Curcumin-alendronate carbon dots: A dual-logic strategy for precision treatment of periodontitis

Abstract

Periodontitis, a multifaceted chronic inflammatory disorder affecting the oral cavity, with its etiology intricately linked to oxidative stress. Existing pharmacotherapies for periodontitis often suffer from a lack of target specificity and are challenged by the double demands of mitigating oxidative stress and promoting tissue regeneration in a coordinated, multi-pronged strategy. To address the challenges of “where” and “how”, this study synthesizes both guidance and therapeutic dual logic-based Curcumin-Alendronate carbon dots (Cur-Alen CDs). Cur-Alen CDs retain the characteristics of alendronate which can accurately target periodontitis bone tissue and osteoclasts to exert guidance logic. At the same time, the therapeutic logic of Cur-Alen CDs is reflected in its superior antioxidant activity to curcumin, which effectively down-regulates the expression of key inflammatory factors and reverse the imbalance of the bone microenvironment in periodontitis. Notably, RNA sequencing of periodontitis rat models revealed that Cur-Alen CDs treat periodontitis by modulating the NF-κB signaling pathway. This study highlights the dual-logic properties of Cur-Alen CDs, namely the multi-faceted modulation of the inflammatory microenvironment and the specific targeting ability. The potential of Cur-Alen CDs for the precision therapy of periodontitis is underscored.

Graphical abstract

1. Introduction

Periodontitis, a multifaceted inflammatory disease [1], can result in the progressive destruction of tooth-supporting tissues—comprising the gums, periodontal ligament, cementum, and alveolar bone [2,3]—if left without proper treatment intervention. The etiology of periodontitis is intricately associated with reactive oxygen species (ROS) [4,5]. Excessively high levels of ROS lead to an increased oxidant burden, causing oxidative stress within the affected host tissues. Intracellularly, ROS induce apoptosis in gingival fibroblasts and inhibit their growth. Additionally, ROS can indirectly promote alveolar bone resorption by facilitating osteoclastogenesis. The inflammatory microenvironment of periodontitis activates various signaling pathways [6,7], including the NF-κB pathway [8], which plays a central role in regulating the expression of pro-inflammatory cytokines and chemokines. Activation of NF-κB leads to the production of interleukin-1β (IL-1β), tumor necrosis factor-alpha (TNF-α), and other inflammatory mediators, which contribute to the progression of periodontitis [9]. Pro-inflammatory cytokines and ROS create a vicious cycle, perpetuating the destructive process in periodontitis. Pro-inflammatory cytokines not only stimulate the generation of osteoclasts but also impair the function of osteoblasts, down-regulate the expression of osteogenic markers such as runt-related transcription factor 2 (RUNX2) and alkaline phosphatase (ALP), and decrease the production of bone matrix proteins like collagen type I and osteocalcin. Consequently, this leads to reduced bone formation and impaired healing of periodontal defects, exacerbating the destructive process of periodontitis [10]. Therefore, breaking the vicious cycle between ROS and inflammatory factors, improving the bone microenvironment of periodontal tissues are the therapeutic logics (“how”) that periodontitis drugs should possess.

Current treatment strategies for periodontitis primarily encompass mechanical scaling, surgical intervention, and systemic or local administration of medications. However, the long-term outcomes of mechanical scaling or surgical treatment alone are suboptimal, with a propensity for recurrence. Moreover, existing medications used for local periodontal therapy have limited functionality, which makes it challenging to address the complex etiology of periodontitis and predisposes to the development of drug resistance [11,12]. Many natural compounds have long attracted the attention of researchers due to their broad biological activities and relatively low toxicity. Curcumin, a natural polyphenol derived from turmeric, has garnered significant interest due to its potential in treating periodontitis. It possesses properties such as bone formation, inhibition of bone resorption, anti-inflammatory, antioxidant, and antibacterial activities. Moreover, it targets multiple pathways associated with periodontal disease, including the NF-κB and MAPK pathways [[13], [14], [15], [16], [17], [18], [19]]. Despite its therapeutic potential, curcumin's effectiveness is limited by its poor absorption, low bioavailability, and rapid metabolism. With the continuous advancement of nanotechnology, it is possible to overcome the limitations of therapeutic molecules derived from natural sources. Carbon dots (CDs), a class of zero-dimensional nanomaterials, exhibit great potential in various biomedical applications such as bioimaging, nanomedicine development, drug delivery, cancer diagnosis and therapy, and biosensing due to their small size, unique optical properties, high biocompatibility, and ease of surface modification. Recent studies have shown that curcumin-derived CDs not only retain the beneficial effects of curcumin but also effectively overcome the challenges related to its solubility and bioavailability. Wu et al. used curcumin-quaternized CDs for their antimicrobial properties to facilitate wound healing in clinically infected wounds. Azzania et al. utilized curcumin CDs to inhibit the dimerization of nuclear cap-binding complex CTD (N-CTD) as a strategy against SARS-CoV-2 virus. Additionally, there are research teams that have applied curcumin CDs in bioimaging [[20], [21], [22]]. However, the application and mechanism of curcumin-derived CDs in inflammatory diseases need further exploration.

Furthermore, the characteristic features of periodontitis necessitate that the corresponding therapeutic agents possess not only a therapeutic logic (“how”) but also a guidance logic (“where”), which entails an accurate response to the periodontally inflamed microenvironment and the determination of the site of action. Alendronate, a synthetic pyrophosphate analog, can specifically bind to hydroxyapatite in bone tissue and inhibit osteoclast activity to prevent bone resorption. Due to alendronate's high affinity for bone tissue, it is commonly used as a bone-targeting moiety in drug delivery systems [23]. Our previous research has confirmed that CDs synthesized using alendronate and polyethylene glycol exhibit excellent bone-targeting properties as well as effectively inhibit osteoclast formation and modulate immune responses [24]. Multiple clinical studies have shown that alendronate demonstrates significant clinical efficacy in treating periodontal disease, particularly when used as an adjunct to scaling and root planing procedures, which can significantly reduce probing depths and bony defects [25]. Therefore, alendronate may not only provide a precise targeting group for periodontal therapeutic agents but also synergistically enhance the overall effectiveness of periodontal disease treatment.

Given the potential of multi-material nanomedicines, we propose combining curcumin and alendronate as precursors for synthesizing CDs. This approach leverages the synergistic effects of both compounds to overcome their individual limitations and enhance their therapeutic efficacy in treating periodontitis, thereby implementing a dual-logic (Guidance and Therapeutic) strategy. The combination of curcumin and alendronate in CDs offers a novel targeted multifunctional therapeutic agent that can reduce inflammation, eliminate ROS, enhance osteoblast function, and suppress osteoclastogenesis, thereby precisely supporting the healing process of periodontitis.

2. Results

2.1. Synthesis and characterization

In this study, curcumin-alendronate carbon dots (Cur-Alen CDs) were synthesized from curcumin and alendronate using the hydrothermal synthesis for the first time. Transmission electron microscopy (TEM) images, as depicted in Fig. 1a and Fig. 1b, revealed that the synthesized Cur-Alen CDs exhibited a uniform diameter of 3.4 ± 0.84 nm, with distinct lattice fringes and a lattice spacing of 0.226 nm and 0.321 nm. This lattice spacing was indicative of the (100) plane and (002) plane of graphitic carbon, underscoring the crystalline nature of the Cur-Alen CDs. In addition, a main X-ray diffraction (XRD) peak at approximately 2θ = 24°for Cur-Alen CDs, corresponding to the (002) crystal plane of graphitic carbon (Fig. S1). The Raman spectra of Cur-Alen CDs was presented in Fig. S2, D peak at 1356 cm⁻¹ and G peak at 1574 cm⁻¹. The calculated ID/IG intensity values of Cur-Alen CDs was 0.89, respectively, indicating that these Cur-Alen CDs possessed carbon defects and graphitic structure. This finding provides a coherent structural explanation for the simultaneous observation of both (100) and (002) lattice planes in our HR-TEM images.

