Skip to main content
Cell Reports Medicine logoLink to Cell Reports Medicine
. 2025 Jun 13;6(7):102192. doi: 10.1016/j.xcrm.2025.102192

Combined inhibition of KAT6A/B and Menin reverses estrogen receptor-driven gene expression programs in breast cancer

Sarah Naomi Olsen 1, Bryn Anderson 1, Charlie Hatton 1, Zhengtao Chu 2, Christopher Simpkins 3, Yanhe Wen 1, Wallace Bourgeois 1, Elena L Haarer 1, Myles Brown 4,5, Rinath Jeselsohn 4,5, Alana L Welm 2, Eneda Toska 3, Scott A Armstrong 1,6,
PMCID: PMC12281420  PMID: 40516531

Summary

KAT6A is a histone acetyltransferase that is emerging as a therapeutic target in cancer, including estrogen receptor-positive (ER+) breast cancer. Here, we perform CRISPR screens to identify the chromatin adaptor Menin as a regulator of KAT6A/B inhibitor response. Co-treatment with KAT6A/B and Menin inhibitors has synergistic anti-proliferative effects in ER+, but not ER−, breast cancer lines. Our data reveal that KAT6A and Menin-KMT2A cooperatively regulate ER-driven gene expression via direct effects on ESR1 expression and co-localization at ER target genes. Combined KAT6A/B and Menin inhibition displaces KAT6A and Menin-KMT2A from promoters of ER-driven genes leading to selective RNA polymerase II chromatin loss at these loci. Importantly, combined KAT6A/B and Menin inhibition is effective in ER+ patient-derived xenograft models and in multiple models of endocrine resistance. KAT6A/B and Menin inhibitors are currently in clinical trials and have shown manageable toxicity profiles, underscoring the potential therapeutic relevance for ER+ breast cancer.

Keywords: Menin, KAT6A, estrogen receptor, ER, chromatin, breast cancer

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • KAT6A/B and Menin are targetable co-dependencies in ER+ breast cancer

  • KAT6A and Menin-KMT2A cooperatively regulate ER-driven gene expression

  • KAT6A and Menin-KMT2A maintain RNA Pol II at promoters of ER target genes

  • Co-treatment of KAT6A/B and Menin inhibitors has anti-tumor effects in PDX models


Olsen et al. identify the chromatin-associated protein Menin as an important regulator of KAT6A/B inhibitor sensitivity in ER+ breast cancer. Mechanistically, KAT6A and Menin-KMT2A regulate ER-driven genes. Combined treatment with KAT6A/B and Menin-KMT2A inhibitors cooperates in endocrine-sensitive and endocrine-resistant models, highlighting the translational relevance of this combination therapy.

Introduction

In ∼70% of breast cancers, estrogen receptor (ER) is expressed and functions as a transcription factor, regulating cell growth and tumor progression.1,2 Inhibiting ER is the mainstay treatment for ER-positive (ER+) breast cancer and includes selective ER modulators (SERMs), aromatase inhibitors (AIs), and selective ER degraders (SERDs). Despite the clinical benefit, resistance to endocrine therapies emerges in virtually all patients with metastatic disease, and breast cancer remains the second leading cause of cancer-related death in women, with ∼50% of mortalities arising from ER+ tumors.3 An increasing number of endocrine resistance mechanisms have been reported, including somatic alterations and epigenetic changes.4 In many cases, ER signaling remains active without estrogen and/or in the presence of antiestrogens, driving gene expression and tumor growth. This continued reliance on ER signaling, even in therapy-resistant settings, suggests that targeting chromatin complexes that mediate ER-driven transcription may offer an alternative therapeutic strategy.

One such complex implicated in regulating ER signaling is the KAT6 complex.5,6,7 KAT6A and its paralog KAT6B belong to the MYST (MOZ, Ybf2, Sas2, Tip60) family of histone acetyltransferases. KAT6A is amplified and/or overexpressed in 15% of breast cancers and correlates with worse clinical outcome in ER+ tumors.5 While KAT6A can catalyze H3K9, H3K14, and H3K23 acetylation in different contexts,8,9,10 H3K23ac is the primary target in breast cancer cells.7 Recently, a highly potent and selective inhibitor of KAT6A/B, PF-9363 (also known as CTx-648), was shown to inhibit tumor growth in ER+ breast cancer models in vitro and in vivo.7 The related KAT6A/B inhibitor, PF-07248144, is under investigation in a phase 1 clinical study for advanced or metastatic breast, prostate, and lung cancer (NCT04606446).

Although targeting epigenetic proteins and transcriptional networks is a promising treatment modality, crosstalk and compensatory effects among chromatin complexes, histone modifications, and transcription factors present complexity.11 We hypothesized that dual targeting of chromatin regulators would enhance the effects of KAT6A/B inhibition, by inducing more robust effects on ER-directed chromatin state and transcription. To identify chromatin-associated proteins that regulate KAT6A/B inhibitor efficacy, we performed an epigenetic-focused CRISPR-Cas9-based functional genetic screen in ER+ breast cancer cells. MEN1 (encoding Menin) emerged as a top targetable co-dependency, with guides targeting MEN1 highly selected against upon PF-9363 treatment. Menin is a conserved nuclear factor that associates with chromatin and interacts with complexes including KMT2A (MLL1) and KMT2B (MLL2).12,13,14 MEN1 can function as a tumor suppressor, and inactivating germline mutations in MEN1 causes the tumor syndrome multiple endocrine neoplasia type 1.15,16 However, Menin can also support oncogenic cell proliferation, including in leukemia,14,17 prostate,18 and breast cancer.19 Recent studies showed that Menin is highly expressed in >50% of breast cancers and strongly associated with ER+ tumors.20 Over the past 5 years, several Menin inhibitors have entered clinical trials in leukemia and have shown significant clinical activity in phase 1/2 trials (reviewed by Wenge et al. and Freire et al.21,22). In November 2024, SNDX-5613 (revumenib) became the first Menin inhibitor to receive Food and Drug Administration (FDA) approval for relapsed refractory KMT2A-rearranged acute leukemia.

We found that KAT6A and Menin cooperatively regulate ER-driven gene expression. Combined therapeutic targeting of KAT6A/B and Menin led to synergistic anti-proliferative effects in models of endocrine-sensitive and -resistant ER+ breast cancer. Since both KAT6A/B and Menin inhibitors are in clinical trials with manageable toxicity profiles, this combination presents a tangible therapeutic strategy for ER+ breast cancer.

Results

KAT6A/B and Menin complexes are targetable co-dependencies in ER+ breast cancer

KAT6A/B inhibition has emerged as a promising treatment strategy in ER+ breast cancer, so we first investigated the effects of catalytic KAT6A/B inhibition using PF-9363 on cellular proliferation and global histone acetylation. In line with previously published reports,7 we found that PF-9363 treatment selectively inhibited proliferation in a panel of ER+ cells, namely MCF7 (luminal A), T47D (luminal A), ZR751 (luminal A), MDAMB361 (luminal B), and CAMA1 (luminal A), but not ER− cell lines, such as MDAMB231, SUM149PT, and SUM159PT (Figure S1A). Interestingly, sensitivity to PF-9363 did not correlate with KAT6A protein levels (Figure S1B) but was strongly associated with the presence of ER, suggesting ER as a potential biomarker for predicting PF-9363 sensitivity.

PF-9363 treatment reduced H3K23ac levels in both sensitive ER+ and resistant ER− cell lines, indicating similar target inhibition but selective requirement for KAT6A/B in ER+ cells only (Figure S1C). We observed no global effects on H3K27ac or H3K9ac upon PF-9363 treatment (Figure S1C). Effective inhibition of H3K23Ac was observed at doses as low as 1 nM PF-9363 (Figure S1D) and as early as 15 min after drug treatment, with maximal inhibition at 2 h (Figure S1E). To further characterize the temporal effects of KAT6A/B inhibition, we assessed the effects of PF-9363 on gene expression in MCF7 and T47D cells at three different time points (8, 48, and 96 h) using RNA sequencing (RNA-seq). PF-9363 induced significant gene expression changes (log2 fold change [FC] > 1, p < 0.05) early (8 h); however, in MCF7 cells, the number of differentially downregulated genes decreased over time (Figure S1F), likely due to compensatory mechanism. This is in line with previous reports that indicate that MCF7 cells exhibit relatively modest gene expression changes upon KAT6A/B inhibition.7 In T47D cells, prior studies established a role of KAT6A in regulating ER signaling and ER-driven gene expression.5,7 However, looking at hallmark estrogen response early genes,23 we found that many of the downregulated ER target genes at 8 h rebounded at 48 and 96 h (Figure S1G), suggesting similar compensatory responses.

To reduce these compensatory effects on gene expression and enhance PF-9363 efficacy, we sought to identify targetable chromatin-associated (epigenetic) complexes that cooperate with KAT6A/B by performing a CRISPR-Cas9-based functional genetic screen using a chromatin-focused guide RNA (gRNA) library24,25 in Cas9-expressing MCF7 cells (Figure 1A, left). We compared PF-9363 treatment to vehicle control on day 30 using the model-based analysis of genome-wide CRISPR-Cas9 knockout (MAGeCK)26 pipeline, which identifies both positively and negatively selected genes simultaneously. Using MAGeCK, we identified MEN1 as a top sensitizer to PF-9363 treatment (Figure 1A, right; Table S1). Functionally, we validated our screen results in three ER+ breast cell lines by inactivating MEN1 using two sgRNA and treating with increasing doses of PF-9363. We confirmed effective sgRNA-mediated MEN1 knockout in all three cell lines via western blotting (Figure S1H). Knockout of MEN1 significantly sensitized cells to PF-9363 treatment, with 5 to 10-fold shifts in thehalf-maximal inhibitory concentration (IC50) (Figure 1B).

Figure 1.

Figure 1

CRISPR screen uncovers functional interplay between KAT6A/B and Menin complexes

(A) (Left) CRISPR-Cas9-based screen to identify regulators of response to KAT6A/B inhibition (PF-9363). sgRNA, single-guide RNA; MOI, multiplicity of infection; NGS, next-generation sequencing; PD, population doublings. (Right) A combined gene score (β-score) of 4 sgRNA per gene was calculated using MAGeCK,26 comparing PF-9363 (50 nM, n = 3) vs. DMSO (n = 3) relative to day 0. β-scores were rank ordered and plotted (Table S1). MEN1 is highlighted in red.

(B) Viability of control cells (sgRNA targeting luciferase, sgLuc) or MEN1 knockout cells after 14 days of PF-9363 treatment, as percent DMSO.

(C) CRISPR-Cas9 competition assays of control cells (sgLuc) and RPA3 (positive control), KAT6A, KAT6B, BRPF1, and MEN1 knockout cells, monitoring sgRNA-RFP expression over time.

(D and E) Viability of control cells (sgLuc) and KAT6A (D) or KAT6B (E) knockout cells after 18 days of SNDX-5613 treatment, as percent DMSO.

(F) Viability after 14 days of drug treatment, as percent DMSO. PF-9363 dose response data are duplicated from Figure S1A.

(G and H) Synergy maps of MCF7 (G) and T47D (H) cells after 14 days of treatment with indicated dose matrices.

(I) Cell counts of MCF7 (left) and T47D (right) cells after 14 days of drug treatment, relative to DMSO.

(J) Viability of MCF7 (top) and T47D (bottom) cells after 8 days of drug treatment, as percent DMSO.

(K and L) Viability of MCF7 (left) and T47D (right) cells after 7 days with increasing doses of fulvestrant (K) and elacestrant (L) and co-treatment of DMSO, 50 nM PF-9363, and/or 200 nM SNDX-5613, as percent DMSO. Cells were pre-treated with DMSO, PF-9363, and/or SNDX-5613 for 5 days prior to treatment with fulvestrant/elacestrant.

(B–L) All data represent mean of 3 biological replicates ± SD.

We next evaluated the impact of genetic targeting of MEN1, KAT6A, and KAT6B, as well as BRPF1, a common subunit of both KAT6A and KAT6B acetyltransferase complexes.27 Upon validating sgRNA targeting KAT6A, KAT6B, and BRPF1 by western blotting (Figure S1I), we performed CRISPR-Cas9-based competition assays, using lentiviral vectors co-expressing an sgRNA and red fluorescence protein (RFP) in four different Cas9-expressing human ER+ breast cancer cell lines (MCF7, T47D, CAMA1, and MDAMB361). While sgRNAs targeting MEN1 were strongly depleted across all four cell lines, the effects of sgRNAs targeting KAT6A versus KAT6B were more nuanced (Figure 1C). In T47D and CAMA1 cells, only sgRNAs targeting KAT6A were strongly depleted, while, in MCF7 and MDAMB361 cells, individual KAT6A or KAT6B knockout had more modest effects (Figure 1C). However, guides targeting BRPF1 were depleted across all cell lines, suggesting that KAT6A and KAT6B might be able to compensate for each other in MCF7 and MDAMB361 cells. Indeed, in MCF7 and MDAMB361 cells, only combined inactivation of KAT6A and KAT6B had strong anti-proliferative effects, while, in T47D cells, inactivation of KAT6A alone had the same effect as combined inactivation of KAT6A and KAT6B (Figures S1J and S1K). Interestingly, only targeting KAT6A sensitized cells to Menin inhibition (SNDX-5613, revumenib) (Figure 1D), while targeting KAT6B had little effect (Figure 1E). Similarly, analyzing publicly available data from The Cancer Genome Atlas (TCGA) revealed that ER+ tumors with co-high levels of MEN1 and KAT6A were significantly associated with more advanced disease compared to tumors with co-low levels of MEN1 and KAT6A (stage III vs. stage I, Fisher’s exact test p = 0.01). However, the same was not true for tumors with co-high levels of MEN1 and KAT6B compared to tumors with co-low levels of MEN1 and KAT6B (stage III vs. stage I, Fisher’s exact test p = 0.3). Collectively, these findings indicate that, while in some cellular contexts KAT6A and KAT6B might compensate for each other to regulate proliferation, KAT6A is the primary paralog that cooperates with Menin and regulates sensitivity to Menin inhibition.

To further investigate the cooperativity of KAT6A and Menin inhibition, we treated a panel of ER+ breast cancer cell lines with increasing doses of PF-9363 and SNDX-5613 or constant 100 nM SNDX-5613 and increasing doses of PF-9363. While both SNDX-5613 and PF-9363 single-agent treatment had significant effects on proliferation, co-treatment resulted in the strongest overall anti-proliferative effect (Figure 1F). ZR751 cells were an exception to this, with no sensitivity to Menin inhibition. This cell line was also most sensitive to PF-9363 treatment, with an IC50 < 1 nM. Interestingly, ZR751 cells completely lack Menin protein (Figure S1L and previously published28), explaining the resistance to Menin inhibitors and suggesting that lack of Menin might mediate ZR751’s exquisite sensitivity to KAT6A/B inhibition.

We next formally assessed synergy in MCF7 (Figure 1G) and T47D (Figure 1H) cells with a 6-point dose curve of SNDX-5613 combined with a 4-point dose curve of PF-9363 and calculated Zero Interaction Potency (ZIP) synergy scores using SynergyFinder 3.0.29,30 SNDX-5613 demonstrated synergy with PF-9363 with synergy scores ≥10 across a broad range of doses in both cell lines. We further confirmed that combined Menin and KAT6A/B inhibition cooperated to reduce cell number by cell counting (Figure 1I). Phenotypic assessment of MCF7 and T47D cells treated with the inhibitors revealed that combined Menin and KAT6A/B inhibition induced more pronounced apoptosis (Figure S1M) and G1 arrest (Figure S1N) compared to single-agent treatment. Of note, combined Menin and KAT6A/B inhibition had comparable anti-proliferative effects to first- and second-generation SERDs as well as ER targeting proteolysis-targeting chimeras (PROTACs) (Figure 1J).

Finally, we assessed the effectiveness of the SNDX-5613+PF-9363 combination in the context of currently FDA-approved ER-targeting agents, specifically the SERDs fulvestrant (Figure 1K) and elacestrant (Figure 1L). Our data demonstrated that combined Menin and KAT6A/B inhibition further enhanced the sensitivity of MCF7 and T47D cells to SERD treatment. Collectively, our findings indicate that KAT6A and Menin complexes are targetable vulnerabilities in ER+ breast cancer cell lines, and combined therapeutic inhibition is highly synergistic across multiple models.

