (47, 48). Accordingly, upregulation of ER stress has not been described in other AD model mice, e.g. Tg2576, APP23, and AppNL-G-F mice (48, 49, 50, 51). Thus, the effect of TUDCA on amyloid reduction in APP/PS1 mice might be attributable, at least in part, to the reduction of central ER stress. Future studies on the effects of TUDCA in young A7-Tg mice will better address these issues.

We found that the ratio of LC3BII/LC3BI and the expression of Sirt1 and PGC-1α are factors that are altered both in the periphery and brain upon TUDCA-treatment in A7-Tg mice. These molecules are involved in the molecular pathways that play an important role in the dietary restriction that delays the onset of many chronic diseases such as obesity, diabetes, and AD, as well as the anti-aging effects of its mimetic, resveratrol (52, 53). Sirt1 activation, or acetylation of PGC-1α by Sirt1, has been suggested to alter Aβ levels in the brain (54, 55, 56). In addition, increased autophagy has been suggested to reduce Aβ levels (57, 58). This suggests that TUDCA may regulate Aβ pathology by suppressing ER stress in the periphery, thereby exerting a dietary restriction-like effect. Which of the processes underlying Aβ accumulation, i.e., production, clearance or aggregation, were altered by TUDCA is yet to be clarified. The levels of CTFβ, an indicator of β-secretase activity, tended to be decreased by TUDCA in HFD-fed A7-Tg mice, suggesting that reduced Aβ production may contribute at least in part to the anti-amyloid effect. On the other hand, we previously showed that HFD feeding decreases the clearance of Aβ in the brain interstitial fluid (11). Since TUDCA ameliorated the adverse effects of HFD on the systemic metabolism, it is also possible that Aβ clearance was improved accordingly. Further studies are needed to elucidate the molecular link between the peripheral metabolism and signal changes in the brain, and brain Aβ dynamics.

Overall, our results suggest a therapeutic potential of TUDCA in suppressing obesity/diabetes-induced Aβ accumulation. Recent progress in imaging biomarker research has revealed that amyloid accumulation occurs in the brains of AD patients decades before the onset of dementia (59). Thus, preclinical stage of pathological progression may be a critical period for disease prevention. Our results showed that interventions in the periphery at the early stage of AD pathology formation may be effective in counteracting Aβ accumulation in the brain. Considering the biosafety and its ability to inhibit apoptosis and neuroinflammation (38), TUDCA is expected to be a multifaceted prevention strategy of AD.

Footnotes

How to cite this article: T. Ochiai, T. Nagayama, K. Matsui et al. Tauroursodeoxycholic Acid Attenuates Diet-Induced and Age-Related Peripheral Endoplasmic Reticulum Stress and Cerebral Amyloid Pathology in a Mouse Model of Alzheimer's Disease. J Prev Alz Dis 2021; https://doi.org/10.14283/jpad.2021.33

Contributor Information

Tomoko Wakabayashi, Email: tomoko-wakabayashi@umin.ac.jp.

Takeshi Iwatsubo, Email: iwatsubo@m.u-tokyo.ac.jp.

Supplementary Materials

Supplementary material is available for this article at https://doi.org/10.14283/jpad.2021.33 and is accessible for authorized users.

Tauroursodeoxycholic acid attenuates diet-induced and age-related peripheral endoplasmic reticulum stress and cerebral amyloid pathology in a mouse model of Alzheimer's disease

mmc1.pdf (753.8KB, pdf)

Funding: This work was supported by AMED under Grant Number JP20dm0107056, and JSPS KAKENHI Grant Number JP20H00525.

Declaration of Competing Interest: T.O. is an employee of Kaken Pharmaceutical Co., LTD. All other authors declare no conflict of interests.

References

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Tauroursodeoxycholic acid attenuates diet-induced and age-related peripheral endoplasmic reticulum stress and cerebral amyloid pathology in a mouse model of Alzheimer's disease

mmc1.pdf (753.8KB, pdf)

Articles from The Journal of Prevention of Alzheimer's Disease are provided here courtesy of Elsevier

RESOURCES