Fig. 1.

Synthesis and characterization a) TEM and HRTEM (inset) images of Cur-Alen CDs. b) Size distribution of Cur-Alen CDs. c) XPS of Cur-Alen CDs. d) high-resolution C1s spectrum. e) high-resolution O1s spectrum. f) high-resolution N1s spectrum. g) high-resolution P2p spectrum. h) The FTIR spectra of Alen, Cur, and Cur-Alen CDs. i) UV–vis absorbance spectra. j) PL spectrum of Cur-Alen CDs. k) Cellular uptake of Cur-Alen CDs in RAW264.7 cells. l) Zeta potential of Cur-Alen CDs solution under different pH values. Con: Simulation of normal oral pH environment, PD: Simulation of periodontitis oral pH environment. m) Adsorption ratio of Cur-Alen CDs solution under different pH values. Con: Simulation of normal oral pH environment, PD: Simulation of periodontitis oral pH environment. n) Fluorescence imaging after treatment with Cur-Alen CDs or PBS in mice (48h) under the 460/530 nm wavelength of excitation/emission. Unless otherwise stated, CDs: Cur-Alen CDs; Cur: Curcumin; Alen: Alendronate; PD: periodontitis.

To elucidate the chemical composition and functional groups present in the Cur-Alen CDs, we utilized X-ray photoelectron spectroscopy (XPS) and Fourier-transform infrared spectroscopy (FTIR). The XPS analysis, as illustrated in Fig. 1c to Fig. 1g, demonstrated that the Cur-Alen CDs were predominantly composed of carbon, nitrogen, oxygen, and phosphorus. The C1s XPS spectrum was deconvoluted into three distinct peaks, which correspond to the following chemical environments: ester groups (-COOR) at a binding energy of 288.95 eV, carbon-oxygen or carbon-nitrogen bonds (C-O//C−N) at 286.05 eV, and carbon-hydrogen or carbon-carbon bonds (C-H/C-C) at 284.80 eV. The N1s spectrum was resolved into two peaks, corresponding to ammonium ions (NH₄⁺) at 401.45 eV and nitrogen within amide or nitrile groups (O=C-N) at 400.15 eV. The O1s spectrum was characterized by two peaks, attributed to oxygen in amide or phosphate groups (O=C-N/PO₄³⁻) at 530.95 eV and carbon-oxygen bonds (C-O) at 532.65 eV. The P2p spectrum exhibited a single peak, which was indicative of phosphate groups (PO₄³⁻) at a binding energy of 133 eV. FTIR results, as delineated in Fig. 1h, revealed distinct absorption peaks at approximately 1636 cm⁻¹ and 1627.87 cm⁻¹, which were ascribed to the stretching vibrations of the carbonyl (ν C=O) group. The bending vibration absorption peak for C-H was observed at 1453.74 cm⁻¹, and for N-H, it was noted at 1518.24 cm⁻¹. In the phosphorus stretching region, comparative analysis with alendronate indicated the presence of absorption bands at 1064.45 cm⁻¹, 1018.46 cm⁻¹ (assigned to symmetric and asymmetric stretching vibrations of PO₃, denoted as νs and νas, respectively), and 921.20 cm⁻¹ (attributed to the vibration of POH). For the Cur-Alen CDs, a broadened absorption band was observed around 1057.21 cm⁻¹, along with a peak at 923.10 cm⁻¹, suggesting the successful incorporation of the phosphate groups into the Cur-Alen CDs structure. Furthermore, the absorption peak at 1163 cm⁻¹ corresponded to the stretching vibration of the C-O bond. The ultraviolet–visible (UV–vis) absorption spectrum, as illustrated in Fig. 1i, exhibited a pronounced and broad absorption peak in the range of 264–270 nm. This spectral feature was characteristic of aromatic compounds, arising from the intrinsic vibrational modes of the benzene ring and the electronic transition from π to π∗ within the conjugated π-electron system. This comprehensive characterization underscored the Cur-Alen CDs as a promising nanomaterial with a diverse array of functional groups could be leveraged for various biomedical applications, including but not limited to, bone health and antioxidant therapy.

CDs have garnered considerable attention in the realm of biomedical applications, particularly in the field of bioimaging. The photoluminescence properties of the Cur-Alen CDs were meticulously examined to further elucidate their optical behavior. The photoluminescence (PL) spectrum revealed that Cur-Alen CDs were capable of emitting a robust fluorescence in the wavelength range of 400–550 nm when excited at the peak wavelength of 390 nm, with the emission reaching a maximum intensity at approximately 470 nm (Fig. 1j). The emission spectrum was redshifted as the excitation wavelength increase. This excitation-dependent fluorescence characteristic underscores the tunable nature of the Cur-Alen CDs' optical response. Furthermore, confocal laser scanning microscopy (CLSM) images, as presented in Fig. 1k and Fig. S3, demonstrated that the Cur-Alen CDs were efficiently internalized by cells, signifying that the Cur-Alen CDs possess the necessary attributes for effective cellular uptake and delivery.

The pH value within the periodontal pocket exhibits an increasing trend concomitant with the progression of periodontitis. As demonstrated in Fig. 1l, the zeta potential measurements indicated that Cur-Alen CDs carry negative charges (−35.3 ± 0.9 mV), a property becomes more pronounced with an elevation in pH (−72.3 ± 2.5 mV). Experimental data, as illustrated in Fig. 1m, demonstrated that the Cur-Alen CDs exhibit an adsorption rate of (45 ± 1.9) % to hydroxyapatite, with an enhanced adsorption rate observed under the pH conditions characteristic of periodontitis ((65 ± 2.7) %). The in vivo fluorescence distribution of Cur-Alen CDs was monitored by the IVIS Lumina LT imaging system. Compared with the phosphate-buffered saline (PBS) control group, an increased fluorescence aggregation was observed in the limbs and jaws of the Cur-Alen CDs group. The faint fluorescence detected in the kidneys indicates that Cur-Alen CDs can be excreted through urine. Moreover, due to the relatively slow excretion of the liver and bile, the liver exhibited partial fluorescence (Fig. 1n). These results suggest that Cur-Alen CDs have the ability to target bone tissue in the periodontitis environment.

2.2. Biocompatibility

Biosafety is an imperative criterion for the clinical translation of nanomaterials. The hemocompatibility of the Cur-Alen CDs was assessed using red blood cells, with TritonX-100 serving as a positive control. Even at a concentration of 80 μg/mL, Cur-Alen CDs exhibited minimal hemolytic activity towards red blood cells (Fig. 2a). The safety profile of the Cur-Alen CDs within a specified concentration range (5–80 μg/mL) was further evaluated using the CCK-8 assay, as illustrated in Fig. 2b. The concentration at which a slight reduction in cell viability was observed as 80 μg/mL for RAW264.7 cells and 40 μg/mL for bone marrow stem cells (BMSCs). Importantly, high concentrations of Cur-Alen CDs did not exhibit toxicity to human gingival fibroblasts (HGF), while low concentrations paradoxically demonstrated a proliferative effect (Fig. S4). Long-term toxicity test, as depicted in Fig. 2c and Fig. S5, revealed that a concentration of 20 μg/mL Cur-Alen CDs did not exert any inhibitory effects on RAW264.7 cells, HGF, and BMSCs. Concurrently, live/dead staining was employed to visually assess the viability of BMSCs, HGF, and RAW264.7 cells at varying concentrations of Cur-Alen CDs. The absence of propidium iodide (PI)-positive red fluorescence, indicative of dead cells, was barely discernible under fluorescence microscopy, as shown in Fig. 2d, Fig. 2e, Fig. S6 and Fig. S7. These findings indicate that Cur-Alen CDs possess significant biocompatibility and negligible toxicity, thereby exhibiting a higher safety profile compared to the therapeutic concentrations of curcumin and alendronate.