KAT6A/B and Menin cooperatively regulate ER-driven gene expression and chromatin accessibility

To understand how KAT6A/B and Menin inhibition synergize to suppress proliferation in ER+ breast cancer, we investigated gene expression and chromatin changes following single-agent or combined PF-9363+SNDX-5613 treatment. RNA-seq in MCF7 cells revealed that PF-9363 treatment induced more significant gene expression changes than SNDX-5613 treatment; however, the combination had the most dramatic effects, affecting the largest number of genes (Figures S2A and S2B; Table S2). Additionally, combined PF-9363+SNDX-5613 treatment induced more robust up- and downregulation of all differentially expressed genes (log2FC > 0.58, p < 0.05, Table S2) compared to single-agent treatment (Figure 2A). Interestingly, PF-9363 and SNDX-5613 regulated largely non-overlapping gene sets (Figure S2C, log2FC > 0.58, p < 0.05). Gene set enrichment analysis (GSEA)31 demonstrated that PF-9363 or combined PF-9363+SNDX-5613 treatment induced gene expression programs highly enriched for ER signatures (Figure S2D, highlighted in red), in line with previous publications implicating KAT6A in ER regulation.5,7 Moreover, normalized enrichment score plots demonstrated canonical estrogen response signatures as top gene signatures to be affected by combined PF-9363+SNDX-5613 treatment (Figure S2E).

Figure 2.

Figure 2

KAT6A/B and Menin cooperatively regulate ER-driven gene expression and changes in chromatin accessibility

(A) Heatmap depicting Z scores of differentially expressed genes (log2FC > 0.58, p < 0.05, Table S2) in MCF7 cells following 96 h of 50 nM PF-9363 and/or 200 nM SNDX-5613 (n = 3 technical replicates).

(B) Heatmap depicting Z scores of differentially expressed genes (log2FC > 1, p < 0.05 −/+ E2 in DMSO-treated samples, Table S2) in MCF7 cells upon acute estradiol (E2) stimulation (100 nM, 6 h) following 72 h of estrogen starvation. Cells were treated/co-treated with 50 nM PF-9363 and/or 200 nM SNDX-5613 for 96 h total (n = 3 technical replicates).

(C) Genome-wide rank-ordered heatmap of chromatin accessibility peaks (ATAC peak −3 kb/+3 kb) in MCF7 cells following 48 h of treatment with 50 nM PF-9363 and/or 200 nM SNDX-5613 (n = 2 technical replicates, replicate 1 shown, see Figure S2K for replicate 2).

(D) Percent of peaks with gain or loss of chromatin accessibility (reads per kilobase [rpk] drug/DMSO FC < 0.5 or FC > 2) following 48 h of treatment with 50 nM PF-9363 and/or 200 nM SNDX-5613 in MCF7 cells (Table S3). Top motifs identified by HOMER32 at regions with loss of accessibility (rpk drug/DMSO FC < 0.5). Motif and p value are indicated.

To validate these results, we genetically inactivated MEN1, KAT6A, and KAT6B in MCF7 and T47D cells using CRISPR-Cas9. GSEA identified estrogen-induced gene sets as the top two gene signatures to be negatively regulated by MEN1 knockout (Figure S2F). Interestingly, KAT6A inactivation induced more pronounced enrichment for ER signatures compared to KAT6B inactivation, which exhibited only modest effects (Figure S2F). Consistent with our findings using small-molecule inhibitors, canonical hallmark estrogen response gene sets23 were negatively regulated by combined MEN1+KAT6A knockout (Figures S2G and S2H). Moreover, in line with our findings that KAT6A is the predominant paralog that cooperates with Menin (Figures 1D and 1E), combined MEN1+KAT6A inactivation had more pronounced effects on hallmark estrogen response genes23 compared to combined MEN1+KAT6B knockout (Figure S2I).

Due to the strong association of PF-9363+SNDX-5613-induced gene expression changes with ER signaling, we next assessed the effects of KAT6A/B and/or Menin inhibition specifically on the ER-regulated transcriptome. We performed RNA-seq upon estrogen-starvation and acute estradiol (E2) stimulation in the context of single-agent or combination treatment. Looking at all E2-induced gene expression changes in the DMSO-treated samples (log2FC > 1, p < 0.05, Table S2), we found that, while PF-9363 or SNDX-5613 treatment attenuated the estrogen response, combined treatment had much more profound effects, blunting almost all E2-mediated changes (Figure 2B).

To understand the chromatin changes underlying the observed effects on ER-directed gene expression, we assessed chromatin accessibility upon KAT6A/B and/or Menin inhibition via assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq).33,34 We detected around 90,000 peaks in our vehicle control, with ∼20% of all peaks associated with promoter regions (transcriptional start site [TSS] −1 kb/+3 kb, Figure S2J). Single-agent or combined PF-9363 and/or SNDX-5613 treatment had no significant effects on global chromatin accessibility (Figure 2C, replicate 1; Figure S2K, replicate 2). Overall, there were more peaks that lost accessibility than peaks that gained accessibility upon combination treatment, but only a small portion, ∼10% of all ATAC peaks, exhibited significant differential accessibility (FC reads per kilobase [rpk] drug/DMSO <0.5 or >2, Figure 2D; Table S3). Motif analysis of peaks that lost accessibility upon treatment showed highly significant enrichment for the estrogen response element (ERE) as well as Forkhead and GATA3 binding motifs (Figure 2D), in line with the observed ER-associated gene expression changes. Similarly, combined KAT6A/B and Menin inhibition induced changes in chromatin accessibility at only a small subset of enhancer-associated peaks (<10% of all enhancer-associated peaks, Figure S2L; Table S3). Again, regions that lost accessibility after treatment were enriched for ERE as well as Forkhead and GATA3 binding motifs (Figure S2L). It is of interest to note that FOXA1 loss also emerged as a sensitizer to KAT6A/B inhibition in our CRISPR screen (Figure 1A), underscoring the close connection and potential interplay between the ER complex and KAT6A/B.

PF-9363 and SNDX-5613 cooperatively suppress ESR1 expression

One potential explanation for the selective effects of KAT6A/B and Menin inhibition at ER target genes is the direct regulation of ESR1 expression. Inhibition of KAT6A/B and Menin reduced ESR1 transcript and ERα protein levels in T47D (Figure 3A) and MCF7 (Figure 3B) cells, consistent with previous work.5,7,28 The combination of PF-9363+SNDX-5613 further decreased ERα protein levels, similar to the degradation induced by fulvestrant (Figures 3A and 3B). Chromatin immunoprecipitation sequencing (ChIP-seq) revealed that PF-9363 alone had only modest effects on global ER chromatin occupancy, but combined PF-9363+SNDX-5613 treatment significantly reduced E2-induced ER recruitment to chromatin (Figure 3C), as well as ER occupancy at key ER target loci (Figure 3D).

Figure 3.

Figure 3

PF-9363 and SNDX-5613 cooperatively suppress ESR1 expression

(A and B) Immunoblot analysis of ERα and β-actin in T47D (A) and MCF7 (B) cells following treatment with 50 nM PF-9363 and/or 200 nM SNDX-5613 or 100 nM fulvestrant (top). Matched expression of ESR1, normalized to GAPDH (bottom). Data represent mean ± SD of 3 biological replicates.

(C) Genome-wide rank-ordered heatmap of ER ChIP-seq signal and corresponding inputs (peak −3 kb/+3 kb) in MCF7 cells upon acute E2 stimulation (100 nM, 3 h) following 72 h of estrogen starvation. Cells were co-treated with 50 nM PF-9363 and/or 200 nM SNDX-5613 for 24 h.

(D) Gene tracks of read count-normalized ChIP-seq signal at indicated genes in MCF7 cells, treated as described in (C). Visualized and read count normalized using the Integrative Genomics Viewer (IGV).35,36

(E) Viability of T47D (top) and MCF7 (bottom) cells after 10 days, as percent DMSO in control cells or ESR1 overexpression cells (N-GFP-ESR1). Data represent mean of 3 independent replicates ± SD.

(F) Violin plot depicting average E2-induced gene expression changes (log2FC > 1, p < 0.05 −/+ E2 in DMSO-treated samples, Tables S2 and S4) in MCF7 control (uninfected, data from Figure 2B) and ESR1 overexpression (N-GFP-ESR1) cells. Cells were stimulated with E2 (100 nM, 6 h) following 72 h of estrogen starvation. Cells were treated/co-treated with 50 nM PF-9363 and/or 200 nM SNDX-5613 for 96 h total (n = 3 technical replicates). Statistical comparisons were performed with one-way ANOVA with Tukey’s multiple comparisons test. ∗∗∗∗p < 0.0001, ∗∗∗p < 0.001.

To assess whether the anti-proliferative and gene expression effects of PF-9363 and SNDX-5613 were exclusively mediated by reduced ESR1, we overexpressed ESR1 under an exogenous spleen focus-forming virus (SFFV) promoter, fused to an N-terminal GFP tag (N-GFP-ESR1) in T47D and MCF7 cells. We confirmed that ESR1 overexpression had no effect on cell proliferation (Figure S3A) and that exogenous GFP-tagged ERα was bound to chromatin at known ER target loci (Figure S3B). As expected, treatment with PF-9363 and/or SNDX-5613 had no effect on expression of exogenous ESR1 transcript and exogenous ERα protein levels (Figures S3C and S3D). ESR1 overexpression led to a slight decrease in sensitivity to PF-9363 monotherapy but had no impact on the effects of the combination treatment (Figure 3E), indicating that exogenous ER alone cannot rescue the anti-proliferative effects of dual KAT6A/B and Menin inhibition.

Next, we assessed if ESR1 overexpression was able to rescue PF-9363’s and SNDX-5613’s effects on ER-mediated gene expression. Looking at all E2-induced gene expression changes in N-GFP-ESR1 DMSO-treated samples (log2FC > 1, p < 0.05, Table S4), we found that PF-9363 and SNDX-5613 treatment attenuated the effects of acute E2 stimulation, while the combination had more profound effects (Figure S3E), mirroring our findings in wild-type cells (Figure 2B). However, directly comparing the effects of KAT6A/B and Menin inhibition in wild-type and ESR1 overexpression cells demonstrated that ESR1 overexpression was able to partially rescue the effects of PF-9363 and/or SNDX-5613 on E2-induced gene expression changes (Figure S3F). In wild-type cells, quantifying the effects of acute E2 stimulation on upregulated genes indicated that on average E2 treatment induced genes with a log2FC of 1.53 (Figure 3F). Single-agent treatment blunted the upregulation of these genes, with an average log2FC of 1.01 (PF-9363) and 1.24 (SNDX-5613). Combined PF-9363+SNDX-5613 almost completely prevented any significant E2-induced upregulation with an average log2FC of 0.58. In the context of ESR1 overexpression, these trends were similar, but with reduced magnitude, whereby E2 treatment induced genes with a log2FC of 1.56, and the combination blunted the upregulation of those genes with an average log2FC of 0.99 (Figure 3F). These findings indicate that exogenous ESR1 can only partially rescue the effects of PF-9363 and SNDX-5613 on gene expression. Consequently, PF-9363 and SNDX-5613 likely affect gene expression and proliferation partly through direct effects on ESR1 and partly through additional mechanisms.

KAT6A and Menin-KMT2A complexes co-localize at promoters of ER target genes

We hypothesized that, in addition to directly affecting ESR1 expression, KAT6A and Menin mediate ER signaling by co-occupying promoter regions of ER target genes. To that end, we characterized chromatin occupancy of KAT6A, Menin, and their respective complex members BRPF1 and KMT2A. In both T47D and MCF7 cells, the majority of Menin, KMT2A, KAT6A, and BRPF1 peaks were enriched at promoter regions (TSS −1 kb and +3 kb TSS, Figure 4A). KAT6A had fewer peaks (Figure 4A), likely due to inefficient antibody pull-down rather than lack of chromatin binding. Peak overlap analysis showed notable co-localization of all four proteins at promoters (Figure S4A), and promoter-associated chromatin binding was highly correlated across T47D and MCF7 cells (Figure S4B), indicating conserved chromatin occupancy patterns in ER+ breast cancer models.

Figure 4.

Figure 4

KAT6A and Menin-KMT2A complexes co-localize at promoters of ER target genes

(A) Peak number and genomic distribution in T47D (top) and MCF7 (bottom) cells upon ChIP-seq using the indicated antibodies. Promoter regions defined as TSS −1 kb to +3 kb.

(B) ChIP-seq gene tracks at the indicated genes in T47D (top) and MCF7 (bottom) cells, visualized using the Integrative Genomics Viewer (IGV).35,36

(C) Box and whiskers plot (whiskers min to max) of copy-number variant (CNV)-normalized rpk at promoters (TSS −1 kb to +3 kb) in MCF7 cells. Genes that were down- (DN) and upregulated (UP) upon drug treatment are defined in Figure 2A (log2FC > 0.58, p < 0.05, Table S2).

(D and E) Genome-wide rank-ordered heatmap of KMT2A (D) and KAT6A (E) ChIP-seq signal and corresponding inputs (peak -3 kb/+3 kb) in MCF7 cells (left). Box and whisker plot (whiskers min to max) of read count-normalized rpk at promoters (TSS −1 kb to +3 kb) of downregulated genes (defined in Figure 2A, log2FC < −0.58, p < 0.05; Table S2) in MCF7 cells following 24 h of treatment with 50 nM PF-9363 and/or 200 nM SNDX-5613 (right).

(F) Gene tracks of read count-normalized ChIP-seq signal at the indicated genes in MCF7 cells, following 24 h of treatment with 50 nM PF-9363 and/or 200 nM SNDX-5613. Visualized and read count normalized using IGV.35,36

(G) ChIP-qPCR of KMT2A, Menin, KAT6A, and BRPF1 at the indicated genes, as percent input following 24 h of drug treatment.

(H) Gene tracks of read count-normalized RNA Pol II ChIP-seq signal at the indicated genes in MCF7 cells, following 24 h of treatment with 50 nM PF-9363 and/or 200 nM SNDX-5613. Visualized and read count normalized using IGV.35,36

(I) ChIP-qPCR of RNA Pol II at the indicated genes, as % input relative to GAPDH following 24 h of drug treatment.

(C, D, and E) Statistical comparisons were performed with one-way ANOVA with Tukey’s multiple comparisons test. ∗∗∗∗p < 0.0001, ∗∗p < 0.01, ∗p < 0.05; ns, not significant. (G and I) Data represent mean ± SD of 3 biological replicates.

Next, we assessed chromatin occupancy specifically at ER-regulated genes. Representative ChIP-seq tracks revealed co-localization of Menin, KMT2A, KAT6A, and BRPF1 at canonical ER target genes and the ESR1 locus in MCF7 and T47D cells (Figure 4B). Quantification of promoter occupancy showed enrichment of all four proteins at hallmark estrogen response early and late genes,23 compared to genome-wide binding (Figure S4C), suggesting a specific role in ER-driven gene regulation. To assess this more formally, we analyzed promoter binding of Menin, KMT2A, KAT6A, and BRPF1 at genes that are sensitive to treatment with PF-9363 and/or SNDX-5613, specifically genes that are down- and upregulated upon drug treatment (identified in Figure 2A; Table S2). Genes that were downregulated upon treatment with the inhibitors had a particularly high load of Menin-KMT2A and KAT6A-BRPF1 complexes (Figure 4C), unlike genes that were upregulated, supporting the idea that highly loaded loci rely on these complexes to maintain gene expression.

To evaluate how drug treatment impacts chromatin binding of KAT6A and Menin complexes, we performed ChIP-seq after 24 h of PF-9363 and/or SNDX-5613. As seen previously in leukemia,37,38 Menin inhibitor treatment globally displaced Menin from chromatin (Figure S4D) while having no global effect on KMT2A occupancy (Figure 4D, left). However, at downregulated genes (identified in Figure 2A; Table S2), we observed locus-specific loss of KMT2A (Figure 4D, right). Similarly, PF-9363 treatment had no global effects on KAT6A occupancy but induced locus-specific KAT6A loss at genes downregulated with inhibitor treatment (Figure 4E). Only the PF-9363+SNDX-5613 combination effectively displaced both KAT6A and KMT2A complexes from chromatin (Figures 4D and 4E). Representative ChIP-seq tracks and ChIP-qPCR of the ESR1 locus and canonical ER target genes confirmed that SNDX-5613 treatment primarily induced KMT2A loss while PF-9363 treatment primarily induced KAT6A loss, and only the PF-9363+SNDX-5613 combination effectively displaced both complexes from chromatin (Figures 4F and 4G).

We next examined whether these chromatin changes correlated with histone modification changes. Western blotting revealed no cooperative reductions in H3K23ac or H3K9ac upon combined PF-9363+SNDX-5613 treatment (Figure S4E). To evaluate potential changes in a more locus-specific fashion, we performed ChIP-seq to assess H3K9ac and H3K4me3. Quantifying drosophila spike-in normalized ChIP signal (rpk)39 at promoters of genes that were downregulated upon PF-9363 and/or SNDX-5613 treatment (identified in Figure 2A; Table S2) revealed that H3K9ac levels were reduced upon 24 h of treatment with either PF-9363 or the combination (Figure S4F, left). However, the combination did not induce greater loss of H3K9ac than PF-9363 treatment alone. In contrast to histone acetylation, we saw no profound changes in H3K4me3 in any of our treatment conditions (Figure S4F, right). Collectively, these data suggest that histone modification changes do not fully account for the cooperative transcriptional repression seen with combined KAT6A/B + Menin inhibition.

To better understand the effects on gene expression, we assessed RNA polymerase II (RNA Pol II) occupancy by ChIP-seq. After 24 h of combined PF-9363+SNDX-5613 treatment, we observed pronounced RNA Pol II loss at ESR1 and canonical ER target genes. In contrast, RNA Pol II occupancy at housekeeping genes (ACTB and GAPDH, Figure 4H) remained unchanged, and no global reductions were observed (Figure S4G). Plotting the fold change of read count-normalized RNA Pol II ChIP signal of treatment versus DMSO further confirmed these findings: neither single-agent nor combination treatment had global effects (Figure S4H, left); however, at promoters of genes that are downregulated upon PF-9363 and/or SNDX-5613 treatment (identified in Figure 2A; Table S2) or hallmark estrogen response early genes,23 combined drug treatment robustly displaced RNA Pol II from chromatin (Figure S4H, middle and right). Notably, the PF-9363+SNDX-5613 combination induced significantly more RNA Pol II loss at these loci than single-agent treatment (Figure S4H, middle and right). These findings were further validated by ChIP-qPCR at ER targets (Figure 4I).

In summary, our findings demonstrate that KAT6A and Menin-KMT2A complexes co-localize at a subset of ER target genes. While treatment with PF-9363 displaced KAT6A and treatment with SNDX-5613 displaced KMT2A at ER targets, only the PF-9363+SNDX-5613 combination dislodged both KAT6A and KMT2A complexes from chromatin. This dual displacement correlates with significant loss of RNA Pol II occupancy at ER target genes, suggesting that KAT6A and Menin-KMT2A complexes can function redundantly to maintain RNA Pol II binding and transcription of ER-regulated genes. These findings offer a mechanistic explanation for the enhanced gene expression changes observed with combined KAT6A/B and Menin inhibition and underscore the cooperative role of these chromatin complexes in regulating ER activity.

KAT6A and Menin coordinately regulate ER-driven gene expression programs in ER+ organoid models

Three-dimensional (3D) organoid models from human tumors and patient-derived xenografts (PDXs) (termed PDxOs) have emerged as valuable model systems since they retain greater physiological relevance than two-dimensional (2D) cell lines.40 Previous studies have established a large collection of paired ER+ PDX and PDxO models with high fidelity to their original tumors and maintenance of functional ER.41 We evaluated the effects of KAT6A/B and Menin inhibition in two of these ER+ PDxOs, the ER+/progesterone receptor+ (PR+) invasive ductal carcinoma (IDC) model HCl-00342 and the ER+ invasive lobular carcinoma (ILC) model HCl-018.41 Both retained ERα expression (Figure S5A) and exhibited sensitivity to SERDs and ER-PROTACs (Figure S5B). We tested a 5-point dose curve of PF-9363 and SNDX-5613 as well as 3 doses of combined PF-9363+SNDX-5613. HCl-003 organoids showed moderate sensitivity to low PF-9363 and high SNDX-5613 doses but responded strongly to all combination doses (Figure 5A). HCl-018 organoids were highly sensitive to PF-9363 alone and showed enhanced anti-proliferative effects with combination treatment (Figures 5B and S5C).

Figure 5.

Figure 5

PF-9363 and SNDX-5613 demonstrate cooperative anti-tumor activity in ER+ patient-derived xenograft models

(A) Bright-field images of the ER+/PR+ PDxO HCl-003 after 14 days with the indicated treatment conditions, scale bar: 360 μm (left); organoid growth after 14 days of treatment, relative to DMSO (right).

(B) Organoid growth of the ER+ PDxO HCl-018 after 18 days of treatment, relative to DMSO.

(C) Heatmap depicting Z scores of differentially expressed genes (left, log2FC > 1, p < 0.05, Table S5) and hallmark estrogen response genes23 (middle and right) in the HCl-003 PDxO following 7 days of treatment with 50 nM PF-9363 and/or 200 nM SNDX-5613 (n = 3 technical replicates).

(D) Baseline-corrected tumor volume of the ER+ breast cancer HCl-018 PDX model41 (n = 4 mice per arm). Total treatment duration was 40 days, indicated by gray background. Shown are mean ± SEM.

(E) Log2FC in tumor volume at day 25 and day 50 compared to the start of treatment (day 0) of the HCl-018 PDX. Shown are individual tumors and the median for each treatment cohort.

(A and B) Data are represented as box and whiskers plot (whiskers min to max) of n = 6 technical replicates, and statistical comparisons were performed with one-way ANOVA with Tukey’s multiple comparisons test. ∗∗∗∗p < 0.0001, ∗∗∗p < 0.001, ∗∗p < 0.01; ns, not significant. (D and E) Statistical comparisons were performed with Kruskal-Wallis with Dunn’s multiple comparisons test. ∗∗∗∗p < 0.0001, ∗∗p < 0.01, ∗p < 0.05; ns, not significant.

To assess if the mechanism of action in PDxOs mirrored that in 2D models, we performed RNA-seq following single-agent and combination treatments. Like our cell line models, PF-9363 treatment induced more significant gene expression changes than SNDX-5613 treatment in PDxO models; however, the combination affected the largest number of genes (Figures S5D–S5G; Table S5). Downregulated genes (log2FC < −1, p < 0.05, Table S5) were enriched for hallmark estrogen response early/late23 and epithelial mesenchymal transition23 gene signatures, with more pronounced enrichment upon combination treatment (Figures S5H and S5I). Heatmap analysis confirmed that combined PF-9363+SNDX-5613 treatment had more robust effects on gene expression and hallmark estrogen response early/late gene sets23 compared to single-agent treatment in both the HCl-003 (Figure 5C) and the HCl-018 (Figure S5J) models. In summary, our findings in 3D PDxO models recapitulated what we saw in 2D cell lines (Figure 2), whereby KAT6A/B and Menin inhibition cooperated to reduce organoid growth and ER-driven gene expression programs.

Combined PF-9363+SNDX-5613 treatment demonstrates robust efficacy in ER+ breast cancer PDX models in vivo

We next evaluated the in vivo activity of PF-9363+SNDX-5613 in the ER+ ILC HCl-018 PDX model, derived from a brain metastasis of a patient treated with chemotherapy, tamoxifen, letrozole, and fulvestrant.41 Both PF-9363 and SNDX-3613 previously demonstrated in vivo efficacy, and pharmacokinetic/pharmacodynamic (PK/PD) properties for both compounds are well established.7,37,43 Engrafted mice (orthotopic tumor volume of ∼100 mm3) were treated with vehicle, PF-9363 (once a day [QD]), SNDX-5613 (0.1% chow), or the combination for 40 days. Monotherapies slowed tumor growth compared to vehicle, but only the combination halted tumor progression (Figure 5D), inducing consistent tumor shrinkage by day 25 that persisted 10 days post-treatment (Figure 5E). This tumor shrinkage was statistically significant compared to vehicle (p < 0.05), though not compared to monotherapies (Figure 5E). SNDX-5613 chow was well tolerated by the mice; however, due to the daily oral dosing of the PF-9363-treated mice, we observed some toxicity in the PF-9363 monotherapy and PF-9363+SNDX-5613 combination treatment arms (Figure S5K), which was mitigated by changing the dosing route and schedule to 5 days ON and 2 days OFF. Since no toxicity has been reported previously with PF-9363 monotherapy7 or the PF-9363+SNDX-5613 combination,44,45 the observed toxicity could be related to the high estrogen supplementation necessary for the HCl-018 tumor model.41 To address this, we performed a second PDX experiment with the ER+/PR+ IDC HCl-003 model at lower levels of estrogen supplementation. This model was derived from a treatment-naive primary tumor.42 Engrafted mice (orthotopic tumor volume of ∼100 mm3) were treated with vehicle (QD, 5 days ON, 2 days OFF), PF-9363 (QD, 5 days ON, 2 days OFF), SNDX-5613 (0.1% chow), or PF-9363 (QD, 5 days ON, 2 days OFF)+SNDX-5613 (0.1% chow) for 40 days. No toxicity or weight loss was observed with this dosing schedule (Figure S5L). All treatment groups reduced tumor growth compared to vehicle, with SNDX-5613 and combined PF-9363+SNDX-5613 treatment inducing significant tumor shrinkage (Figure S5M). However, because SNDX-5613 alone caused strong tumor regression, we could not assess additive effects of the combination in this model. Nonetheless, our in vivo results confirm that KAT6A/B and Menin inhibition—especially in combination—have potent anti-tumor activity in ER+ breast cancer PDX models, aligning with our in vitro findings.

Combined KAT6A/B and Menin inhibition is effective in models of endocrine resistance

Over the last two decades, numerous mechanisms of resistance to endocrine therapies have been identified. The three most common categories of acquired endocrine resistance are (1) mutations in ESR1; (2) alterations in signaling pathways, such as NF1 loss or ERBB2 amplifications; and (3) mutations in transcription factors, like FOXA1, MYC, and CTCF (reviewed by Will et al.46). While resistant to ER-targeting agents, many of these models still depend on ER-driven gene expression programs. Since KAT6A and Menin-KMT2A complexes cooperatively regulate ESR1 and ER target genes, we hypothesized that combined PF-9363+SNDX-5613 treatment would be effective across these resistance mechanisms.

ESR1 mutations occur in ∼3% of primary breast cancer but rise to 20%–40% in metastatic disease treated with antiestrogens.47,48,49,50 Most ESR1 mutations occur in the ligand-binding domain (LBD), and the common LBD mutation, Y537S, has been demonstrated to confer endocrine resistance and ligand-independent ER activity in various contexts.51,52,53 Using endogenous ESR1 Y537S knockin MCF7 cells,53 we confirmed resistance to fulvestrant and estrogen deprivation (Figures S6A and S6B), yet these cells remained sensitive to PF-9363 and SNDX-5613 single-agent and combination treatment (Figure 6A). Notably, combined KAT6A/B and Menin inhibition was able to prevent E2-induced upregulation of canonical ER target genes, while also significantly downregulating expression of ESR1 itself (Figure 6B). Similar effects were observed in isogenic, doxycycline (dox)-inducible HA-ESR1 Y537S models in T47D and MCF7 cells.53 Dox treatment conferred resistance to fulvestrant; however, cells remained sensitive to combined KAT6A/B and Menin inhibition, albeit slightly less sensitive than non-dox-treated control cells (Figure S6C). While PF-9363 and/or SNDX-5613 affected endogenous wild-type ERα protein levels, treatment did not reduce levels of Y537S mutant ERα (Figure S6D), further supporting our conclusion from Figure 3 that KAT6A and Menin-KMT2A regulate ER activity beyond ESR1 expression itself.

Figure 6.

Figure 6

Combined PF-9363+SNDX-5613 treatment is effective in multiple models of endocrine resistance

(A and B) Viability (A) and gene expression normalized to ACTB (B) of MCF7 control (wild-type ESR1) and endogenous knockin mutant ESR1 Y537S53 cells.

(C and D) Viability (C) and gene expression normalized to ACTB (D) of MCF7 non-targeting control (sgNT) and NF1 knockout cells (sgNF1-1 and sgNF1-2).49

(E and F) Viability (E) and gene expression normalized to ACTB (F) of MCF7 control cells (empty vector), FOXA1 wild-type, or mutant (F266L and SY242CS) overexpression cells.54 For gene expression, cells were treated with PF-9363 and/or SNDX-5613 in full media for 96 h.

(G) Organoid growth of the estrogen-independent HCl-040 PDxO subline after 21 days of treatment, relative to DMSO (left). Data are represented as box and whiskers plot (whiskers min to max) of n = 6 technical replicates (bottom). Statistical comparisons were performed with one-way ANOVA with Tukey’s multiple comparisons test. ∗∗∗∗p < 0.0001, ∗∗p < 0.01, ∗p < 0.05. Bright-field images, scale bar: 890 μm (right).

(H) Baseline-corrected tumor volume of the ESR1 Y537S PDX model (PDX1526)53,55 (n = 5 mice per arm for vehicle and single agents, n = 8 mice for combined PF-9363+SNDX-5613). Total treatment duration was 40 days, indicated by gray background. Shown are mean ± SEM.

(I) Log2FC in tumor volume at day 46 compared to the start of treatment (day 0) of the ESR1 Y537S PDX model (PDX1526).53,55 Shown are individual tumors and the median for each treatment cohort.

(A–F) Data represent mean of 3 biological replicates ± SD. (A, C, and E) Viability of cells after 14 days of drug treatment, as percent DMSO. (B and D) Cells were stimulated with E2 (100 nM, 6 h) following 72 h of estrogen starvation. Cells were treated/co-treated with PF-9363 and/or SNDX-5613 for 96 h. (H and I) Statistical comparisons were performed with Kruskal-Wallis with Dunn’s multiple comparisons test. ∗∗∗∗p < 0.0001, ∗∗p < 0.01, ∗p < 0.05; ns, not significant.

We next tested PF-9363 and SNDX-5613 in NF1-deficient cells, previously established using CRISPR-Cas9 editing.49 We confirmed NF1 protein loss (Figure S6E) and endocrine independence (Figure S6F) using two different sgRNAs. NF1 knockout cells were similarly sensitive to PF-9363 and SNDX-5613 treatment compared to our non-targeting control cells (sgNT), with comparable IC50 values (Figure 6C). Moreover, combined PF-9363+SNDX-5613 treatment was able to attenuate E2-induced expression of canonical ER target genes in NF1 knockout cells to the same extent as in control cells (Figure 6D).

Finally, we tested how FOXA1 mutations affected PF-9363 and SNDX-5613 sensitivity, using previously established cellular models,54 where FOXA1 overexpression and mutation conferred estrogen independence (Figure S6G). Overexpression of FOXA1 reduced sensitivity to PF-9363, while SNDX-5613 and the combination remained effective (Figure 6E). The FOXA1 F266L and SY242CS mutants showed relative resistance to both monotherapies but were still sensitive to the combination (Figure 6E). Importantly, the combination suppressed canonical ER target genes across all FOXA1 contexts (Figure 6F), highlighting the robustness of this therapeutic strategy. Collectively these findings demonstrate that KAT6A and Menin are important therapeutic vulnerabilities and regulators of proliferation and ER-driven gene expression across different models of endocrine resistance.

Next, we wanted to assess if combined KAT6A/B and Menin inhibition was able to re-sensitize endocrine-resistant cells to ER targeting agents. All three models of endocrine resistance—ESR1 mutation, NF1 loss, and FOXA1 mutation—were able to grow well in estrogen--depleted media compared to their respective control cells (Figures S6H–S6J). However, treatment with combined PF-9363 and SNDX-5613 re-sensitized mutant cells to estrogen starvation and reverted cell growth back to the level of wild-type control cells (Figures S6H–S6J). Moreover, assessing KAT6A/B and/or Menin inhibition in combination with currently approved SERDs (fulvestrant and elacestrant) demonstrated that combined PF-9363 and SNDX-5613 treatment cooperated with SERD treatment in all three models of endocrine resistance and reduced cell viability to comparable levels as control SERD-treated cells (Figures S6K–S6M).

To confirm efficacy in endocrine-resistant 3D models, we assessed the effects of PF-9363 and/or SNDX-5613 treatment in estrogen-independent (EI) ER+ PDxOs. These models were developed previously by transplanting ER+ PDX models into ovariectomized mice without E2 supplementation. Tumor sublines that grew under these conditions were termed EI, and PDxOs from these sublines were established, validated, and published.41 As expected, fulvestrant treatment had little effect in this model; however, combined PF-9363+SNDX-5613 treatment potently suppressed growth at all tested doses (Figure 6G).

Finally, we assessed the effects of combined KAT6A/B and Menin inhibition in vivo in a previously published ESR1 Y537S PDX model, PDX1526,53,55 derived from a chest wall metastasis harboring a Y537S ESR1 mutation from a patient who had prior treatments with an AI, everolimus, fulvestrant, abemaciclib, and capecitabine. This PDX was resistant to estrogen deprivation and grew in ovariectomized mice without E2 supplementation. Engrafted mice (orthotopic tumor volume of ∼100 mm3) were treated with single agents or the combination for 40 days. In line with our findings in Figure S5L, all treatments were well tolerated by the mice with no significant weight loss (Figure S6N). PF-9363 alone significantly reduced tumor growth; however, only the combination was able to induce tumor regression (Figures 6H and 6I). In summary, these findings demonstrate that combined KAT6A/B and Menin inhibition continues to be effective in diverse contexts of endocrine resistance, underscoring the therapeutic potential of this combination therapy.