Fig. 2.

Biocompatibility a) Hemolysis after treatment with Cur-Alen CDs. b) CCK-8 analysis of the viability of RAW264.7 cells and BMSCs treated with different Cur, Alen and Cur-Alen CDs concentrations for 24 h. Unless otherwise stated, ∗P < 0.05; ∗∗P < 0.01; ∗∗∗P < 0.001; ∗∗∗∗P < 0.0001. c) Growth curves of RAW264.7 cells and BMSCs cultured in Cur, Alen and Cur-Alen CDs for 5 days. d) Live-dead staining of BMSCs incubated with different Cur-Alen CDs concentrations for 24 h. e) Semi-quantitative analysis of BMSCs live/dead staining.

2.3. Antioxidative stress and anti-inflammatory properties

ROS are pivotal factors in the pathogenesis of periodontitis. Our research has confirmed that Cur-Alen CDs possess the capability to neutralize hydroxyl (•OH) and 2,2-diphenyl-1-picrylhydrazyl (DPPH) radicals, as depicted in Fig. 3a. Subsequently, we investigated the impact of Cur-Alen CDs on macrophages under inflammatory conditions. We induced RAW264.7 cells to produce an excess of ROS using lipopolysaccharide (LPS) stimulation. The ROS scavenging capacity was assessed using the DCFH-DA fluorescence probe. As shown in Fig. 3b, following LPS treatment, the fluorescence probe reacts with ROS to form DCF, which exhibits a strong fluorescent signal. A noticeable quenching of fluorescence was observed in the cell group treated with Cur-Alen CDs. We measured the mitochondrial membrane potential by JC-1 fluorescence mitochondrial staining assay. In the Cur-Alen CDs treatment group, a lower intensity of green fluorescence is observed (Fig. Fig. S8). The results were consistent with the DCFH staining trend, indicating that Cur-Alen CDs possess significant intracellular ROS scavenging properties. Therefore, we further employed quantitative polymerase chain reaction (qPCR) to assess the expression levels of Foxo1, Ho-1, and Nqo1, and conducted MDA quantification, carbonyl detection, H₂O₂ measurement, and relevant enzyme activity assays (Figs_3c-3e) to validate that Cur-Alen CDs can effectively quench ROS, ameliorate oxidative stress, enhance the activity of peroxidase (POD) and superoxide dismutase (SOD), and attenuate the levels of MDA, hydrogen peroxide, and carbonyls. Concurrently, qPCR analysis indicated that in RAW264.7 cells (Fig. 3g) and HGF (Fig. S9) induced by LPS, the expression levels of the pro-inflammatory cytokines Tnf-α, Il-6, and Il-1β in the Cur-Alen CDs group were significantly lower than those in the LPS group. In the in vivo experimental phase, the fluorescent probe 2′,7′-dichlorofluorescein diacetate (DCFH-DA) was administered to the gingival tissues of mice, followed by fluorescence imaging to assess ROS levels at the infection sites. The group treated with LPS exhibited the most intense fluorescence signal, indicating high ROS levels, whereas the group treated with Cur-Alen CDs showed the weakest signal (Fig. 3f). Collectively, these results demonstrate the capability of Cur-Alen CDs to eliminate ROS, thereby potentially reversing the oxidative and inflammatory microenvironment associated with periodontitis.

Fig. 3.

Antioxidative stress and anti-inflammatory properties a) •OH and DPPH scavenging ability of Cur-Alen CDs at different concentrations. b) Scavenging efficiencies of Cur-Alen CDs for ROS. Levels of ROS in RAW264.7 cells. c) Gene expression levels of anti-ROS-related markers after stimulation by LPS of RAW264.7 cells. d) Levels of malondialdehyde (MDA) in RAW264.7 cells. e) Carbonyl group detection, H₂O₂ detection, enzyme activity detection of Cur and Cur-Alen CDs in RAW264.7 cells. f) Fluorescence images showing ROS levels in infected periodontal tissue with different treatments. g) mRNA levels of inflammation-related cytokines in RAW264.7 cells. 3D surface plot was employed for the visualization of fluorescence intensity.

2.4. Effects on the inflammatory microenvironment

The inflammatory microenvironment significantly impedes the osteoblast proliferation and differentiation of periodontal tissues, thereby exerting a detrimental effect on the regeneration of periodontal tissues. Addressing the issue of bone regeneration under such inflammatory conditions is a key research focus in the field of periodontal tissue engineering. In our study, LPS was utilized to stimulate BMSCs to replicate the inflammatory microenvironment typically encountered in periodontitis. To assess the osteogenic potential of BMSCs under these conditions, we employed qPCR (Fig. 4b) and Western blotting (WB) analysis (Fig. S10) to evaluate the expression of genes associated with osteogenesis. The qPCR results indicate that the mRNA expression levels of the Runx2, Alp, and Opn genes in the Cur-Alen CDs group were significantly higher compared to the LPS group. The WB results show that, in comparison to the LPS group, the protein expressions of Runx2 and Opg in the Cur-Alen CDs treated cells were significantly elevated. Additionally, Alizarin Red staining and alkaline phosphatase activity were conducted at specific time points (Fig. 4a, Fig. 4g) to further characterize osteogenic differentiation. Our research results indicated that Cur-Alen CDs can significantly enhance the osteogenic differentiation of BMSCs in an inflammatory environment.

Fig. 4.

Effects on the inflammatory microenvironment a) ALP staining after osteogenic induction for 7 days. ARS staining after osteogenic induction for 14 days. b) Osteogenic marker gene expression on day 5 post-treatment. c) The expression level of osteoclast-related genes of BMDMs at 5 days. d) Gene expression levels of soft-tissue healing markers after stimulation by LPS of HGF. e) Representative images of TRAP staining in BMDMs treated with Cur-Alen CDs, Cur and Alen for 5 days. f) Wounding healing assays of HGF treated with LPS, images were acquired 0 h and 24 h after the scratch. g) Semi-quantitative analysis of ARS staining and ALP staining. h) Semi-quantitative analysis of TRAP staining. i) Semi-quantitative measures of wounding healing assays.

Osteoclasts differentiated from monocytes/macrophages are instrumental in bone resorption, and their excessive activity is a hallmark of pathological bone loss observed in periodontitis. Alendronate, known for its inhibitory effect on osteoclast differentiation, is a key component of our synthesized Cur-Alen CDs. In order to determine whether Cur-Alen CDs maintain this inhibitory effect, we performed in vitro simulations of periodontitis, utilizing RANKL and MCSF to induce osteoclast differentiation in bone marrow-derived macrophages (BMDMs). Subsequent to the induction, we performed tartrate-resistant acid phosphatase (TRAP) staining and qPCR analysis to assess the osteoclastogenesis. The TRAP staining, as depicted in Fig. 4e and Fig. 4h, revealed a reduction in the number of TRAP-positive osteoclasts within the group treated with Cur-Alen CDs. This evidence suggested that the Cur-Alen CDs can impede the differentiation of osteoclasts. Further corroboration was provided by the qPCR results presented in Fig. 4c, which indicated that Cur-Alen CDs significantly suppressed the expression of genes pivotal to osteoclast differentiation, namely Nfatc1 (Nuclear factor of activated T-cells 1), Calcr (calcitonin receptor), and Ctsk (cathepsin K). NFATC1 is recognized for its high expression during the early phases of osteoclast differentiation, while CTSK is predominantly expressed in the later stages. The down-regulation of these genes by Cur-Alen CDs underscores the inhibitory influence exerted at all stages of osteoclastogenesis. These findings collectively demonstrated that Cur-Alen CDs effectively induce inhibitory effects throughout the osteoclast differentiation process.