Discussion

KAT6A/B inhibition has emerged as a treatment modality in various solid tumors, and PF-07248144 is in phase 1 trials for advanced breast, prostate, and lung cancers (NCT04606446).7 Using a CRISPR-Cas9-based approach, we identified MEN1 loss as a top sensitizer to treatment with the highly potent, selective, and orally bioavailable pre-clinical analog of PF-07248144, PF-9363. Menin is a member of the wild-type KMT2A/B complex and serves as an adaptor, facilitating KMT2A/B binding to chromatin. In leukemia, Menin plays a potent pro-oncogenic role, which prompted development of clinical Menin inhibitors. These inhibitors target the pocket on Menin that binds to KMT2A/B, thereby globally displacing Menin from chromatin and reducing chromatin binding of KMT2A at select loci.37,56,57 Several Menin inhibitors have entered clinical trials (reviewed by Wenge et al.21), and SNDX-5613 (revumenib) was FDA approved for relapsed refractory KMT2A-rearranged acute myeloid leukemia in November 2024. Here, we show that Menin inhibition is also efficacious in models of ER+ breast cancer, and treatment with SNDX-5613 can cooperate with KAT6A/B inhibition in endocrine-sensitive as well as -resistant models. Combined KAT6A/B and Menin inhibition induced more dramatic changes in ER-driven chromatin accessibility and gene expression than either inhibitor alone. Mechanistically, we discovered that Menin inhibition functioned similarly in breast cancer as in leukemia, whereby SNDX-5613 treatment reduced global Menin chromatin occupancy, without global effects on KMT2A. However, at a critical subset of ER target genes, SNDX-5613 reduced KMT2A chromatin binding and gene expression. Interestingly, we did not observe major changes in H3K4me3 levels at loci where KMT2A was displaced from chromatin upon Menin inhibition. This is consistent with previous work in leukemia58 and likely due to other histone methyltransferases depositing the majority of H3K4me3.59,60 The mechanisms behind KMT2A’s dependence on Menin for chromatin binding at a subset of loci remain unclear but may involve DNA sequence composition or stabilizing interactions with other proteins and histone modifications. Unraveling these questions is the subject of ongoing studies.

Like Menin inhibition and its effect on KMT2A chromatin occupancy, PF-9363 treatment had no global effects on KAT6A chromatin binding but displaced KAT6A selectively at ER target genes. We observed locus-specific reductions in H3K9ac at ER target gene promoters, suggesting H3K9ac might stabilize KAT6A binding through its plant homeodomain (PHD) fingers.61 Alternatively, a recent structural study revealed a multifaceted acetylation-dependent and independent interaction of ENL/MLLT1, KAT6A, and CREB-binding protein (CBP)/p300 at promoters of actively transcribed genes.62 More kinetically refined experiments are needed to formally assess the cause-and-effect relationship of changes in histone acetylation versus changes in protein-protein interactions and their effects on KAT6A chromatin occupancy at ER target genes.

While PF-9363 induced chromatin loss of KAT6A at ER target genes and SNDX-5613 induced loss of KMT2A, only combined PF-9363+SNDX-5613 treatment was able to displace both KAT6A and KMT2A complexes. Importantly, only combined chromatin loss of KAT6A and KMT2A caused substantial loss of RNA Pol II at ER target genes. Both KAT6A7,63 and KMT2A64,65 have been implicated in transcriptional initiation and elongation. Here, we show that these two complexes can in part compensate for each other, whereby loss of either KAT6A or KMT2A alone induced only small reductions in RNA Pol II occupancy at promoters of ER target genes. However, when both KAT6A and KMT2A complexes were displaced from chromatin, we saw profound reductions in RNA Pol II occupancy. Importantly, these effects on RNA Pol II were restricted to a small subset of critical ER target genes, with general transcription remaining intact. This selective disruption of oncogenic transcriptional programs has been observed in other cancers dependent on KAT6A and/or Menin-KMT2A. In KMT2A-rearranged or NPM1 mutant leukemia, for example, Menin inhibition does not affect transcription globally, but rather anti-tumor effects are achieved through selective downregulation of genes like MEIS1 and other critical leukemic genes.37,38,58 In gastrointestinal stromal tumors (GISTs), Menin and/or KAT6A/B inhibition cooperates to selectively disrupt expression of genes like HAND1 and other GIST-associated transcription factors.43 And now, our work demonstrates that, in ER+ breast cancer, KAT6A and Menin-KMT2A are cooperative regulators of ER-driven gene expression. So, while KAT6A and Menin-KMT2A support oncogenic gene expression across many different cancer types, the specific oncogenic programs differ depending on the cellular context.

The specific and selective effects of Menin and KAT6A/B inhibitors on ER-driven gene expression programs make them attractive therapeutic agents for ER+ breast cancer. In many endocrine-resistant tumors, ER signaling remains active in the absence of estrogen and/or presence of antiestrogens, suggesting that KAT6A/B and/or Menin inhibition might be a promising treatment strategy for advanced ER+ cancers. Indeed, we showed that combined PF-9363+SNDX-5613 treatment continued to be effective in endocrine-resistant models, inhibiting proliferation and ER-driven gene expression. While the combination was effective in both endocrine-sensitive and -resistant models, further studies are needed to determine the relationship between relative sensitivity to these inhibitors and estrogen dependence. Additional in vitro and in vivo models should evaluate the efficacy of single agents and combination therapy in both contexts.

In summary, we discovered that combined KAT6A/B and Menin inhibition cooperates across different models of ER+ breast cancer in vitro and in vivo. We molecularly characterized this combination in several ER+ models, demonstrating that KAT6A and Menin-KMT2A chromatin complexes coordinately regulate ER-driven gene expression programs. Importantly, KAT6A and Menin-KMT2A promote ER activity in two complementary ways: (1) by co-occupying the ESR1 promoter and driving ESR1 mRNA expression and ERα protein level and (2) by co-occupying promoters of ER target genes and maintaining RNA Pol II chromatin binding at these loci. It is this dual role that KAT6A and Menin-KMT2A complexes play in controlling ER-directed gene expression that makes them such attractive targets. Since both KAT6A/B and Menin inhibitors are in phase 1/2 clinical trials and have shown manageable toxicity profiles to date, this combination therapy is tractable and might improve outcomes for patients with metastatic/relapsed ER+ breast cancers.

Limitations of the study

While this study focused on the histone acetylation effects of PF-9363, we cannot rule out that non-histone substrates may also mediate response to PF-9363 treatment. Further approaches must be undertaken to identify potential additional cellular substrates for KAT6A/B. Moreover, while we demonstrate that PF-9363 treatment induces KAT6A loss and SNDX-5613 treatment induces KMT2A loss specifically at ER target genes, without having global effects on KAT6A or KMT2A chromatin occupancy, it remains unknown how this specificity is achieved. More detailed kinetic studies are needed to determine if changes in histone modifications, changes in protein-protein interactions, or changes in chromatin state/architecture mediate the specific chromatin loss of KAT6A and KMT2A at promoters of ER target genes. Lastly, while we performed relevant in vitro experiments in the three most common models of endocrine resistance (ESR1 mutation, NF1 loss, and FOXA1 mutation), we only tested one ESR1 mutant PDX model in vivo. Future work needs to expand these studies and test appropriate NF1 loss and FOXA1 mutant PDX models in vivo.

Resource availability

Lead contact

Requests for further information, resources, and reagents may be directed to and will be fulfilled by the lead contact, Scott A. Armstrong (scott_armstrong@dfci.harvard.edu).

Materials availability

All unique/stable reagents generated in this study are available from the lead contact with a completed materials transfer agreement.

Data and code availability

  • ATAC-seq (GEO: GSE264724), ChIP-seq (GEO: GSE264726), CRISPR-seq (GEO: GSE264727), and RNA-seq (GEO: GSE264728) data have been deposited at NCBI GEO database and are publicly available as of the date of publication. Accession numbers are listed in the key resources table. Original western blot images have been deposited at Mendeley (https://doi.org/10.17632/v25sw2s8k9.1) and are publicly available as of the date of publication.

  • This paper does not report original code.

  • Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Acknowledgments

We thank Yadira Soto-Feliciano for sharing her human chromatin-focused sgRNA library and ipUSEPR plasmid. We also thank Drs. Karen Cichowski, Jonathan Tsai, and Alana Welm for sharing cell lines, plasmids, and organoid models with us. The results shown here are in part based upon data generated by the TCGA Research Network: https://www.cancer.gov/tcga. We thank all members of the Armstrong lab for invaluable discussions. HCI PDX and PDxO development and drug testing were conducted with funding from the National Cancer Institute (U54CA224076 to A.L.W.). E.T. is supported by the National Cancer Institute R01CA276187. S.A.A. is supported by NIH grants CA206963, CA204639, and CA066996. Dana-Farber/Harvard Cancer Center is supported in part by an NCI Cancer Center Support Grant # NIH 5 P30 CA06516. S.N.O. is supported by the Claudia Adams Barr Program for Innovative Cancer Research and the Breast Cancer Alliance Young Investigator Award.

Author contributions

S.A.A. supervised the study. S.A.A. and S.N.O. conceived the study. S.N.O. performed data analysis. C.H. and Y.W. performed bioinformatics analysis. S.N.O., B.A., C.S., Z.C., and E.L.H. performed experiments. W.B., R.J., M.B., A.L.W., and E.T. contributed to critical experimental planning and resources. S.N.O. and S.A.A. wrote the manuscript.

Declaration of interests

R.J. received research funding from Pfizer, Lilly, and Novartis and is a consultant for Lilly, Carrick Therapeutics, Pfizer, Novartis, and AstraZeneca. E.T. reports grants and personal fees from AstraZeneca and consulting from Menarini. S.A.A. has been a consultant and/or shareholder for Neomorph, C4 Therapeutics, Accent Therapeutics, Hyku Biosciences, AstraZeneca, and Nimbus Therapeutics. S.A.A. has received research support from Janssen and Syndax. S.A.A. is an inventor on a patent related to Menin inhibition (WO/2017/132398A1). S.N.O. and S.A.A. have a patent application related to this work (63/658,526). The University of Utah may license the HCI models described herein to for-profit companies, which may result in tangible property royalties to members of the Welm labs who developed the models.

STAR★Methods

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

Rabbit anti-KAT6A (MYST3) Cell Signaling Technology Cat#78462S; RRID: AB_3095769
Rabbit anti-KAT6A (MOZ) Invitrogen Cat#PA5-66742; RRID: AB_2664289
Rabbit anti-KAT6B (MORF) Abcam Cat#ab246879; RRID: AB_3331660
Rabbit anti-Menin Bethyl Laboratories Cat#A300-105A
Rabbit anti-Neurofibromin (NF1) Cell Signaling Technology Cat#14623; RRID: AB_2798543
Rabbit anti-Estrogen Receptor alpha Cell Signaling Technology Cat#8644S; RRID: AB_2617128
Estrogen Receptor alpha Monoclonal Antibody (TE111.5D11) Invitrogen Cat#MA112692; RRID: AB_1074278
Estrogen Receptor alpha Antibody (F-10) Santa Cruz Biotechnology Cat#SC-8002; RRID: AB_627558
Mouse anti-β-actin Cell Signaling Technology Cat#3700S; RRID: AB_2242334
Rabbit anti-H3K9 acetyl Abcam Cat#ab4441; RRID: AB_2118292
Rabbit anti-H3 Abcam Cat#ab1791; RRID: AB_302613
Rabbit anti-H3K27 acetyl Abcam Cat#ab4729; RRID: AB_2118291
Rabbit anti-H3K23 acetyl Abcam Cat#ab177275; RRID: AB_2927706
Rabbit anti-H3K4 trimethyl Abcam Cat#ab8580; RRID: AB_306649
Rabbit anti-MLL1 Bethyl Laboratories Cat#A300-086A
Rabbit anti-BRPF1 Invitrogen Cat#PA5-27783; RRID: AB_2545259
Rabbi anti-RNA polymerase II Abcam Cat#ab26721; RRID: AB_777726
Anti-GFP antibody (RM1064) Abcam Cat#ab316291
Vinculin (E1E9V) XP Rabbit mAb Cell Signaling Technology Cat#13901; RRID: AB_2728768
Donkey anti-rabbit Li-Cor Biosciences Cat#NC9523609
Donkey anti-mouse Li-Cor Biosciences Cat#NC0250903

Biological samples

PDX HCl-018 Dr. Alana Welm, Huntsman Cancer Institute, University of Utah, Guillen et al. 202241 N/A
PDX HCl-003 Dr. Alana Welm, Huntsman Cancer Institute, University of Utah, DeRose et al. 201142 N/A
PDX 1526, ESR1 Y537S Dr. Rinath Jeselsohn, Dana-Farber Cancer Institute, Jeselsohn et al., 201853 and Guarducci et al. 202455 N/A

Chemicals, peptides, and recombinant proteins

UltraPure Bovine Serum Albumin (BSA) Invitrogen Cat#AM2616
Dimethyl-sulfoxide (DMSO) Sigma Aldrich Cat#D2650
16% Formaldehyde (w/v), Methanol-free Thermo Fisher Scientific Cat#28908
Penicillin-Streptomycin (PenStrep) Gibco Cat#15-140-122
Fetal Bovine Serum Sigma Aldrich Cat#F2442
Trypsin EDTA 1X Corning Cat#25-053-Cl
L-Glutamine Gibco Cat#25030164
Charcoal-Stripped FBS Gibco Cat#12676029
Hydrocortisone Sigma Aldrich Cat#H0888-1G
Matrigel Growth Factor Reduced Basement Membrane Matrix Corning Cat#354230
TrypLE Express Enzyme Gibco Cat#12605010
Advanced DMEM/F-12 Gibco Cat#12634010
HEPES Gibco Cat#15630080
GlutaMAX Supplement Gibco Cat#35050061
Gentamicin Gibco Cat#15750060
hEGF Sigma Aldrich Cat#E9644
FGF2 R & D Systems Cat#4114-TC-01M
N-Acetyl-L-Cysteine (NAC) Sigma Aldrich Cat#A7250-5G
Y-27632 2HCl Selleck Chemicals Cat#S1049
Recombinant Human Heregulinβ-1 Peprotech Cat#100-03
Puromycin dihydrochloride Sigma Aldrich Cat#P8833
Blasticidin S HCl Gibco Cat#A11139-03
RNase A, DNase and protease-free Thermo Fisher Scientific Cat#EN0531
Proteinase K Thermo Fisher Scientific Cat#EO0491
Protease Inhibitor Tablets, EDTA-free Roche Cat#1873580
β-mercaptoethanol Sigma-Aldrich Cat#M6250
Digitonin Promega Cat#G9441
TWEEN-20 Roche Diagnostics Cat#11332465001
Geneticin G418 Thermo Fisher Scientific Cat#10131-035
PF-9363 MedChem Express LLC Cat#HY-132283
SNDX-5613 MedChem Express LLC Cat#HY-136175
Fulvestrant Selleck Chemicals Cat#S1191
Elacestrant MedChem Express LLC Cat#HY-19822A
Giredestrant MedChem Express LLC Cat#HY-109176
Estradiol Selleck Chemicals Cat#S1709
Brilanestrant MedChem Express LLC Cat#HY-12864
ARV-471 MedChem Express LLC Cat#HY-138642
ERD-308 MedChem Express LLC Cat#HY-128600
Capivasertib Selleck Cat#S8019

Critical commercial assays

X-tremeGene 9 DNA Transfection Reagent Millipore Cat#XTG9-RO
Polybrene Transfection Reagent Millipore Cat#TR-1003-G
Power SYBR Green PCR Master Mix Applied Biosystems Cat#4367660
Precision Plus Protein Dual Color Standards Bio-Rad Cat#1610374
NuPAGE Tris-Acetate Protein Gel 3 to 8% Invitrogen Cat#EA0378BOX
NuPAGE Bis-Tris Protein Gel 4 to 12% Invitrogen Cat#NP0335BOX
iBlot 3 Transfer Stacks, nitrocellulose Invitrogen Cat#IB33001
NEBNext Ultra II RNA Library Prep Kit for Illumina New England BioLabs Cat#E7770L
Ampure Xp Beckman Coulter Life Sciences Cat#A63881
Dynabeads Protein A Thermo Fisher Scientific Cat#10002D
Dynabeads Protein G Thermo Fisher Scientific Cat#100-04D
Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32854
D5000 Reagents Agilent Cat#5067-5589
D5000 ScreenTape Agilent Cat#5067-5588
High Sensitivity D5000 Reagents Agilent Cat#5067-5593
High Sensitivity D5000 ScreenTape Agilent Cat#5067-5592
High Sensitivity D1000 Reagents Agilent Cat#5067-5585
High Sensitivity D1000 ScreenTape Agilent Cat#5067-5584
NextSeq 500 High Output v2 Kit Illumina Inc Cat#20024906
Tagment DNA TDE1 Enzyme and Buffer Kits Illumina Cat#20034197
NEBNext High-Fidelity 2X PCR Master Mix New England BioLabs Cat#M0541L
ThruPLEX DNA-Seq Kit Takara Cat#R400676
DNA Single Index Kit- 12S SetA Takara Cat#R400695
DNA Single Index Kit- 12S SetB Takara Cat#R400697
CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682
CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7571
High Capacity cDNA Reverse Transcription Kit Applied BioSystems Cat#4374966
FTA Sample Collection Kit for Human Cell Authentication Service ATCC Cat#ATCC135-XV
Pierce BCA Protein Assay Kit Thermo Scientific Cat#23225
NuPAGE LDS Sample Buffer Invitrogen Cat#NP0007
RNeasy Mini Kit Qiagen Cat#74106
RNase-Free DNase Set Qiagen Cat#79254
QIAshredder Columns Qiagen Cat#79654
NEBNext Poly(A) mRNA Magnetic Isolation Module New England BioLabs Cat#E7490L
DNA Clean and Concentrator Kits Zymo Research Cat#D4034
Cell Lifter Corning Cat#3008
milliTube 1 mL AFA Fiber Covaris Inc Cat#520130
Drosophila spike-in chromatin Active Motif Cat#53083
eBioscience Annexin V Apoptosis Detection Kit APC Thermo Fisher Scientific Cat#88-8007-74
BD Pharmingen FITC BrdU Flow Kit BD Biosciences Cat#559619; RRID: AB_2617060