To validate the effect of Cur-Alen CD on the ability of cells to migrate in an inflammatory environment, we performed a cell scratch experiment. As depicted in Fig. 4f and Fig. 4i, cells treated with Cur-Alen CDs exhibited a significantly higher migration rate compared to cells treated solely with LPS and untreated control groups. This observation suggested that Cur-Alen CDs may possess the potential to alleviate the inhibitory effects of inflammation on cell migration. Furthermore, we examined the expression alterations of genes associated with soft-tissue healing under inflammatory conditions and found that the group treated with Cur-Alen CDs showed a significant enhancement compared to the LPS-treated group (Fig. 4d).

2.5. The impact of Cur-Alen CDs on Periodontitis in Rats

In vitro experiments have established that Cur-Alen CDs possess a range of beneficial properties, including antioxidant, anti-inflammatory, osteogenic activity promotion, and osteoclast differentiation inhibition capabilities. Based on these findings, we proceeded to develop a periodontitis model to assess the in vivo therapeutic effects of Cur-Alen CDs and elucidate their underlying mechanisms. Given that local administration is a common method for treating periodontitis, our team employed direct injection as the method of drug delivery. Micro-computed tomography (micro-CT, Fig. 5a) revealed that the Cur-Alen CDs group exhibited less alveolar bone resorption compared to the periodontitis group, with a shorter CEJ-ABC distance, a significant increase in alveolar bone height. The Cur-Alen CDs group was associated with increased BV/TV, increased Tb.Th, and decreased Tb.Sp compared to the PD group (Fig. S11, Fig. S12, and Fig. S13). There was no significant difference in Tb.N (Fig. S14) between the Cur-Alen CDs group and PD group. Histological hematoxylin and eosin (H&E) staining (Fig. 5b) of the periodontitis model revealed that periodontitis group had disorganized connective tissue with widespread inflammatory cell infiltration, while the Cur-Alen CDs group showed a significant reduction in inflammatory cell infiltration and a decrease in alveolar bone resorption.

Fig. 5.

The impact of Cur-Alen CDs on Periodontitis in Rats a) 3D-reconstructed images produced by micro-CT were performed on maxillae. The average distance from alveolar bone crest (ABC) to cement-enamel junction (CEJ). b) H&E staining of periodontal tissue after 4 weeks of treatment. c) Representative TRAP staining image of each group. d) DNA was isolated and analyzed for 8-OHdG content using ELISA assay. e) Gene expression levels of cellular anti-ROS-related markers and inflammation-related markers. f) Masson staining of periodontal tissue after 4 weeks of treatment. g) Semi-quantitative analysis of TRAP staining.

To further confirm the in vivo effects of Cur-Alen CDs on inhibiting osteoclast differentiation and their anti-inflammatory and antioxidant properties, we performed TRAP staining on bone sections from the periodontitis model (Fig. 5c and Fig. 5g). The results demonstrated a significant increase in the number of TRAP-positive cells in the periodontitis group compared to the control group, while the TRAP positivity rate was markedly reduced in the Cur-Alen CDs group. This outcome confirmed the in vivo inhibitory effect of Cur-Alen CDs on osteoclast differentiation. The assessment of oxidative damage in the periodontitis site was conducted using detection of 8-hydroxy-2′-deoxyguanosine (8-OHdG, Fig. 5d) and qPCR (Fig. 5e). These analyses suggest that Cur-Alen CDs can ameliorate oxidative stress and mitigate the release of pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) at the periodontitis lesion site. Masson's trichrome staining results indicated that the Cur-Alen CDs group exhibited denser and more orderly collagen fibers compared to the periodontitis group, with a greater area of deep blue staining and a reduction in red-stained regions. This suggests that Cur-Alen CDs alleviated periodontal tissue inflammation and reversed the degradation of collagen fibers. (Fig. 5f). In summary, our comprehensive in vivo studies highlight the multifunctional therapeutic potential of Cur-Alen CDs in the treatment of periodontitis.

To assess the in vivo bio-safety of Cur-Alen CDs, we performed H&E staining on organ tissues (heart, liver, spleen, kidney, and lung) of rats (Fig. S15), as well as blood biochemistry and routine blood tests (Fig. S16). The results showed no significant differences in cellular morphology between the Cur-Alen CDs group and the control group in all examined organs. Additionally, no significant abnormalities were observed in blood biochemistry and routine tests, indicating that Cur-Alen CDs exhibit minimal toxicity and can be safely administered in vivo.

2.6. The mechanism of Cur-Alen CDs Ameliorating Periodontal Disease

RNA sequencing was conducted on periodontitis model tissues to explore the mechanisms by which Cur-Alen CDs treat periodontitis. Gene Ontology Enrichment Analysis (KEGG) analysis results (Fig. 6a) showed significant differences in the NF-κB and osteoclast differentiation pathways. Gene Ontology Enrichment Analysis (GO) (Fig. 6b) results indicated that the functions of CDs were enriched in immunity (such as immunoglobulin receptor binding), calcium ion (such as calcium ion binding), and oxidative stress (such as peroxidase activity), corresponding to previous in vivo and in vitro experimental results. Gene set enrichment analysis (GSEA) results (Fig. 6c, Fig. S17, Fig. S18 and Fig. S19) indicated that these pathways were generally down-regulated in the experimental group compared to the control group. Additionally, the Hedgehog, Hippo, and Wnt pathways in the experimental group were upregulated compared to the control group, consistent with previous results of inflammatory osteogenesis experiments. We employed immunohistochemical (IHC) staining of tissue sections to confirm, at the protein level, that the expression of NF-κB pathway-related genes, such as Tnf -α and Rank, was significantly reduced in the CDs group compared to the periodontitis group (Fig. 6d, Fig. 6e). In vitro experimental results were consistent with in vivo findings, including immunofluorescence (IF) (Fig. 6f), WB assays (Fig. 6g, Fig. 6i and Fig. 6j) and qPCR (Fig. 6, Fig. 3g). p65 is a key subunit of NF-κB, and its phosphorylation (p-p65) is one of the important steps in the activation of the NF-κB signaling pathway. The results of WB (Fig. 6h, Fig. 6k) showed that the phosphorylation of NF-κB p65 was promoted in the LPS group, and the expression level of p-p65/p65 protein in the Cur-Alen CDs group was lower than that in the LPS group. Notably, after treatment with CDs, a decrease in the corresponding markers was observed. Simultaneously, we identified periodontitis-related targets such as IKKF3, SP140, and CXCL1 through protein-protein interaction (PPI) network analysis (Fig. 6m) and transcription factor analysis (Fig. 6n, Fig. S20).

Fig. 6.

The mechanism of Cur-Alen CDs Ameliorating Periodontal Disease a) KEGG enrichment analysis of significantly different RNAs. b) GO enrichment analysis of significantly different RNAs. c) GSEA analysis of NF-κB pathway and osteoclast differentiation pathway. d) IHC evaluation of Tnf-α and Rank in periodontal tissues. e) Semi-quantitative IHC analysis of Tnf-α and Rank. f) Representative images of IF staining with Tnf-α (green) and Rank (red) in RAW264.7 cells. 3D surface plot was employed for the visualization of fluorescence intensity. g, i, j) The protein expression levels of Tnf-α and Rank in RAW264.7 cells. h, k) The protein expression levels of p-p65 and p65 in RAW264.7 cells. l) The mRNA expression level of Rank in RAW264.7 cells. m) Part of protein-protein interaction network analysis via string. n) Top TFs analysis via ChEA3. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

3. Discussion

Our research has pioneered an innovative nanodrug, Cur-Alen CDs, which is designed to overcome the limitations of conventional local periodontal therapies, such as limited functionality and imprecise targeting. This novel nanodrug embodies a dual logic strategy, encompassing both guidance and therapeutic. The uniqueness of Cur-Alen CDs lies in their ability to precisely locate and target the areas affected by periodontitis. Meanwhile, they can alleviate inflammation, relieve oxidative stress and facilitate the restoration of balance within the microenvironment of the damaged bone tissue. In the material selection process, we opted for alendronate as the precursor for crafting CDs. Subsequent physicochemical property analyses confirmed that the synthesized Cur-Alen CDs preserved the phosphate groups, which are crucial for bone tissue targeting. Patients with periodontitis tend to have a more alkaline oral environment [12], and we have observed that this environment enhances the bone targeting effect of Cur-Alen CDs. This enhancement may due to the increased negative charge of Cur-Alen CDs at higher pH levels, promoting a stronger interaction with the positively charged calcium ion sites on hydroxyapatite [26]. Furthermore, through comprehensive evaluations of biosafety and biocompatibility, including hemolysis tests, CCK-8 cell viability assays, and histological analyses of visceral tissue sections, we have established that Cur-Alen CDs demonstrate superior biocompatibility. So this study have addressed the shortcomings of traditional positively charged nanoparticles, such as weak targeting capabilities, easy hemolysis, and cytotoxicity [27,28]. As a promising therapeutic approach, Cur-Alen CDs offer the potential for more precise action on periodontal lesion sites, significantly minimizing interference with healthy tissues, and enhancing the efficacy and safety of drug delivery, thereby achieving guidance logic in the treatment of periodontitis.

Activated macrophages, under the influence of LPS, release a significant amount of ROS upon NF-κB pathway activation [29]. The excessive accumulation of these species intensifies oxidative stress and amplifies inflammatory signaling within affected tissues [30,31]. Moreover, elevated ROS levels promote osteoclastogenesis, disrupting the balance in the periodontal bone microenvironment. It is crucial to modulate ROS levels to physiological norms to protect periodontal tissues from the inflammatory immune microenvironment's detrimental effects. Previous studies have shown that curcumin can ameliorate osteoblast dysfunction caused by oxidative stress [32]. Curcumin primarily exerts its anti-ROS effects through its phenolic hydroxyl groups [33]. In an alkaline environment, the scavenging of free radicals by curcumin is attributed to the combined action of the phenolic hydroxyl and methoxy groups with the 1,3-diketone moiety, forming a conjugated diene system [34]. The FTIR results, with the C-H stretching vibration at 2974 cm⁻¹ and the absorption peak of C-O bond at 1163 cm⁻¹, indicate that Cur-Alen CDs retain the methoxy groups connected to the benzene ring. The absorption peaks at 1636 cm⁻¹ and 1627.87 cm⁻¹ suggest that Cur-Alen CDs may preserve the 1,3-diketone structure. Further integration of XPS results, we believe that the synthesis process of Cur-Alen CDs not only retains the characteristic groups of curcumin that exert antioxidant activity under alkaline conditions but also undergoes an esterification reaction. Previous studies have demonstrated that esterification of curcumin phenolic hydroxyl groups enhances their antioxidant capacity [35,36], and the presence of -COOR groups indicates an enhancement of the antioxidant ability of Cur-Alen CDs. Antioxidant experiments have confirmed that Cur-Alen CDs can effectively neutralize ROS, eliminate free radicals, and boost enzymatic activity, while qPCR results demonstrate their ability to upregulate the expression of anti-ROS-related genes, including forkhead box O1 (Foxo1), heme oxygenase-1 (Ho-1), and nad(p)h quinone dehydrogenase 1 (Nqo1). Previous studies have pointed out that FOXO1 overexpression can shield human periodontal ligament stem cells from oxidative stress-induced damage, even under inflammatory conditions, by reducing ROS accumulation, lowering malondialdehyde (MDA) levels—a biomarker of lipid peroxidation and oxidative stress [19]—and upregulating osteogenic markers such as RUNX2 [37]. Furthermore, Bartell et al. reported that FOXO1 can inhibit osteoclastogenesis by reducing the levels of hydrogen peroxide (H₂O₂) [38]. Collectively, these findings indicate that increased expression of FOXO1 can have a positive impact on the repair of periodontal tissues. Similarly, HO-1 has been demonstrated to suppress the down-regulation of osteoprotegerin (OPG) in human periodontal ligament cells [39]and to mitigate the release of pro-inflammatory mediators induced by LPS [40]. Additionally, multiple research teams have mitigated the elevated ROS milieu characteristic of periodontitis through the upregulation of NQO1, a key enzyme that, in conjunction with HO-1, constitutes an integral part of the NRF2 signaling pathway [41,42], which plays a pivotal role in the cellular response to oxidative stress [43]. We speculate that Cur-Alen CDs, through their ROS-scavenging capability, can alleviate the adverse effects of the inflammatory microenvironment on cells, promoting tissue healing and the osteogenic potential of BMSCs. While clearing ROS can inhibit osteoclastogenesis, in this study, we believe that the alendronate characteristics of Cur-Alen CDs further enhance this inhibitory effect. Our previous studies have shown that alendronate-modified CDs can curb excessive bone destruction by inhibiting the transcription of osteoclastogenesis-related genes and reducing osteoclast production [23]. This study's qPCR and TRAP results indicate that Cur-Alen CDs maintain this characteristic, preventing further bone destruction in an inflammatory environment. The therapeutic logic endowed by curcumin and alendronate makes Cur-Alen CDs a potentially effective treatment strategy for the comprehensive and multi-pathway amelioration of the periodontitis microenvironment.

Existing research has clearly established a close link between the NF-κB pathway and periodontitis [44,45]. To further validate this pathway and explore whether its regulation constitutes a key mechanism in the treatment of periodontitis by Cur-Alen CDs, we integrated various omics data for analysis. Through this comprehensive analysis, we not only confirmed the importance of the NF-κB pathway but also identified changes in several key genes, particularly Tnf-α, a gene that plays a central role in the NF-κB pathway, whose expression levels significantly increased in patients with periodontitis. To confirm this finding, we conducted detailed validations of Tnf-α in both in vivo and in vitro experiments, and the results were highly consistent with the omics analysis, further confirming the important role of Tnf-α in the pathological process of periodontitis. The role of Tnf-α is not limited to directly stimulating osteoclast precursor cells [46], it also indirectly promotes the generation of osteoclasts by inducing the expression of Rank on the surface of these cells [47]. Notably, Rank is not only a component of the NF-κB pathway but was also identified as a significantly differentially expressed gene in our omics analysis. Based on this discovery, we conducted a series of validation experiments to fully assess the role of Rank in periodontitis, and the results showed that the expression of Rank was significantly upregulated in patients with periodontitis, further supporting the key role of Rank in the pathogenesis of periodontitis. P65 is a key subunit of NF-κB, and the abnormal activation of NF-κB/p65 is an important pathogenic mechanism in various inflammatory diseases [48,49]. Studies have shown that inhibiting the phosphorylation of p65 protein can effectively alleviate the symptoms of periodontal inflammation and promote disease recovery [50]. WB results suggest that Cur-Alen CDs may prevent NF-κB pathway activation by inhibiting the phosphorylation of p65 protein. Based on the aforementioned experimental results, we speculate that Cur-Alen CDs effectively reverse the imbalance between bone resorption and bone formation in periodontitis by inhibiting NF-κB pathway activation and reducing the expression of its key molecule Tnf-α and downstream target Rank. Considering the multifunctionality of Cur-Alen CDs in the treatment of periodontitis and the complexity of their mechanisms of action, we further utilized ChEA3 and PPI network analysis to delve into the mechanisms of Cur-Alen CDs. These analyses can not only provide new research directions, but also reveal more potential therapeutic targets, offering valuable insights for future strategies. Through these multidimensional research methods, we hope to gain a deeper understanding of Cur-Alen CDs and pave new paths for the treatment of periodontitis.