Deposited data

Mendeley Dataset This study https://doi.org/10.17632/v25sw2s8k9.1
ATACseq This study GEO: GSE264724
ChIPseq This study GEO: GSE264726
CRISPRseq This study GEO: GSE264727
RNAseq This study GEO: GSE264728
Hallmark gene sets Liberzon et al.23 N/A
C2 gene sets (GSEA) Subramanian et al.31 N/A
Mendeley Dataset DOI URL This paper N/A

Experimental models: Cell lines

293T ATCC CRL-3216
MDAMB361 ATCC HTB-27
MDAMB231 Dr. Karen Cichowski, Brigham and Women’s Hospital N/A
CAMA1 Dr. Karen Cichowski, Brigham and Women’s Hospital N/A
MCF7 Dr. Karen Cichowski, Brigham and Women’s Hospital N/A
SUM149PT Dr. Karen Cichowski, Brigham and Women’s Hospital N/A
SUM159PT Dr. Karen Cichowski, Brigham and Women’s Hospital N/A
T47D Dr. Karen Cichowski, Brigham and Women’s Hospital N/A
ZR751 Dr. Karen Cichowski, Brigham and Women’s Hospital N/A
HCl-003 Dr. Alana Welm, Huntsman Cancer Institute, University of Utah42 N/A
HCl-018 Dr. Alana Welm, Huntsman Cancer Institute, University of Utah41 N/A
HCl-040 estrogen independent Dr. Alana Welm, Huntsman Cancer Institute, University of Utah41 N/A
MCF7 sgNT Dr. Eneda Toska, Johns Hopkins University, Razavi et al., 201849 N/A
MCF7 sgNF1-1 Dr. Eneda Toska, Johns Hopkins University, Razavi et al., 201849 N/A
MCF7 sgNF1-2 Dr. Eneda Toska, Johns Hopkins University, Razavi et al., 201849 N/A
MCF7 FOXA1 Dr. Eneda Toska, Johns Hopkins University, Arruabarrena-Arristorena et al., 202054 N/A
MCF7 FOXA1 Empty Vector Dr. Eneda Toska, Johns Hopkins University, Arruabarrena-Arristorena et al., 202054 N/A
MCF7 FOXA1 SY242CS Dr. Eneda Toska, Johns Hopkins University, Arruabarrena-Arristorena et al., 202054 N/A
MCF7 FOXA1 F266L Dr. Eneda Toska, Johns Hopkins University, Arruabarrena-Arristorena et al., 202054 N/A
MCF7 ER Y537S-HA, dox inducible Dr. Rinath Jeselsohn, Dana-Farber Cancer Insitute, Jeselsohn et al., 201853 N/A
T47D ER Y537S-HA, dox inducible Dr. Rinath Jeselsohn, Dana-Farber Cancer Insitute, Jeselsohn et al., 201853 N/A

Experimental models: Organisms/strains

Mouse:
NOD.Cg-Rag1tm1MomIl2rgtm1Wjl/SzJ (NRG)
Jackson Laboratory 007799
Mouse:
NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ (NSG)
Jackson Laboratory 005557

Oligonucleotides

Primers for preparing CRISPR screen amplicon libraries See STAR Methods section N/A
Primers for qRT-PCR See STAR Methods section N/A
Primers for ChIP-qPCR See STAR Methods section N/A
sgRNA for CRISPR-Cas9 See STAR Methods section N/A

Recombinant DNA

SFFV-mCherry-IRES-eGFP-ESR1 Dr. Jonathan Tsai, Dana-Farber Cancer Institute N/A
pLentiCas9-Blast Addgene 52962
improved-scaffold-pU6-sgRNA-EF1alpha_PURO-T2A-RFP (ipUSEPR) Dr. Yadira Soto-Feliciano, MIT N/A
pMD2.G Addgene 12259
psPAX2 Addgene 12260
pLentiCas9-Blast Addgene 52962

Software and algorithms

FlowJo 10.10.0 Becton Dickinson & Company N/A
bcl2fastq Conversion Software, v2.20.0.422 Illumina, Inc N/A
STAR, v2.7.5a N/A
Picard tools, v2.9.4 Broad Institute N/A
SAMtools, v1.95 N/A
HTSeq, htseq-count, v0.6.1pl N/A
DESeq2 package, v1.24.0 N/A
MACS2, v2.1.4 N/A
IGVtools, v2.3.75 Robinson et al., 201736; N/A
deeptools, v3.1.3 N/A
HOMER, v4.11 N/A
bedtools, v2.28.0 N/A

Experimental model and study participant details

Cell lines

MDAMB361 cells were obtained from ATCC. CAMA1, MCF7, MDAMB231, SUM149PT, SUM159PT, T47D, and ZR751 cell were obtained from Dr. Karen Cichowski (Brigham and Women’s Hospital). MCF7 ESR1 mutant cell lines (endogenous point mutant and isogenic doxycycline-inducible overexpression mutant) and T47D ESR1 mutant cell line (isogenic doxycycline-inducible overexpression) were obtained from Dr. Rinath Jeselsohn (Dana-Farber Cancer Institute), MCF7 sgNT and sgNF1 cells as well as MCF7 FOXA1 cells were obtained from Dr. Eneda Toska (Johns Hopkins University). T47D and ZR751 cells were cultured in Roswell Park Memorial Institute (RPMI) medium supplemented with 1xL-glutamine (Gibco), 10% Fetal Bovine Serum (FBS) and 1xPenStrep (Gibco). HEK293T, MCF7, CAMA1, MDAMB231 and MDAMB361 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 1xL-glutamine (Gibco), 10% Fetal Bovine Serum (FBS) and 1xPenStrep (Gibco). SUM149PT and SUM159PT cells were cultured in Ham’s F-12 (Gibco) medium, supplemented with 1xL-glutamine (Gibco), 10% Fetal Bovine Serum (FBS) and 1xPenStrep (Gibco), 1μg/mL Hydrocortisone (Sigma-Aldrich), and 5μg/mL Insulin (Gibco). MCF7 and T47D cells with the doxycycline-inducible Y537S ESR1 mutation were grown in DMEM and RPMI respectively, supplemented with 1xL-glutamine (Gibco), 10% Fetal Bovine Serum (FBS), 1xPenStrep (Gibco), and 500μg/ml Geneticin (Gibco). For estrogen starvation, cells were grown in RPMI or DMEM without phenol red (Gibco), supplemented with 10% charcoal stripped FBS (Gibco), 1xPenStrep (Gibco), and 1xL-glutamine (Gibco). All cells were grown at 37°C and 5% CO2 and were routinely tested for mycoplasma contamination. The identity of MCF7 and T47D cells was independently confirmed by ATCC’s FTA Sample Collection Kit (ATCC), which utilizes short tandem repeat (STR) profiling.

Patient-derived xenograft organoids (PDxOs)

PDxOs were obtained from Dr. Alana Welm (Huntsman Cancer Institute, University of Utah) through an MTA and were thawed and cultured as previously described.41 PDxOs HCl-003, HCl-018 and HCl-040 were derived from their respective PDX samples (collection was previously performed in accordance with the University of Utah IRB protocols 89989, 91596 and 10924; approved human sample collection following informed consent and PDX models were previously published for HCl-003,42 HCl-018/HCl-04041). In brief, PDxOs were maintained in 200μL Matrigel domes (Corning) and were passaged by dissociation using TrypLE (Gibco). ER+ HCl-003 and HCl-018 PDxOs were cultured in Advanced DMEM/F12 (Gibco), supplemented with 5% Fetal Bovine Serum (FBS), 10 mM HEPES (Gibco), 1xGlutamax (Gibco), 1 μg/ml hydrocortisone (Sigma-Aldrich), 50 μg/ml gentamicin (Gibco), 10 ng/ml hEGF (Sigma-Aldrich), 100 ng/ml FGF2 (R&D Systems), and 1 mM NAC (Sigma-Aldrich). 10 μM Y-27632 (Selleck Chemicals) was added fresh. The ER+/HER2+ PDxO HCl-040 estrogen independent (EI) was cultured in Advanced DMEM/F12 (Gibco), supplemented with 5% Fetal Bovine Serum (FBS), 10 mM HEPES (Gibco), 1xGlutamax (Gibco), 1 μg/ml hydrocortisone (Sigma-Aldrich), 50 μg/ml gentamicin (Gibco), 10 ng/ml hEGF (Sigma-Aldrich), 100 ng/ml FGF2 (R&D Systems), 1 mM NAC (Sigma-Aldrich), and 10 nM heregulin-β1 (Pepro Tech). 10 μM Y-27632 (Selleck Chemicals) was added fresh. Medium was changed every 3-5 days. Organoids were grown at 37°C and 5% CO2 and were routinely tested for mycoplasma contamination.

Mouse models

HCl-003 and HCl-018 PDX sample collection was previously performed in accordance with the University of Utah IRB (protocols 89989, 91596 and 10924) approved human sample collection following informed consent and PDX models were previously published (HCl-00342 and HCl-01841). Three-to four-week-old NOD rag gamma mice (NRG, Jackson Laboratory) were used to generate tumors as previously described.66,67 In brief, tumor chunks (from 2mmx4mm to 4mmx4mm) were implanted orthotopically into cleared inguinal mammary fat pads. For the HCl-018 PDX, 1mg E2 pellets were administered prior to tumor implantation and mice were switched to E2 water 4 weeks after surgery, as previously published.41 The PDX HCl-018 sample is an ER+ invasive lobular carcinoma (ILC) and was collected from a brain metastasis. The patient was treated with chemotherapy, tamoxifen, letrozole, and fulvestrant prior to sample collection.41 The study was carried out at the Huntsman Cancer Institute as per the Institute’s protocols, which were approved by the Institutional Animal Care and Use Committee. For the HCl-003 PDX, 0.25mg E2 pellets with a 90-day release were administered prior to tumor implantation. Mice did not receive any additional E2 in their water. The PDX HCl-003 sample is an ER+/PR+ invasive ductal carcinoma (IDC) and was collected from a primary breast tumor. The patient had not been exposed to any systemic treatments up to the time of sample collection.42 The study was carried out at the Dana-Farber Cancer Institute Experimental Therapeutics Core (ETx) and was approved by the relevant Institutional Animal Care and Use Committee.

ESR1 Y537S PDX sample collection was previously performed in accordance with the IRB-approved protocol (Dana-Farber/Harvard Cancer Center IRB protocol 93-085) with patient consent and was previously published PDX1526.53,55 Tumor samples were dipped in 50% matrigel and implanted into the cleared fourth mammary fat pads of ovariectomized NOD-SCID-IL2Rgc–/– mice (NSG, Jackson Laboratories), without E2 supplements. The PDX1526 sample was derived from a chest wall metastasis harboring a Y537S ESR1 mutation from a patient who had prior treatments with an aromatase inhibitor, everolimus, fulvestrant, abemaciclib, and capecitabine. The study was carried out at the Dana-Farber Cancer Institute Experimental Therapeutics Core (ETx) and was approved by the relevant Institutional Animal Care and Use Committee.

Method details

Virus production and infections

Sequences for sgRNA species were cloned into the lentiviral vector improved-scaffold-pU6-sgRNA-EF1alpha_PURO-T2A-RFP (ipUSEPR) (gift from Y. Soto-Feliciano, MIT) using BsmBI. The sgRNA sequences are as follows: Non-targeting control (sgLuc- TTCTAAAACGGATTACCA), sgRNA targeting human KAT6A (sgRNA1-TGGCTCCACATCGTAATAGA; sgRNA2-TGATAGCCAATCGTAACTGC), KAT6B (sgRNA1-AGCGCGGTCTATCTAAGTGG; sgRNA2-AGAAAAGGGGTCGTAAACGC), BRPF1 (sgRNA1-TGAGGTGATGAGCTATGCAC; sgRNA2-AGGGTGACTGCAGGCAACGG), MEN1 (sgRNA1-CACCTGCTGCGATTCTACGA; sgRNA2-GAACGTTGGTAGGGATGACG) and a common essential lethal gene, RPA3 (sgRPA3-GGTTGGAAGAGTAACCGCCA). For the epigenetic-focused CRPSR screen, we used the pUSEPR-humanEpiV2.0 sgRNA library (gift from Y. Soto-Feliciano, MIT) with 4 guides per gene, sequences are listed in Table S1. Constitutive Cas9 expression was achieved using pLentiCas9-Blast (Addgene, 52962). To exogenously express ESR1, we stably expressed SFFV-mCherry-IRES-eGFP-ESR1 (N-GFP-ESR1, gift from J. Tsai, Brigham and Women’s Hospital). Lentivirus was produced in HEK293T cells following transient cotransfection with ipUSEPR/pLentiCas9/eGFP-ESR1 (5 μg), pMD2.G (1 μg, Addgene, 12259) and psPAX2 (5 μg, Addgene, 12260) in 10-cm tissue culture plates using Xtremegene (Roche) and Opti-MEM medium (Gibco). Viral supernatant was collected 48 hours after transfection, passed through a 0.45-μm filter, and stored at −80°C. All human breast cancer cell lines were infected by co-incubation of cells with viral supernatant supplemented with polybrene (Millipore) at 8 μg/ml at appropriate dilutions (virus:media 1:3-1:10; 1:100-1:250 for competition assay and CRISPR screen). Cells were recovered for 48 hours and then selected with puromycin (2.5 μg/ml, Sigma-Aldrich) or blasticidin (10μg/ml, Gibco) for 3-6 days until non-infected cells were dead.

Epigenetic-focused CRISPR screen

Cloning of the sgRNA library targeting human chromatin regulators was previously described24 and chromatin-focused CRSIPR screening in a human cancer cell line was previously performed.25 In brief, viral supernatant was titrated to produce an MOI of approximately 0.3. For each experimental replicate 30 million Cas9-expressing MCF7 cells were infected with the CRISPR library at 30% RFP transduction efficiency, resulting in >6 million infected cells, providing >1000x coverage of the sgRNA library. After recovery from infection (48 hours), cells were placed in puromycin (2.5 μg/ml, Sigma-Aldrich) for 72 hours to enrich for sgRNA-infected cells. Subsequently, 6 million puromycin-selected cells were pelleted and stored at −20°C (Day 0) and 6 million puromycin-selected cells per replicate were plated into either DMSO- or PF-9363–containing media (in total, 18 million cells in DMSO and 18 million cells in PF-9363). Cells were split every 3-5 days and at each split 6 million cells per replicate were plated back to maintain >1,000x library coverage. Once the population reached 12 cumulative population doublings, 6 million cells per replicate were pelleted and stored at −20°C (Day 30). Pelleted cells were thawed and lysed in 1.3 ml lysis buffer per sample (NaCl, 300 mM; SDS, 0.2%; EDTA, 1 mM; Tris-HCl, pH 8.0, 10 mM). Samples were then incubated with RNase A (100 μg/ml, Thermo Fisher Scientific) for 1 hour at 65°C and then incubated overnight with proteinase K (100 μg/ml, Invitrogen) at 55°C with constant rotation. Genomic DNA was purified by phenol–chloroform extraction. Amplicon sequencing libraries were then produced using 35 μg genomic DNA from each experimental replicate as follows: a first-round PCR reaction was carried out in 5 separate 100μl reactions, using Q5 High-Fidelity DNA Polymerase (NEB) to amplify the region of the sgRNA corresponding to that between U6 and EF-1α using primers (forward F1, AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG and reverse R1, TCTACTATTCTTTCCCCTGCACTGTACCTGTGGGCGATGTGCGCTCTG); the product was pooled from the primary PCR reaction. A second PCR was carried out to incorporate Illumina adaptors and a 6-bp barcode for identification of samples. A third PCR reaction was carried out to enrich for the full-length amplicon using primers (forward F3, AATGATACGGCGACCACCGAGATC and reverse R3, CAAGCAGAAGACGGCATACGAGAT). Final amplicon libraries were purified by AMPure XP bead (Beckman Coulter) purification. Sequencing was done using the Illumina Next Gen Sequencing NextSeq platform (Illumina) with >6 million reads per sample, 75 bp single-end, and results were analyzed using MAGeCK.26

In vitro cell growth assays

For competition assays, stable Cas9-expressing human breast cancer cell lines were plated in complete cell culture medium in 96 well plates (10,000-25,000 cells, depending on the cell line). The next day, cells were infected in triplicate with the respective sgRNA construct. Cells were not sorted/selected, yielding a mixed population of RFP+ and RFP− cells. 3-4 days following sgRNA infection, RFP expression was measured by flow cytometry using an LSR Fortessa flow cytometer (BD Bioscience) as the Day 0 measurement. RFP expression was measured over time as indicated and data were analyzed with FlowJo software (Tree Star).