4. Conclusion

In summary, we successfully synthesized bone-targeting Cur-Alen CDs using hydrothermal synthesis. The primary results demonstrate that Cur-Alen CDs not only retains the bone-targeting properties of alendronate, enabling precise delivery to inflamed periodontal tissues, but also concomitantly suppresses osteoclast differentiation and promotes bone formation, thereby restoring the disrupted bone microenvironment. Mechanistically, Cur-Alen CDs likely treats periodontitis through inhibition of the NF-κB signaling pathway and disruption of the ROS-inflammation cycle. This dual-logic therapeutic strategy combining precision targeting with multimodal regulation positions Cur-Alen CDs as a promising candidate for the treatment of periodontitis, underscoring the necessity for further research and development in this field.

5. Material and methods

5.1. Characterization of Cur-Alen CDs

Alendronate (Aladdin, Shanghai, China) and curcumin (Solarbio, Beijing, China) were dissolved in a 50 % ethanol solution at a mass ratio of 1:1. After being mixed uniformly, the mixture was placed into a reaction kettle. CDs were synthesized by the “bottom-up” hydrothermal synthesis method at 200 °C for 4.5 h. Then, they were collected into centrifuge tubes. Impurities were removed through filtration and centrifugation. Subsequently, the product was dialyzed with a 3500 KDa dialysis bag for 72 h, and the ultrapure water was replaced every 12 h. By having unreacted small molecular compounds removed, purified carbon dots were obtained. A certain amount of the Cur-Alen CDs solution was taken, freeze-dried and weighed so that the concentration of the Cur-Alen CDs solution was calculated. The solution was stored in the dark under refrigeration for future use.

The microstructure and morphology of Cur-Alen CDs were characterized using a TEM (FEI Tecnai G2 F20 S-TWIN, Philips, Amsterdam, Holland). XPS, performed on a Thermo Scientific 250Xi spectrometer (Waltham, USA), was primarily utilized to characterize the elemental composition on the surface of Cur-Alen CDs, particularly focusing on elements C, N, O, and FTIR spectroscopy was conducted using an FTIR spectrometer (Thermo Scientific, Waltham, USA) to investigate the functional groups present. UV spectra were obtained after diluting the samples and performing baseline correction using a HITACHI U-3900 instrument (HITACHI, Tokyo, Japan), followed by testing on the instrument. PL spectroscopy, mainly analyzing the emission and excitation spectra of the materials, was conducted as follows: an appropriate amount of Cur-Alen CDs solution was placed in a sample holder for testing using an Edinburgh FLS1000 spectrometer (Edinburgh, UK).

Utilizing well-grown RAW264.7, HGF and BMSCs, cells were plated at a density of 20,000 cells per well on 12-well plates with cell culture slides. Each well was supplemented with 500 μL of a 100 μg/mL solution of Cur-Alen CDs, and the plates were incubated overnight in a cell culture incubator maintained at 37 °C with 5 % CO₂. After 24 h, cells were stained with DAPI (Beyotime Biotechnology, Shanghai, China) and phalloidin (Mesgen, Shanghai, China), and images were captured using a confocal microscope (Leica, Wetzlar, Germany). The zeta potential measurements were conducted using a Nanotrac Wave II (Microtrac Nanotrac, Montgomeryville, USA). The pH was set to 7.4 and 8.8, respectively, to simulate normal and alkaline environments.

5.2. Bone targeting experiment

Artificial saliva simulating the oral environment was prepared using PBS at pH = 7.4, while PBS at pH = 8.8 was used to mimic the alkaline conditions at the site of infection. Hydroxyapatite powder (100 mg) was weighed using an electronic balance and mixed with 1 mL of a 100 μg/mL Cur-Alen CDs solution. The mixture was incubated on a shaker for 12 h. After incubation, the mixture was centrifuged at 1000 rpm for 5 min. The supernatant was collected, and the optical density (OD) value was measured using a fluorescence plate reader. The adsorption rate was subsequently computed in accordance with the measured OD values.

C57BL/6 mice, aged 4–6 weeks, were anesthetized intraperitoneally. A solution of 1 mg/mL Cur-Alen CDs or PBS (200 μL) was administered via tail vein injection. After 48 h, the mice were placed in a small animal live imaging system for observation and photography. Following the imaging session, the femur, tibia, and major organs (such as liver and kidneys) were harvested and photographed to assess the biodistribution of the Cur-Alen CDs.

5.3. Hemolysis test

Collect whole blood from the retro-orbital venous plexus of rat and place it into heparin lithium anticoagulant tubes, ensuring thorough mixing. Take 1 mL of whole blood and gently mix it with 9 mL of 0.9 % sodium chloride solution, then centrifuge to separate (1500 rpm, 10 min). After centrifugation, discard the supernatant, retain the red blood cells (RBCs), and wash the RBCs with 0.9 % sodium chloride solution until the supernatant is colorless. Prepare a 4 % RBC suspension by mixing 400 μL of RBCs with 10 mL of 0.9 % sodium chloride solution. Mix the 4 % RBC suspension with different concentrations of Cur-Alen CDs (0, 5, 10, 20, 40, 80 μg/mL) and incubate at 37 °C for 2 h. After incubation, centrifuge (2500 rpm, 10 min) to collect the supernatant and measure the OD value at 540 nm using a plate reader.

5.4. Cell viability

The BMSCs cells were purchased from Cellverse (Shanghai, China). The RAW264.7 cells were purchased from Punosai (Wuhan, China). The HGF cells were purchased from MEISEN (Zhejiang, China). Unless otherwise mentioned, default concentrations (Cur-Alen CDs: 20 μg/mL; Curcumin: 5 μg/mL; Alendronate: 5 μg/mL; LPS: 50 ng/mL) were used for each analysis based on the results of biocompatibility and previous experimental results.

Seed cells at a density of 3000 cells (BMSCs, RAW264.7, and HGF) per well in a 96-well plate and incubate for 24 h. Add different concentrations of Cur-Alen CDs to the culture medium. After a 24-h incubation, replace the cell culture medium (Gibco, Waltham, USA) with medium containing 10 % CCK-8 (Biosharp, Hefei, China) and incubate for another hour. Check the absorbance using a Bio-Rad plate reader (Hercules, CA, USA) at 450 nm. For cumulative toxicity testing, seed cells at a density of 1000 cells per well, change the complete medium containing Cur-Alen CDs, Cur, or Alen every other day, and continue culturing. Use the CCK-8 assay daily to test cell viability. Seed BMSCs, RAW264.7, and HGF in 48-well plates and treat them with Cur-Alen CDs at concentrations of 10, 20, 40, and 80 μg/mL for 24 h. After treatment, wash the cells with PBS and stain them with calcein acetoxymethyl ester (AM) and propidium iodide (PI) (Beyotime Biotechnology, Shanghai, China). Examine the live and dead staining using a fluorescence microscope system.

All procedures should be performed in accordance with ethical guidelines for the use of animals and cells, and appropriate permissions and approvals should be obtained before conducting the experiments [24,51].

5.5. ROS scavenging

•OH scavenging activity of Cur-Alen CDs was determined using a UV–Vis spectrophotometer, based on the reaction of hydroxyl radicals with salicylic acid to form 2,3-dihydroxybenzoic acid, which has an absorption peak at 510 nm. Hydrogen peroxide (H₂O₂, 8.8 mM) and ferrous sulfate (FeSO₄, 9 mM) were mixed in deionized water and allowed to react for 5 min. Then, different concentrations of Cur-Alen CDs were added to the solution and incubated at 37 °C for an additional 15 min. Finally, salicylic acid (9 mM) was added to detect the remaining •OH by generating a purple-colored solution, and the absorbance of this solution was measured using a UV–Vis spectrophotometer. A 0.1 mM working solution of DPPH was prepared by mixing it with ethanol. DPPH (0.7 mL) was combined with Cur-Alen CDs at varying concentrations (0.1 mL) and incubated in the dark at room temperature for 30 min. The absorbance at 517 nm was then measured using a UV–Vis spectrophotometer. A mixture of deionized water and DPPH served as the blank control.

Following the stimulation of RAW264.7 cells with LPS to induce an excessive production of ROS, cell samples were prepared. The concentrations of various oxidative stress markers were assessed using commercial assay kits, including MDA assay kit for lipid peroxidation, protein carbonyl content assay kit, H₂O₂ content assay kit, and POD activity assay kit. All kits were procured from Solarbio (Beijing, China).

DCFH-DA is extensively employed as a fluorescent probe for monitoring the levels of ROS within cells. HGF and RAW264.7 cells were seeded in a 12-well plate at a density of 4 × 10⁴ cells per well. The cells were exposed to LPS for 4 h and then treated with various concentrations of Cur-Alen CDs (20 μg/mL) for 24 h. The cell culture medium was replaced with serum-free medium containing 10 μM DCFH-DA (Beyotime Biotechnology, Shanghai, China) and incubated at 37 °C for 25 min. After washing the cells three times with PBS, the intracellular ROS levels were observed using a fluorescence microscope. Cells that were untreated served as the control group.

Thirty C57BL/6 male mice weighing about 19∼21 g were randomly divided into 5 groups: control group, LPS group, curcumin group, alendronate group, and Cur-Alen CDs group. Except for the control group, which was injected with PBS at the gingiva of the lower incisors of mice, the other four groups were injected with 20 μL of LPS at a concentration of 1 mg/mL daily for 3 consecutive days to induce the periodontal oxidative stress model [51,52]. After the model was successfully established, the administration group was injected with 20 μL of different drugs with a concentration of 1 mg/mL to the gingiva of the lower incisors, and the PBS group was injected with the same dose of sterile PBS for 4 consecutive days. After treatment, the ROS probe DCFH-DA (600 μM, 20 μL) (Aladdin, Shanghai, China) was performed, and the in vivo ROS levels were assessed using IVIS LuminaLT animal imaging system (PerkinElmer, Waltham, USA).

5.6. QPCR

Following the treatment of cells with PBS, total RNA was extracted from the cells using the SteadyPure Total RNA Extraction Kit (ACCURATE BIOTECHNOLOGY(HUNAN)CO., LTD, ChangSha, China). Subsequently, reverse transcription was performed using the same SteadyPure kit, and amplification was carried out using the qPCR system (Mx3005p, Agilent, Santa Clara, USA) to collect fluorescence signals. The primer (General Biol, Anhui, China) sequences used in the experiment are presented in Table 1 below. The relative expression levels of gene expression were calculated using the 2^−ΔΔCt method.

Table 1.

Sequence of the primers.

Species	Gene	Forward/Reverse	Primer sequence (5' - 3′)
Mouse	β-actin	F	CATCCGTAAAGACCTCTATGCCAAC
Mouse	β-actin	R	ATGGAGCCACCGATCCACA
Mouse	Alp	F	TTGACCTCCTCGGAAGACACTCTG
Mouse	Alp	R	CGCCTGGTAGTTGTTGTGAGCATAG
Mouse	Calcr	F	TCATCATCCACCTGGTTGAG
Mouse	Calcr	R	CACAGCCATGACAATCAGAG
Mouse	Opn	F	ATGAGGCTGCAGTTCTCCTGG
Mouse	Opn	R	AAAGCTCTTCTCTCCTCTGAGCTGCC
Mouse	Runx2	F	GTGATAAATTCAGAAGGGAGG
Mouse	Runx2	R	CTTTTGCTAATGCTTCGTGT
Mouse	Foxo1	F	ACGAGTGGATGGTGAAGAGC
Mouse	Foxo1	R	TGCTGTGAAGGGACAGATTG
Mouse	Tnf-α	F	AGGCGGTGCCTATGTCTC
Mouse	Tnf-α	R	CGATCACCCCGAAGTTCAGTAG
Mouse	Il-1β	F	GAAATGCCACCTTTTGACAGTG
Mouse	Il-1β	R	TGGATGCTCTCATCAGGACAG
Mouse	Il-6	F	CTGCAAGAGACTTCCATCCAG
Mouse	Il-6	R	AGTGGTATAGACAGGTCTGTTGG
Mouse	Ctsk	F	CTCGGCGTTTAATTTGGGAGA
Mouse	Ctsk	R	TCGAGAGGGAGGTATTCTGAGT
Mouse	Nfatc1	F	GGAGAGTCCGAGAATCGAGAT
Mouse	Nfatc1	R	TTGCAGCTAGGAAGTACGTCT
Human	TNF-α	F	CCTCTCTCTAATCAGCCCTCTG
Human	TNF-α	R	GAGGACCTGGGAGTAGATGAG
Human	IL-1β	F	ATGATGGCTTATTACAGTGGCAA
Human	IL-1β	R	GTCGGAGATTCGTAGCTGGA
Human	β-Actin	F	CATGTACGTTGCTATCCAGGC
Human	β-Actin	R	CTCCTTAATGTCACGCACGAT
Human	IL-6	F	AAGCCAGAGCTGTGCAGATGAGTA
Human	IL-6	R	TGTCCTGCAGCCACTGGTTC
Human	COL1A1	F	GAGGGCCAAGACGAAGACATC
Human	COL1A1	R	CAGATCACGTCATCGCACAAC
Human	TGFB1	F	CAATTCCTGGCGATACCTCAG
Human	TGFB1	R	GCACAACTCCGGTGACATCAA
Human	VEGF	F	AGGGCAGAATCATCACGAAGT
Human	VEGF	R	AGGGTCTCGATTGGATGGCA
Rats	Gapdh	F	ACCACAGTCCATGCCATCAC
Rats	Gapdh	R	TCCACCACCCTGTTGCTGTA
Rats	Tnf-α	F	TACTGAACTTCGGGGTGATCGGTCC
Rats	Tnf-α	R	CAGCCTTGTCCCTTGAAGAGAACC
Rats	Il-6	F	GCGATGATGCACTGTCAGA
Rats	Il-6	R	GAGCATTGGAAGTTGGGGTA
Rats	Il-1β	F	TGACCCATGTGAGCTGAAAG
Rats	Il-1β	R	AGGGATTTTGTCGTTGCTTG
Rats	Ho1	F	GCATGTCCCAGGATTTGTCC
Rats	Ho1	R	CCTCTTCCAGGGCCGTATAG
Rats	Nqo1	F	GGCCAATTCAGAGTGGCATT
Rats	Nqo1	R	TTCTTCCACCCTTCCAGGAC

5.7. WB and ELISA

After treating the cells with PBS, the cellular proteins were isolated. A protein sample of 20 μg was subjected to gel electrophoresis at a constant voltage of 80 V. Following electrophoresis, the proteins were transferred onto a PVDF membrane at a constant current of 300 mA. Post-transfer, the membrane was washed and blocked with 5 % skim milk at room temperature for 90 min. The PVDF membrane was then incubated with the primary antibody. Subsequently, the membrane was incubated with the corresponding secondary antibody for 90 min at room temperature. The detection was achieved using an Enhanced Chemiluminescence (ECL) system (Meilunbio, Dalian, China) for signal enhancement and visualization.

Rat periodontal tissues were rinsed with precooled PBS (0.01 M, pH = 7.4) to remove residual blood, weighed, and then minced. The minced tissues were homogenized with a 1:9 vol ratio of PBS using a grinding instrument (Jingxin Technology, Shanghai, China). To further lyse tissue cells, the homogenate was subjected to ultrasonication (Scientz, Ningbo, China). Finally, the homogenate was centrifuged at 5000 g for 10 min, and the supernatant was collected for detection. A rat ELISA kit (Zcibio technology, Shanghai, China) was used according to the manufacturer's instructions.