For dose titration experiments, 10,000-25,000 cells (depending on the cell line) were plated in complete cell culture medium in 96 well plates. For cells with CRISPR-Cas9 mediated inactivation of MEN1, KAT6A and/or KAT6B, cells were infected and selected with puromycin as described above. Cells were selected for three days and then plated in complete cell culture medium in 96 well plates, supplemented with 2.5 μg/ml puromycin. For isogenic MCF7 and T47D cells with doxycycline-inducible Y537S ESR1 expression, cells were treated with DMSO or 1 μg/ml doxycycline for three days to induce expression of the mutation. Three days upon -/+ doxycycline treatment, 10,000-15,000 cells were plated in complete cell culture medium -/+ doxycycline in 96 well plates. The day after seeding (Day 0), triplicate wells of cells were treated with limiting dilutions of drug as indicated or 0.1% DMSO. All wells were DMSO-normalized. Every 3-4 days cells in each well were split 1:3-1:5, using a constant split-ratio and fresh drug/DMSO was added. Cell viability was assayed using the CellTiter-Glo Luminescent Cell Viability Assay (Promega) and luminescence was read using the BMG Labtech CLARIOstarPlus plate reader. ZIP synergy scores were calculated with SynergyFinder 3.0.29,30

For cell counting based assays, 125,000-250,000 cells (depending on the cell line) were seeded in complete culture medium in triplicate per well of a 6 well plate. For cells with CRISPR-Cas9 mediated inactivation of KAT6A and/or KAT6B, cells were infected and selected with puromycin as described above. Cells were selected for three days and then plated in complete cell culture medium in 96 well plates, supplemented with 2.5 μg/ml puromycin. Cells were replated at normalized cell densities every 3-4 days. For drug treatment experiments, triplicate wells of cells were treated with drug or 0.1% DMSO the day after plating (Day 0). Every 3-4 days cells in each well were split at normalized cell densities and fresh drug/DMSO was added were applicable.

For estrogen depletion experiments, 150,000-250,000 cells were seeded in complete culture medium in triplicate per well of a 6 well plate. The next day (Day 0), cells were washed with PBS 3 times and phenol red-free DMEM (Gibco), supplemented with 10% charcoal-stripped FBS (Gibco), was added. For concomitant drug treatments, drugs or 0.1% DMSO were added as indicated at the time of estrogen starvation. Estrogen-depleted medium and drugs were refreshed every 3-5 days. On day 10 the experiment was stopped for cell counting or CellTiter-Glo Luminescent Cell Viability Assay (Promega), where luminescence was read using the BMG Labtech CLARIOstarPlus plate reader.

Organoid growth assays

For PDxO drug treatment experiments, organoids were plated in replicates of 6 in a 96 well plate with 700 cells in 5 μL Matrigel (Corning) domes per well. Complete cell culture medium was added and the next day (Day 0) organoids were treated with different concentrations of drug or 0.1% DMSO. All wells were DMSO-normalized. Every 3-4 days media was changed and drug/DMSO replenished. At the end of the experiment, cell viability was assayed using the CellTiter-Glo 3D Luminescent Cell Viability Assay (Promega) and luminescence was read using BMG Labtech CLARIOstarPlus plate reader. Representative images were taken using an ECHO Revolve microscope.

Apoptosis and cell cycle assays

To assess apoptosis, MCF7 and T47D cells were plated in triplicate in 6 well plates and drugs were added the next day. Every 3-4 days cells were replated at normalized cell densities and fresh drug/DMSO was added. At the time of collection, cells were trypsinized (Corning), washed with cold PBS, resuspended in AnnexinV Binding Buffer, and stained by APC AnnexinV and DAPI for 15 min at room temperature in the dark, using the APC AnnexinV Apoptosis Detection Kit (eBioscience). Cells were analyzed using an LSR Fortessa flow cytometer (BD Bioscience) and data were analyzed with FlowJo software (Tree Star).

For cell cycle assays, MCF7 and T47D cells were plated in triplicate in 6 well plates and drugs were added the next day. Every 3-4 days cells were replated at normalized cell densities and fresh drug/DMSO was added. Cells were treated with 10 μM BrdU (BD Biosciences) for 1 hour. At the time of collection, cells were trypsinized (Corning), washed with cold PBS, and fixed, permealized and stained according to the manufacturer’s instructions (BD Biosciences). Cells were analyzed using an LSR Fortessa flow cytometer (BD Bioscience) and data were analyzed with FlowJo software (Tree Star).

Western blotting

For non-histone proteins, adherent cells were washed twice in cold PBS and lysed in RIPA buffer (150mM NaCl, 0.5% Na Deoxycholate, 0.1% SDS, 1% Triton X-100, 50mM Tris-HCl, pH=8) with protease inhibitor (Roche). PDxO domes were rinsed with cold PBS, mechanically dissociated by pipetting up and down 20-30x with 1 mL cold TrypLE Express (Gibco) and transferred to tubes containing 3 mL cold TrypLE. Cells were incubated for 10 minutes with vortexing every 2-3 minutes. 4 mL ice cold DMEM/F12 + 10% FBS was added to the tube, inverted to mix, and centrifuged at 4°C, 600 g for 5 minutes. Pellets were washed in cold PBS 1x then lysed in RIPA buffer (as described above) with protease inhibitor. Lysates were incubated on ice for 30 minutes then cleared by centrifugation at 4°C, max speed for 10 minutes. Protein concentrations were quantified with the Pierce BCA Protein Assay Kit (Thermo Fisher). Samples were normalized and supplemented with NuPage 1X LDS Sample Buffer (Invitrogen) and 2.5% β-mercaptoethanol (Sigma-Aldrich) and denatured at 95°C for 10 minutes. For western blotting, 30-80 ug of protein extract per sample or protein ladder (BioRad) was separated on a 4–12% NuPAGE Bis-Tris or 3-8% Tris-Acetate protein gel (Thermo Fisher) and transferred to nitrocellulose by using iBlot3 Regular Nitrocellulose Transfer Stacks (Thermo Fisher). The membranes were blocked in 5% dry milk for 1 hour and incubated overnight with antibody. The next day membranes were washed in TBST and developed using anti-mouse or anti-rabbit secondary antibodies (LI-COR Biosciences) and detected using the Odyssey CLx infrared imaging system (LI-COR Biosciences).

For histones, cells were washed twice in cold PBS and pellets were resuspended in TEB (PBS containing 0.5% Triton X-100) with 2mM phenylmethylsulfonylfluoride (PMSF) and protease inhibitor (Roche) at a cell density of 107 cells per mL. Cells were lysed on ice for 10 minutes and centrifuged at 2,000 rpm for 10 minutes at 4°C. The pellet was washed in TEB with PMSF and protease inhibitor (Roche) and centrifuged as before. The pellet was resuspended in 0.2N HCl, supplemented with PMSF and protease inhibitor (Roche) at a cell density of 4x107 per ml and histones were acid extracted overnight at 4°C. The next day, samples were centrifuged for 10 minutes at 4°C and the protein concentration in the supernatant was quantified with the Pierce BCA Protein Assay Kit (Thermo Fisher). Samples were normalized and supplemented with NuPage 1X LDS Sample Buffer (Invitrogen) and 2.5% β-mercaptoethanol (Sigma-Aldrich) and denatured at 95°C for 10 minutes. For western blotting, 3-10 ug of protein extract per sample or protein ladder (BioRad) was separated on a 4–12% NuPAGE Bis-Tris protein gel (Thermo Fisher) and transferred to nitrocellulose by using iBlot3 Regular Nitrocellulose Transfer Stacks (Thermo Fisher). The membranes were blocked in 5% dry milk for 1 hour and incubated overnight with antibody. The next day membranes were washed in TBST and developed using anti-rabbit secondary antibodies (LI-COR Biosciences) and detected using the Odyssey CLx infrared imaging system (LI-COR Biosciences).

RNA isolation

For full media experiments, cells/organoids were plated in triplicate and drugs were added the next day (Day 0). For RNA experiments -/+ acute estradiol stimulation (-/+E2), cells were plated in full media and drugs were added the next day (Day 0). The following day (Day 1), cells were washed with PBS 3 times and phenol red-free DMEM (Gibco), supplemented with 10% charcoal-stripped FBS (Gibco) and appropriate drug was added. On Day 4 (72 hours upon estrogen starvation, 96 hours upon addition of drugs), cells were treated with vehicle (DMSO) or estradiol (Selleck Chemicals) for 6 hours. Following DMSO/estradiol treatment, cells were harvested.

For cells with CRISPR-Cas9 mediated inactivation of MEN1, KAT6A and/or KAT6B, cells were infected and selected with puromycin as described above. Cells were selected for three days and then plated in complete culture medium in triplicate per well of a 6 well plate, supplemented with 2.5 μg/ml puromycin. Cells were replated at normalized cell densities every 3-4 days and were harvested seven days after viral infection.

For cell lines, 1 million cells were trypsinized (Corning), washed with cold PBS, and lysed in RLT buffer (Qiagen). RNA was isolated using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions and DNase treatment (Qiagen) was performed on the column.

For PDxOs, domes were mechanically disrupted using plain Advanced DMEM/F12 (Gibco). Cells were centrifuged at 4°C, 600 g for 5 minutes and washed once in cold PBS. Pellets were lysed in RLT buffer (Qiagen), supplemented with 1% β-mercaptoethanol (Sigma-Aldrich) and stored at -80°C. Once thawed, samples were transferred to QiaShredder columns (Qiagen) and centrifuged. RNA was isolated from the flow through using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions and DNase treatment (Qiagen) was performed on the column.

qRT-PCR and ChIP-qPCR

RNA was reverse transcribed with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). SYBR green gene expression assays (Applied Biosystems) were used for quantitative qRT-PCR. ACTB or GAPDH were used as housekeeping gene for normalization, as indicated in the Figure. Relative gene expression was calculated by the comparative ΔΔ cycle threshold method. Probes used: GAPDH (F: TGCACCACCAACTGCTTAGC, R: GGCATGGACTGTGGTCATGAG), ACTB (F: TCCCTGGAGAAGAGCTACG, R: GTAGTTTCGTGGATGCCACA), ESR1 (endogenous) (F: GAGTATGATCCTACCAGACCCTTC, R: CCTGATCATGGAGGGTCAAATC), ESR1 (exogenous) (F: GAATACGACCCAACACGCCCG, R: ACTTGGTCGTGCAGTGTGAGGTC), TFF1 (F: CCCCTGGTGCTTCTATCCTAA, R: GATCCCTGCAGAAGTGTCTAAAA), PGR1 (F: CTTAATCAACTAGGCGAGAG, R: AAGCTCATCCAAGAATACTG), GREB1 (F: GTGGTAGCCGAGTGGACAAT, R: ATTTGTTTCCAGCCCTCCTT), XBP1 (F: GCGCCTCACGCACCTG, R: GCTGCTACTCTGTTTTTCAGTTTCC). Samples were loaded in triplicate into 384-well plates and run on the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems).

For ChIP-qPCR, the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) was used with 384-well plates using SYBR green (Applied Biosystems). Percent input was calculated for each ChIP sample based on its corresponding input sample. ChIP-qPCR primers used were: GAPDH (F: CAGTCAGCCGCATCTTCTTT, R: CCTTCAGGCCGTCCCTA), IGF1R (F: GGCTCCCTTTACTAAGTCGTTTA, R: GGATTATTTCTCCCGTGTCTTCT), ESR1 (F: GTCCTGGGACTGCACTTG, R: GCACAGCCCGAGGTTAG), PGR (F: TAGTTGAGATAGGGCGGGTAG, R: CTGCACTCGGCCTCAAC), TFF1 (GGGGAGATGTTGGCATGAAC, R: CTTCAGTCGGGGCTGTTTTC), IRX3 (F: GACGAGAGCACGTTGGAC, R: ATACATCCGCCCGCTTTAC), gene desert (F: AACCTCACTTTCATTGTTACTAGCCATA, R: CGCTCAAGGATGTCAGTAGCAT).

In vivo xenograft studies

For drug treatment studies, engrafted mice were enrolled into treatment groups when tumors reached approximately 100mm3 in size, as measured by calipers and calculated using the [(Length x Width x Width)/2)] formula.

For the HCl-018 PDX model,41 mice were randomly assigned to treatment groups (n = 4 mice per arm) and were administered vehicle (5%DMSO/40% PEG300/55%saline, orally (PO), once per day (QD)), 1mg/kg PF-9363 (PO, QD), SNDX-5613 (0.1% in chow) or the combination. Due to weight loss, the dosing route for vehicle and PF-9363 was changed from PO (day 1-20) to intraperitoneal injection (IP) for day 20-40. The total treatment duration was 40 days. Tumor volumes and body weights were measured twice a week, and all procedures were conducted under protocols approved by the Institutional Animal Care and Use Committee at the University of Utah.

For the HCl-003 PDX model,42 engrafted mice were randomly assigned to treatment groups (n=3 mice per arm) and were administered vehicle (5%DMSO/40% PEG300/55%PBS, orally (PO), once per day (QD) for five days ON, two days OFF), 1mg/kg PF-9363 (PO, QD, five days ON, two days OFF), SNDX-5613 (0.1% in chow) or the combination. The total treatment duration was 40 days. Tumor volumes were measured twice a week and body weights were measured daily. Body weight was maintained during the course of treatment, indicating the safety and tolerability of the five-day-ON, two-day-OFF treatment regimen. The study was carried out at the Dana-Farber Cancer Institute Experimental Therapeutics Core (ETx) and was approved by the relevant Institutional Animal Care and Use Committee.

For the ESR1 Y537S PDX152653,55 model, engrafted mice were randomly assigned to treatment groups (n=5 mice per arm for vehicle and single agents; n=8 per arm for the PF-9363+SNDX-5613 combination treatment) and were administered vehicle (5%DMSO/40% PEG300/55%PBS, orally (PO), once per day (QD) for five days ON, two days OFF), 1mg/kg PF-9363 (PO, QD, five days ON, two days OFF), SNDX-5613 (0.1% in chow) or the combination. The total treatment duration was 40 days. Tumor volumes were measured twice a week and body weights were measured daily. Body weight was maintained during the course of treatment and follow-up, indicating the safety and tolerability of the five-day-ON, two-day-OFF treatment regimen. The study was carried out at the Dana-Farber Cancer Institute Experimental Therapeutics Core (ETx) and was approved by the relevant Institutional Animal Care and Use Committee.

RNA sequencing

RNA quality for RNA sequencing was checked on the Agilent TapeStation (Agilent) and quantified by Qubit (ThermoFisher). RNA (1μg) was used to make Illumina compatible libraries by doing Poly-A tail selection (New England Biolabs) and library preparation using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was done using the Illumina Next Gen Sequencing NextSeq platform (Illumina) with 20-30 million 37bp paired-end or 75bp single-end reads.

ATAC sequencing

Samples were prepared as previously published.33,34 In brief, 50,000 cells were harvested and washed in PBS. Cell pellets were resuspended in 1mL ATAC-resuspension buffer (10 mM Tris-HCl, pH 7.4; 10 mM NaCl; 3 mM MgCl2) and centrifuged at 1,000 g for 10 min at 4°C. Cell pellets were resuspended in 50 μL cold lysis buffer (10 mM Tris-HCl, pH 7.4; 10 mM NaCl; 3 mM MgCl2; 0.1% NP40; 0.1% Tween-20 (Roche), 0.01% Digitonin (Promega)) and incubated on ice for 3 minutes. 1mL wash buffer was added (10 mM Tris-HCl, pH 7.4; 10 mM NaCl; 3 mM MgCl2; 0.1% Tween-20) and cells were spun down immediately at 1,000 g for 10 min at 4°C. Following this, the pellet was resuspended in a transposase reaction mixture (2X TD buffer, 20X transposase (100nM final, Illumina), 0.01% Digitonin (Promega), 0.1% Tween-20 (Roche)) at 37°C for 30 minutes in a thermomixer with 1,000 rpm mixing. DNA was purified using a DNA Clean and Concentrator-5 kit (Zymo) as per the manufacturer’s instructions. The DNA fragments were amplified in a PCR reaction with 2X NEBNext High-Fidelity PCR Master Mix (New England Biolabs) and purified using AMPure XP beads (Beckman Coulter). DNA fragments were quantified by TapeStation 4200 (Agilent) using HSD5000 Tape and Reagent (Agilent) and Qubit (ThermoFisher). This was followed by sequencing using the NextSeq550 (Illumina) to obtain 50 million 37bp, paired-end reads.

ChIP sequencing

Cells were crosslinked in 1% methanol-free formaldehyde (ThermoFisher) for 10 min at room temperature with gentle shaking. Following crosslinking, cells were quenched using 100 mM Tris pH 8.0 and 250 mM Glycine, washed with room temperature PBS and scraped using cell lifters (Corning). 20 million cells were then lysed in 1mL of 50 mM Tris-HCl pH 8.0, 100 mM NaCl, 5 mM EDTA, 1% SDS, supplemented with protease inhibitors (Roche). Drosophila melanogaster S2 cells were used for spike-in controls (Active Motif). Chromatin was collected by centrifugation at 15,000g for 10 min and pellets were resuspended in 1mL 66mM Tris-HCl pH 8.0, 100mM NaCl, 5mM EDTA, 1.7% Triton X-100, 0.5% SDS, supplemented with protease inhibitors (Roche). Lysates were transferred to Covaris tubes and chromatin was sheared using an E100S sonicator (Covaris) to 200-400 bp fragments. 5μL of sonicated chromatin was de-crosslinked with 100 mM NaHCO3, 100 mM NaCl, 1% SDS in a total volume of 50uL and was incubated at 65°C for 4-6 hours. Following de-crosslinking, DNA was purified with AMPure XP beads (Beckman Coulter). Input DNA fragments were run on a TapeStation 4200 (Agilent), using D5000 Tape and Reagents (Agilent) to ensure proper shearing, and quantified using Qubit (ThermoFisher). Sheared chromatin from 20 million cells was used in each immunoprecipitation using the following antibodies: anti-ER (Invitrogen and Santa Cruz Biotechnology), anti-GFP (Abcam), anti-Menin (Bethyl), anti-KMT2A/MLL1 (Bethyl), anti-KAT6A/MOZ (Invitrogen), anti-BRPF1 (Invitrogen), anti-RNA Pol II (Abcam). Sheared chromatin from 2-5 million cells was used in each immunoprecipitation using the following antibodies: anti-H3K9ac (Abcam), H3K4me3 (Abcam). Antibodies were conjugated to protein-A or protein-G magnetic beads (Dynabeads) for 4-6 hours on a rotator at 4°C with 0.5 μg/μL BSA (Invitrogen). Subsequently, the sheared chromatin was added to the beads+antibody and was incubated on a rotator at 4°C overnight. Samples were washed serially with Buffer A (150 mmol/L NaCl, 5 mmol/L EDTA, 5% sucrose, 1% Triton X-100, 0.2% SDS, 20 mmol/L Tris), Buffer B (5 mmol/L EDTA, 1% Triton X-100, 0.1% Deoxycholate, 20 mmol/L Tris), Buffer C (250 mmol/L LiCl, 1 mmol/L EDTA, 0.5% NP40, 0.5% Deoxycholate, 10 mmol/L Tris), and TE following resuspension of beads in Elution Buffer (200 mmol/L NaCl, 100 mmol/L NaHCO3, 1% SDS) and incubation at 65°C to reverse cross-links for 12 to 15 hours. Following de-crosslinking, DNA was purified with AMPure XP beads (Beckman Coulter). DNA fragments were quantified by TapeStation 4200 (Agilent) using HSD1000 Tape and Reagent (Agilent) and Qubit (ThermoFisher). 1-10 ng of DNA was used in preparation of Illumina compatible libraries using ThruPLEX DNA-Seq Kit (Takara) followed by sequencing using NextSeq550 (Illumina) to obtain 20-30 million 37bp, paired-end reads.

Bioinformatics analysis

For the CRISPR sequencing analysis, the MAGeCK computational pipeline26 was used. FASTQ files were converted to read-count tables using the MAGeCK ‘count’ command. Each genetic screen was carried out in n = 3 replicates. The maximum likelihood estimation (MLE) algorithm of MAGeCK-vispr was used to generate count summaries and beta scores.

For all other sequencing analyses (RNA-, ATAC-, ChIP-seq), raw Illumina sequencer output was converted to FASTQ format using bcl2fastq (v2.20.0.422). Reads (paired-end 37-mers or single 75-mer reads) were aligned to the human genome (Gencode GRCh38/hg38 v33) using STAR (v2.7.5a; params --alignIntronMax 1 --alignEndsType EndToEnd --alignMatesGapMax 2000 for ChIPseq/ATACseq analysis), sorted and duplicates marked/removed with picard pipeline tools (v2.9.4). Final “deduped”.BAM files were indexed using SAMtools (v1.95). All gene body and TSS locus annotations are from Gencode GRCh38/hg38 v33.

For RNA-seq, raw per-gene counts were calculated with HTSeq (htseq-count, v0.6.1pl) and differential RNA-seq expression was calculated using the BioConductor DESeq2 package (v1.24,0), using raw unnormalized per-gene counts from deduplicated BAMs. All heatmaps were generated using the Broad Institute Morpheus tool (https://software.broadinstitute.org/morpheus). To perform gene set enrichment analysis, DESeq2 was used to obtain the normalized input gene expression matrix for the GSEA software v4.3.31 The reference gene sets for GSEA, specifically the hallmark gene sets (H) and curated gene sets (C2) are from The Molecular Signatures Database (MSigDB).23

For ATAC-seq, MACS2 (v2.1.4) was used to call peaks. ATAC-seq data visualizations were produced using IGVtools (TDF signal pileups; v2.3.75) and deeptools (tornado plots; v3.1.3; regions around combined peak loci from all ATAC samples plotted using referencePoint option and k=1). Putative enhancer regions were defined as loci corresponding to H3K27ac peak regions called in MCF7 cells that overlapped with called H3K4me1 regions in the same cell line but did not overlap with promoter/TSS regions (TSS -1kB/+3kB), nor with annotated blacklisted regions of likely artifact. Motif enrichment analysis was performed using HOMER (v4.11) motif analysis tools.32 Loss of accessibility was defined as rpk drug/DMSO FC <0.5. Top motifs were identified by Homer de novo Motif Results.

For ChIP-seq, MACS2 (v2.1.4) was used to call peaks with appropriate input samples as controls for peak calling. Peaks were called with q-value cut-off of 0.01 and broad peak mode. Peaks that are overlapped with blacklisted regions were filtered out. Overlaps of called peaks with peaks from other samples, TSS regions, gene bodies and annotated blacklist regions were determined using bedtools “intersect” (v2.28.0), with TSS regions defined as above. Promoter-associated signal was determined using bedtools “coverage” (v2.28.0), using annotated gene body genomic intervals and TSS region intervals (-1kb to +3kb for each protein-coding transcript TSS, using gene orientation). A single representative promoter region was chosen for each gene, based on the site with the highest average signal in DMSO control samples. Genes with relevant signal at the promoter (2-fold enrichment of DMSO over input and rpk > 10) were kept for further analysis. Copy number-based normalization was performed using gene-associated CN annotations from the Cancer Cell Line Encyclopedia (CCLE68). ChIP-seq data visualizations were produced using IGVtools (TDF signal pileups; v2.3.75) and deeptools (tornado plots; v3.1.3; regions around TSS/promoter intervals plotted using referencePoint or scaledRegion option and k=1). For RNA Pol II interval counts were normalized using a ratio of TSS signal values among a set of selected housekeeping genes. For KMT2A and KAT6A reads were normalized using ratios of total read counts between treated and control sample pairs. For histone marks, reads were normalized using drosphila-spike in as previously published.39

Quantification and statistical analysis

No statistics were applied to determine sample size. Experiments shown are typically representative of at least three independent experimental replicates. Data collection and analysis were not performed blind to the conditions of the experiments. For proliferation assays, dose–response curves were calculated in a variable slope model as a four-parameter dose–response curve (GraphPad Prism Version 10.2.0). Absolute IC50 values were calculated by setting the maximal inhibition baseline parameter to 0% and constraining the minimal inhibition top parameter to 100% (GraphPad Prism Version 10.2.0). ANOVA with Tukey’s multiple comparisons tests and Kruskal-Wallis with Dunn’s multiple comparisons tests were performed with GraphPad Prism Version 10.2.0. ZIP synergy scores were calculated with SynergyFinder 3.0.29,30

Published: June 13, 2025

Footnotes

Supplemental information can be found online at https://doi.org/10.1016/j.xcrm.2025.102192.

Supplemental information

Document S1. Figures S1–S6
mmc1.pdf (32.2MB, pdf)
Table S1. Excel file containing additional data related to Figure 1
mmc2.xlsx (90.9KB, xlsx)
Table S2. Excel file containing gene lists related to RNA-seq data in Figure 2
mmc3.xlsx (5MB, xlsx)
Table S3. Excel file containing additional information related to ATAC-seq data in Figure 2
mmc4.xlsx (24.9MB, xlsx)
Table S4. Excel file containing gene lists related to RNA-seq data in Figure 3
mmc5.xlsx (14KB, xlsx)
Table S5. Excel file containing gene lists related to RNA-seq data in Figure 5
mmc6.xlsx (60.6KB, xlsx)
Document S2. Article plus supplemental information
mmc7.pdf (69.1MB, pdf)