5.8. Alizarin Red and alkaline phosphatase staining

BMSCs were seeded in 6-well plates at a density of 3 × 10⁵ cells per well. After 24 h, the culture medium was replaced with osteogenic induction medium (Xrbio, Hangzhou, China), and this was replenished every 2 days. Concurrently, LPS (Beyotime Biotechnology, Shanghai, China) was added to induce inflammation and Cur-Alen CDs (20 μg/mL) were introduced alongside respective control treatments, with medium changes occurring every 2 days. On day 14, cells were fixed with 4 % paraformaldehyde for 15 min, followed by two washes with deionized water, and then treated with Alizarin Red solution (Solarbio Science & Technology, Beijing, China) for 20 min. To determine ALP activity, after the same treatment for 7 days, BMSCs were fixed with 4 % paraformaldehyde and incubated in alkaline phosphatase staining solution (Beyotime Biotechnology, Shanghai, China) at 37 °C for 20 min. ALP staining was examined under an optical microscope to assess the stained areas.

5.9. Cell migration assays

Wound Healing Assays for Measuring Relative Cell Migration Capacity: Cells were plated in 6-well plates at a density of 5 × 10⁴ cells per well. Once the cells reached confluence, a manual scratch was created in the monolayer using a 10 μL pipette tip. The cells were then washed with PBS and supplemented with cell culture medium. Images were taken using an inverted microscope, and the exact locations of each wound were recorded. LPS was added to induce inflammation, and Cur-Alen CDs (20 μg/mL) were introduced along with respective control treatments. The cells were returned to the cell culture incubator, and after 24 h, images of the recorded scratch areas were taken. The scratch area was measured using Adobe Photoshop 2021, and data analysis was performed using GraphPad Prism 8.

5.10. TRAP staining

The culture medium was aspirated after Rankl (Amizona Scientific LLC, Hangzhou, China) induction. Cells were washed with PBS and fixed with 4 % paraformaldehyde (PFA) for 20 min, then wash the Cells with PBS for 3 times. Subsequently, 0.1 % Triton X-100 was added to each well to permeabilize the cell membranes at room temperature for 15 min, after which the cells were washed three times with PBS. TRAP working solution was prepared according to the manufacturer's instructions (Servicebio, Wuhan, China) and added to the cells, followed by incubation in the dark at 37 °C for 20 min. After incubation, the cells were washed three times. Cells were then observed and photographed using a microscope.

5.11. Periodontitis models

Sprague-Dawley (SD) rats (200 ± 5 g) used in this study were approved by the Institutional Animal Care and Use Committee of Harbin Medical University (Approval Protocol Number YJSKY2023-122). Sample size: 6 animals per group. All animal procedures were conducted in strict accordance with the guidelines for the care and use of laboratory animals. To establish experimental periodontitis in SD rats, silk sutures were placed around the left maxillary second molars after anesthesia and maintained for 2 weeks. After successful modeling, based on the corresponding concentrations in in vitro experiments (Cur-Alen CDs: 20 μg/mL), different types of drugs were administered at a dosage of 20 μL per site every two days at the mesial point of the second molar using an insulin syringe (BD Micro-Fine 0.3-mL syringe, Becton Dickinson Medical, USA). Two weeks post-treatment, the rats were euthanized and fixed with 4 % paraformaldehyde for 48 h prior to micro-CT imaging. All samples were embedded in paraffin and sectioned at a thickness of 3 μm for histological staining.

5.12. Micro-computed tomography (Micro-CT) analysis

A high-resolution micro-CT scanner (μCT35, Scanco Medical, Brüttisellen, Switzerland) was utilized to perform three-dimensional reconstruction of the region surrounding the second maxillary molars of rats. The distance between the CEJ and the ABC at the mesiobuccal aspect of the second molars was measured using ImageJ software to assess the degree of alveolar bone resorption.

5.13. Histological staining

Following micro-CT scanning, the maxillae were placed into beakers containing 15 % EDTA (TCRY, Tianjin, China) decalcification solution on a magnetic stirrer, with the solution being changed every two days. After decalcification, the tissues were washed under running water for 12 h and then dehydrated in an automatic tissue processor (STP 120, Thermo Scientific, Waltham, USA). Sections were cut at a thickness of 3 μm using a manual rotary microtome (MICROM HM325, Thermo Scientific, Waltham, USA) for further histological staining. The sections were stained with H&E, TRAP and Masson (Solarbio, Beijing, China) according to the manufacturer's protocol. After staining, the slides were observed and photographed using an upright microscope (eclipse 80i, Nikon, Tokyo, Japan).

5.14. Immunohistochemistry

Maxillary bone sections were routinely deparaffinized to sodium citrate buffer and antigen retrieval was performed using a water bath method. Subsequently, the sections were blocked and incubated with primary antibodies (Tnf-α, Proteintech, Wuhan, China; Rank, ABClonal, Wuhan, China) at room temperature for 1.5 h. Following this, the sections were incubated with secondary antibodies for 30 min. Then, the sections were stained with DAB (ZSGB-Biotech, Beijing, China) according to the manufacturer's protocol and counterstained with Methyl Green. After sealing, the sections were photographed using an upright microscope (eclipse 80i, Nikon, Tokyo, Japan).

5.15. Immunofluorescence

RAW264.7 cells were seeded on glass slides and induced with LPS, followed by treatment with Cur-Alen CDs for 24 h. After washing, the cells were fixed, permeabilized, and blocked. The cells were then incubated with the primary antibody (Tnf-α, 1:100 dilution, Proteintech, Rank ABclonal, China) overnight at 4 °C. On the following day, the cells were incubated with the corresponding fluorescent secondary antibody. Subsequent staining was performed, and an anti-fade mounting medium was added to seal the slides. The slides were observed and photographed using an inverted microscope.

5.16. RNA-seq analysis

Perform omics analysis on the periodontitis sites of the periodontitis group and the Cur-Alen CDs group in the periodontitis model. RNA-seq analysis (Cur-Alen CDs:3; Control group:4) was conducted by BGI in Shenzhen, China, utilizing the DNBSEQ platform. Subsequent KEGG, GO, and GSEA analyses were performed using the Dr. TOM platform with a threshold of |log2 Fold Change (FC)| ≥ 1 and a q-value≤0.05. TF analysis was carried out using the ChEA3 platform, while PPI network analysis was conducted with the String platform and Cytoscape.

5.17. Statistical analysis

Data were statistically analyzed using GraphPad Prism, version 8.0.1. Results are presented as the mean ± standard deviation (Mean ± SD). One-way analysis of variance (ANOVA) and t-tests were employed to analyze the data. A p-value of less than 0.05 was considered to indicate statistical significance.

CRediT authorship contribution statement

Shujian Zhang: Writing – review & editing, Writing – original draft, Visualization, Validation, Software, Methodology, Formal analysis, Data curation, Conceptualization. Xiaohan Zhang: Methodology, Formal analysis, Data curation. Jie Huang: Validation, Formal analysis, Data curation. Na Zhou: Visualization, Validation. Fangping Zhang: Resources. Junyu Ren: Project administration, Methodology, Investigation. Wenxuan Zhang: Visualization, Validation, Methodology. Tuo Wang: Project administration. Wenxia Xu: Validation, Methodology. Xinrui Luan: Validation. Xiaowei Huang: Validation. Zansheng Huang: Validation. Jiaming Wu: Resources. Junlong Da: Writing – review & editing. Lixue Liu: Writing – review & editing. Bin Zhang: Writing – review & editing, Funding acquisition, Conceptualization. Ying Li: Supervision, Resources, Project administration. Han Jin: Supervision, Resources, Funding acquisition, Conceptualization.

Declaration of generative AI in scientific writing

During the preparation of this work the author(s) used Kimi in order to improve the fluency of language. After using this tool/service, the author(s) reviewed and edited the content as needed and take(s) full responsibility for the content of the publication.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following are the Supplementary data to this article:

figs1.

figs2.

figs3.

figs4.

figs5.

figs6.

figs7.

figs8.

figs9.

figs10.

figs11.

figs12.

figs13.

figs14.

figs15.

figs16.

figs17.

figs18.

figs19.

figs20.

Data availability

Data will be made available on request.