References

  • 1.Perou C.M., Sørlie T., Eisen M.B., van de Rijn M., Jeffrey S.S., Rees C.A., Pollack J.R., Ross D.T., Johnsen H., Akslen L.A., et al. Molecular portraits of human breast tumours. Nature. 2000;406:747–752. doi: 10.1038/35021093. [DOI] [PubMed] [Google Scholar]
  • 2.Sørlie T., Perou C.M., Tibshirani R., Aas T., Geisler S., Johnsen H., Hastie T., Eisen M.B., van de Rijn M., Jeffrey S.S., et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc. Natl. Acad. Sci. USA. 2001;98:10869–10874. doi: 10.1073/pnas.191367098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Siegel R.L., Miller K.D., Jemal A. Cancer statistics, 2018. CA Cancer J. Clin. 2018;68:7–30. doi: 10.3322/caac.21442. [DOI] [PubMed] [Google Scholar]
  • 4.Hanker A.B., Sudhan D.R., Arteaga C.L. Overcoming Endocrine Resistance in Breast Cancer. Cancer Cell. 2020;37:496–513. doi: 10.1016/j.ccell.2020.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yu L., Liang Y., Cao X., Wang X., Gao H., Lin S.-Y., Schiff R., Wang X.-S., Li K. Identification of MYST3 as a novel epigenetic activator of ERα frequently amplified in breast cancer. Oncogene. 2017;36:2910–2918. doi: 10.1038/onc.2016.433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Turner-Ivey B., Guest S.T., Irish J.C., Kappler C.S., Garrett-Mayer E., Wilson R.C., Ethier S.P. KAT6A, a Chromatin Modifier from the 8p11-p12 Amplicon is a Candidate Oncogene in Luminal Breast Cancer. Neoplasia. 2014;16:644–655. doi: 10.1016/j.neo.2014.07.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Sharma S., Chung C.-Y., Uryu S., Petrovic J., Cao J., Rickard A., Nady N., Greasley S., Johnson E., Brodsky O., et al. Discovery of a highly potent, selective, orally bioavailable inhibitor of KAT6A/B histone acetyltransferases with efficacy against KAT6A-high ER+ breast cancer. Cell Chem. Biol. 2023;30:1191–1210.e20. doi: 10.1016/j.chembiol.2023.07.005. [DOI] [PubMed] [Google Scholar]
  • 8.Champagne N., Pelletier N., Yang X.-J. The monocytic leukemia zinc finger protein MOZ is a histone acetyltransferase. Oncogene. 2001;20:404–409. doi: 10.1038/sj.onc.1204114. [DOI] [PubMed] [Google Scholar]
  • 9.Huang F., Abmayr S.M., Workman J.L. Regulation of KAT6 Acetyltransferases and Their Roles in Cell Cycle Progression, Stem Cell Maintenance, and Human Disease. Mol. Cell Biol. 2016;36:1900–1907. doi: 10.1128/mcb.00055-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sheikh B.N., Akhtar A. The many lives of KATs — detectors, integrators and modulators of the cellular environment. Nat. Rev. Genet. 2019;20:7–23. doi: 10.1038/s41576-018-0072-4. [DOI] [PubMed] [Google Scholar]
  • 11.Jenuwein T., Allis C.D. Translating the histone code. Science. 2001;293:1074–1080. doi: 10.1126/science.1063127. [DOI] [PubMed] [Google Scholar]
  • 12.Meeks J.J., Shilatifard A. Multiple Roles for the MLL/COMPASS Family in the Epigenetic Regulation of Gene Expression and in Cancer. Annu. Rev. Cancer Biol. 2017;1:425–446. doi: 10.1146/annurev-cancerbio-050216-034333. [DOI] [Google Scholar]
  • 13.Hughes C.M., Rozenblatt-Rosen O., Milne T.A., Copeland T.D., Levine S.S., Lee J.C., Hayes D.N., Shanmugam K.S., Bhattacharjee A., Biondi C.A., et al. Menin Associates with a Trithorax Family Histone Methyltransferase Complex and with the Hoxc8 Locus. Mol. Cell. 2004;13:587–597. doi: 10.1016/s1097-2765(04)00081-4. [DOI] [PubMed] [Google Scholar]
  • 14.Yokoyama A., Somervaille T.C.P., Smith K.S., Rozenblatt-Rosen O., Meyerson M., Cleary M.L. The Menin Tumor Suppressor Protein Is an Essential Oncogenic Cofactor for MLL-Associated Leukemogenesis. Cell. 2005;123:207–218. doi: 10.1016/j.cell.2005.09.025. [DOI] [PubMed] [Google Scholar]
  • 15.Chandrasekharappa S.C., Guru S.C., Manickam P., Olufemi S.-E., Collins F.S., Emmert-Buck M.R., Debelenko L.V., Zhuang Z., Lubensky I.A., Liotta L.A., et al. Positional Cloning of the Gene for Multiple Endocrine Neoplasia-Type 1. Science. 1997;276:404–407. doi: 10.1126/science.276.5311.404. [DOI] [PubMed] [Google Scholar]
  • 16.Thakker R.V., Newey P.J., Walls G.V., Bilezikian J., Dralle H., Ebeling P.R., Melmed S., Sakurai A., Tonelli F., Brandi M.L., Endocrine Society Clinical practice guidelines for multiple endocrine neoplasia type 1 (MEN1) J. Clin. Endocrinol. Metab. 2012;97:2990–3011. doi: 10.1210/jc.2012-1230. [DOI] [PubMed] [Google Scholar]
  • 17.Yokoyama A., Cleary M.L. Menin Critically Links MLL Proteins with LEDGF on Cancer-Associated Target Genes. Cancer Cell. 2008;14:36–46. doi: 10.1016/j.ccr.2008.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Malik R., Khan A.P., Asangani I.A., Cieślik M., Prensner J.R., Wang X., Iyer M.K., Jiang X., Borkin D., Escara-Wilke J., et al. Targeting the MLL complex in castration-resistant prostate cancer. Nat. Med. 2015;21:344–352. doi: 10.1038/nm.3830. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Imachi H., Murao K., Dobashi H., Bhuyan M.M., Cao X., Kontani K., Niki S., Murazawa C., Nakajima H., Kohno N., et al. Menin, a product of the MENI gene, binds to estrogen receptor to enhance its activity in breast cancer cells: possibility of a novel predictive factor for tamoxifen resistance. Breast Cancer Res. Treat. 2010;122:395–407. doi: 10.1007/s10549-009-0581-0. [DOI] [PubMed] [Google Scholar]
  • 20.Massey S., Khan M.A., Rab S.O., Mustafa S., Khan A., Malik Z., Shaik R., Verma M.K., Deo S., Husain S.A. Evaluating the role of MEN1 gene expression and its clinical significance in breast cancer patients. PLoS One. 2023;18 doi: 10.1371/journal.pone.0288482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Wenge D.V., Armstrong S.A. The future of HOXA-expressing leukemias: Menin inhibitor response and resistance. Curr. Opin. Hematol. 2024;31:64–70. doi: 10.1097/moh.0000000000000796. [DOI] [PubMed] [Google Scholar]
  • 22.Freire P.R., Cutler J.A., Armstrong S.A. Therapeutic Targeting of the Menin–KMT2A Interaction. Annu. Rev. Cancer Biol. 2024;8:291–307. doi: 10.1146/annurev-cancerbio-062822-021934. [DOI] [Google Scholar]
  • 23.Liberzon A., Birger C., Thorvaldsdóttir H., Ghandi M., Mesirov J.P., Tamayo P. The Molecular Signatures Database Hallmark Gene Set Collection. Cell Syst. 2015;1:417–425. doi: 10.1016/j.cels.2015.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Soto-Feliciano Y.M., Sanchez-Rivera F.J., Perner F., Barrows D.W., Kastenhuber E.R., Ho Y.-J., Carroll T.S., Xiong Y., Anand D., Soshnev A.A., et al. A molecular switch between mammalian MLL complexes dictates response to Menin-MLL inhibition. Cancer Discov. 2022;13:146–169. doi: 10.1158/2159-8290.cd-22-0416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Chen X., Li Y., Zhu F., Xu X., Estrella B., Pazos M.A., McGuire J.T., Karagiannis D., Sahu V., Mustafokulov M., et al. Context-defined cancer co-dependency mapping identifies a functional interplay between PRC2 and MLL-MEN1 complex in lymphoma. Nat. Commun. 2023;14:4259. doi: 10.1038/s41467-023-39990-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Li W., Xu H., Xiao T., Cong L., Love M.I., Zhang F., Irizarry R.A., Liu J.S., Brown M., Liu X.S. MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens. Genome Biol. 2014;15:554. doi: 10.1186/s13059-014-0554-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ullah M., Pelletier N., Xiao L., Zhao S.P., Wang K., Degerny C., Tahmasebi S., Cayrou C., Doyon Y., Goh S.-L., et al. Molecular Architecture of Quartet MOZ/MORF Histone Acetyltransferase Complexes. Mol. Cell Biol. 2008;28:6828–6843. doi: 10.1128/mcb.01297-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Dreijerink K.M.A., Groner A.C., Vos E.S.M., Font-Tello A., Gu L., Chi D., Reyes J., Cook J., Lim E., Lin C.Y., et al. Enhancer-Mediated Oncogenic Function of the Menin Tumor Suppressor in Breast Cancer. Cell Rep. 2017;18:2359–2372. doi: 10.1016/j.celrep.2017.02.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ianevski A., Giri A.K., Aittokallio T. SynergyFinder 3.0: an interactive analysis and consensus interpretation of multi-drug synergies across multiple samples. Nucleic Acids Res. 2022;50:W739–W743. doi: 10.1093/nar/gkac382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zheng S., Wang W., Aldahdooh J., Malyutina A., Shadbahr T., Tanoli Z., Pessia A., Tang J. SynergyFinder Plus: Toward Better Interpretation and Annotation of Drug Combination Screening Datasets. Genom. Proteom. Bioinform. 2022;20:587–596. doi: 10.1016/j.gpb.2022.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Subramanian A., Tamayo P., Mootha V.K., Mukherjee S., Ebert B.L., Gillette M.A., Paulovich A., Pomeroy S.L., Golub T.R., Lander E.S., Mesirov J.P. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA. 2005;102:15545–15550. doi: 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Heinz S., Benner C., Spann N., Bertolino E., Lin Y.C., Laslo P., Cheng J.X., Murre C., Singh H., Glass C.K. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 2010;38:576–589. doi: 10.1016/j.molcel.2010.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Corces M.R., Trevino A.E., Hamilton E.G., Greenside P.G., Sinnott-Armstrong N.A., Vesuna S., Satpathy A.T., Rubin A.J., Montine K.S., Wu B., et al. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat. Methods. 2017;14:959–962. doi: 10.1038/nmeth.4396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Buenrostro J.D., Giresi P.G., Zaba L.C., Chang H.Y., Greenleaf W.J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat. Methods. 2013;10:1213–1218. doi: 10.1038/nmeth.2688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Thorvaldsdóttir H., Robinson J.T., Mesirov J.P. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief. Bioinform. 2013;14:178–192. doi: 10.1093/bib/bbs017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Robinson J.T., Thorvaldsdóttir H., Wenger A.M., Zehir A., Mesirov J.P. Variant Review with the Integrative Genomics Viewer. Cancer Res. 2017;77:e31–e34. doi: 10.1158/0008-5472.can-17-0337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Krivtsov A.V., Evans K., Gadrey J.Y., Eschle B.K., Hatton C., Uckelmann H.J., Ross K.N., Perner F., Olsen S.N., Pritchard T., et al. A Menin-MLL Inhibitor Induces Specific Chromatin Changes and Eradicates Disease in Models of MLL-Rearranged Leukemia. Cancer Cell. 2019;36:660–673.e11. doi: 10.1016/j.ccell.2019.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Olsen S.N., Godfrey L., Healy J.P., Choi Y.A., Kai Y., Hatton C., Perner F., Haarer E.L., Nabet B., Yuan G.-C., Armstrong S.A. MLL::AF9 degradation induces rapid changes in transcriptional elongation and subsequent loss of an active chromatin landscape. Mol. Cell. 2022;82:1140–1155.e11. doi: 10.1016/j.molcel.2022.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Orlando D.A., Chen M.W., Brown V.E., Solanki S., Choi Y.J., Olson E.R., Fritz C.C., Bradner J.E., Guenther M.G. Quantitative ChIP-Seq Normalization Reveals Global Modulation of the Epigenome. Cell Rep. 2014;9:1163–1170. doi: 10.1016/j.celrep.2014.10.018. [DOI] [PubMed] [Google Scholar]
  • 40.Weeber F., Ooft S.N., Dijkstra K.K., Voest E.E. Tumor Organoids as a Pre-clinical Cancer Model for Drug Discovery. Cell Chem. Biol. 2017;24:1092–1100. doi: 10.1016/j.chembiol.2017.06.012. [DOI] [PubMed] [Google Scholar]
  • 41.Guillen K.P., Fujita M., Butterfield A.J., Scherer S.D., Bailey M.H., Chu Z., DeRose Y.S., Zhao L., Cortes-Sanchez E., Yang C.-H., et al. A human breast cancer-derived xenograft and organoid platform for drug discovery and precision oncology. Nat. Cancer. 2022;3:232–250. doi: 10.1038/s43018-022-00337-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.DeRose Y.S., Wang G., Lin Y.-C., Bernard P.S., Buys S.S., Ebbert M.T.W., Factor R., Matsen C., Milash B.A., Nelson E., et al. Tumor grafts derived from women with breast cancer authentically reflect tumor pathology, growth, metastasis and disease outcomes. Nat. Med. 2011;17:1514–1520. doi: 10.1038/nm.2454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Hemming M.L., Benson M.R., Loycano M.A., Anderson J.A., Andersen J.L., Taddei M.L., Krivtsov A.V., Aubrey B.J., Cutler J.A., Hatton C., et al. MOZ and Menin–MLL Complexes Are Complementary Regulators of Chromatin Association and Transcriptional Output in Gastrointestinal Stromal Tumor. Cancer Discov. 2022;12:1804–1823. doi: 10.1158/2159-8290.cd-21-0646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Gordon S.J.V., Perner F., MacPherson L., Wenge D.V., Bourgeois W., Fennell K., Klaus T., Petrovic J., Horvath J., Cao J., et al. Catalytic inhibition of KAT6/KAT7 enhances the efficacy and overcomes primary and acquired resistance to Menin inhibitors in MLL leukaemia. bioRxiv. 2024 doi: 10.1101/2024.12.11.627663. Preprint at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Michmerhuizen N.L., Heikamp E.B., Iacobucci I., Umeda M., Arthur B., Mishra V., Di Giacomo D., Hiltenbrand R., Gao Q., Radko-Juettner S., et al. MOZ and HBO1 Histone Acetyltransferase Complexes Are Molecular Dependencies and Therapeutic Targets in NUP98-Rearranged Acute Myeloid Leukemia. bioRxiv. 2024 doi: 10.1101/2024.12.02.624182. Preprint at. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Will M., Liang J., Metcalfe C., Chandarlapaty S. Therapeutic resistance to anti-oestrogen therapy in breast cancer. Nat. Rev. Cancer. 2023;23:673–685. doi: 10.1038/s41568-023-00604-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Koboldt D.C., Fulton R.S., McLellan M.D., Schmidt H., Kalicki-Veizer J., McMichael J.F., Fulton L.L., Dooling D.J., Ding L., Mardis E.R., et al. Comprehensive molecular portraits of human breast tumours. Nature. 2012;490:61–70. doi: 10.1038/nature11412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Jeselsohn R., Yelensky R., Buchwalter G., Frampton G., Meric-Bernstam F., Gonzalez-Angulo A.M., Ferrer-Lozano J., Perez-Fidalgo J.A., Cristofanilli M., Gómez H., et al. Emergence of Constitutively Active Estrogen Receptor-α Mutations in Pretreated Advanced Estrogen Receptor–Positive Breast Cancer. Clin. Cancer Res. 2014;20:1757–1767. doi: 10.1158/1078-0432.ccr-13-2332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Razavi P., Chang M.T., Xu G., Bandlamudi C., Ross D.S., Vasan N., Cai Y., Bielski C.M., Donoghue M.T.A., Jonsson P., et al. The Genomic Landscape of Endocrine-Resistant Advanced Breast Cancers. Cancer Cell. 2018;34:427–438.e6. doi: 10.1016/j.ccell.2018.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Jeselsohn R., Buchwalter G., De Angelis C., Brown M., Schiff R. ESR1 mutations—a mechanism for acquired endocrine resistance in breast cancer. Nat. Rev. Clin. Oncol. 2015;12:573–583. doi: 10.1038/nrclinonc.2015.117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Toy W., Weir H., Razavi P., Lawson M., Goeppert A.U., Mazzola A.M., Smith A., Wilson J., Morrow C., Wong W.L., et al. Activating ESR1 Mutations Differentially Affect the Efficacy of ER Antagonists. Cancer Discov. 2017;7:277–287. doi: 10.1158/2159-8290.cd-15-1523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Fanning S.W., Mayne C.G., Dharmarajan V., Carlson K.E., Martin T.A., Novick S.J., Toy W., Green B., Panchamukhi S., Katzenellenbogen B.S., et al. Estrogen receptor alpha somatic mutations Y537S and D538G confer breast cancer endocrine resistance by stabilizing the activating function-2 binding conformation. eLife. 2016;5 doi: 10.7554/elife.12792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Jeselsohn R., Bergholz J.S., Pun M., Cornwell M., Liu W., Nardone A., Xiao T., Li W., Qiu X., Buchwalter G., et al. Allele-Specific Chromatin Recruitment and Therapeutic Vulnerabilities of ESR1 Activating Mutations. Cancer Cell. 2018;33:173–186.e5. doi: 10.1016/j.ccell.2018.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Arruabarrena-Aristorena A., Maag J.L.V., Kittane S., Cai Y., Karthaus W.R., Ladewig E., Park J., Kannan S., Ferrando L., Cocco E., et al. FOXA1 Mutations Reveal Distinct Chromatin Profiles and Influence Therapeutic Response in Breast Cancer. Cancer Cell. 2020;38:534–550.e9. doi: 10.1016/j.ccell.2020.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Guarducci C., Nardone A., Russo D., Nagy Z., Heraud C., Grinshpun A., Zhang Q., Freelander A., Leventhal M.J., Feit A., et al. Selective CDK7 inhibition suppresses cell cycle progression and MYC signaling while enhancing apoptosis in therapy-resistant estrogen receptor positive breast cancer. Clin. Cancer Res. 2024;30:1889–1905. doi: 10.1158/1078-0432.ccr-23-2975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Grembecka J., He S., Shi A., Purohit T., Muntean A.G., Sorenson R.J., Showalter H.D., Murai M.J., Belcher A.M., Hartley T., et al. Menin-MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia. Nat. Chem. Biol. 2012;8:277–284. doi: 10.1038/nchembio.773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Borkin D., He S., Miao H., Kempinska K., Pollock J., Chase J., Purohit T., Malik B., Zhao T., Wang J., et al. Pharmacologic Inhibition of the Menin-MLL Interaction Blocks Progression of MLL Leukemia In Vivo. Cancer Cell. 2015;27:589–602. doi: 10.1016/j.ccell.2015.02.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Uckelmann H.J., Kim S.M., Wong E.M., Hatton C., Giovinazzo H., Gadrey J.Y., Krivtsov A.V., Rücker F.G., Döhner K., McGeehan G.M., et al. Therapeutic targeting of preleukemia cells in a mouse model of NPM1 mutant acute myeloid leukemia. Science. 2020;367:586–590. doi: 10.1126/science.aax5863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Bledau A.S., Schmidt K., Neumann K., Hill U., Ciotta G., Gupta A., Torres D.C., Fu J., Kranz A., Stewart A.F., Anastassiadis K. The H3K4 methyltransferase Setd1a is first required at the epiblast stage, whereas Setd1b becomes essential after gastrulation. Development. 2014;141:1022–1035. doi: 10.1242/dev.098152. [DOI] [PubMed] [Google Scholar]
  • 60.van Nuland R., Smits A.H., Pallaki P., Jansen P.W.T.C., Vermeulen M., Timmers H.T.M. Quantitative Dissection and Stoichiometry Determination of the Human SET1/MLL Histone Methyltransferase Complexes. Mol. Cell Biol. 2013;33:2067–2077. doi: 10.1128/mcb.01742-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Qiu Y., Liu L., Zhao C., Han C., Li F., Zhang J., Wang Y., Li G., Mei Y., Wu M., et al. Combinatorial readout of unmodified H3R2 and acetylated H3K14 by the tandem PHD finger of MOZ reveals a regulatory mechanism for HOXA9 transcription. Genes Dev. 2012;26:1376–1391. doi: 10.1101/gad.188359.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Becht D.C., Selvam K., Lachance C., Côté V., Li K., Nguyen M.C., Pareek A., Shi X., Wen H., Blanco M.A., et al. A multivalent engagement of ENL with MOZ. Nat. Struct. Mol. Biol. 2025;32:709–718. doi: 10.1038/s41594-024-01455-8. [DOI] [PubMed] [Google Scholar]
  • 63.Yan F., Li J., Milosevic J., Petroni R., Liu S., Shi Z., Yuan S., Reynaga J.M., Qi Y., Rico J., et al. KAT6A and ENL form an epigenetic transcriptional control module to drive critical leukemogenic gene expression programs. Cancer Discov. 2022;12:792–811. doi: 10.1158/2159-8290.cd-20-1459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Milne T.A., Dou Y., Martin M.E., Brock H.W., Roeder R.G., Hess J.L. MLL associates specifically with a subset of transcriptionally active target genes. Proc. Natl. Acad. Sci. USA. 2005;102:14765–14770. doi: 10.1073/pnas.0503630102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Lauberth S.M., Nakayama T., Wu X., Ferris A.L., Tang Z., Hughes S.H., Roeder R.G. H3K4me3 Interactions with TAF3 Regulate Preinitiation Complex Assembly and Selective Gene Activation. Cell. 2013;152:1021–1036. doi: 10.1016/j.cell.2013.01.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.DeRose Y.S., Gligorich K.M., Wang G., Georgelas A., Bowman P., Courdy S.J., Welm A.L., Welm B.E. Patient-Derived Models of Human Breast Cancer: Protocols for In Vitro and In Vivo Applications in Tumor Biology and Translational Medicine. Curr. Protoc. Pharmacol. 2013;Chapter 14:Unit14.23. doi: 10.1002/0471141755.ph1423s60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Scherer S.D., Zhao L., Butterfield A.J., Yang C.-H., Cortes-Sanchez E., Guillen K.P., Welm B.E., Welm A.L. Breast cancer PDxO cultures for drug discovery and functional precision oncology. STAR Protoc. 2023;4 doi: 10.1016/j.xpro.2023.102402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Ghandi M., Huang F.W., Jané-Valbuena J., Kryukov G.V., Lo C.C., McDonald E.R., Barretina J., Gelfand E.T., Bielski C.M., Li H., et al. Next-generation characterization of the Cancer Cell Line Encyclopedia. Nature. 2019;569:503–508. doi: 10.1038/s41586-019-1186-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Document S1. Figures S1–S6
mmc1.pdf (32.2MB, pdf)
Table S1. Excel file containing additional data related to Figure 1
mmc2.xlsx (90.9KB, xlsx)
Table S2. Excel file containing gene lists related to RNA-seq data in Figure 2
mmc3.xlsx (5MB, xlsx)
Table S3. Excel file containing additional information related to ATAC-seq data in Figure 2
mmc4.xlsx (24.9MB, xlsx)
Table S4. Excel file containing gene lists related to RNA-seq data in Figure 3
mmc5.xlsx (14KB, xlsx)
Table S5. Excel file containing gene lists related to RNA-seq data in Figure 5
mmc6.xlsx (60.6KB, xlsx)
Document S2. Article plus supplemental information
mmc7.pdf (69.1MB, pdf)

Data Availability Statement

  • ATAC-seq (GEO: GSE264724), ChIP-seq (GEO: GSE264726), CRISPR-seq (GEO: GSE264727), and RNA-seq (GEO: GSE264728) data have been deposited at NCBI GEO database and are publicly available as of the date of publication. Accession numbers are listed in the key resources table. Original western blot images have been deposited at Mendeley (https://doi.org/10.17632/v25sw2s8k9.1) and are publicly available as of the date of publication.

  • This paper does not report original code.

  • Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.


Articles from Cell Reports Medicine are provided here courtesy of Elsevier

RESOURCES