Ulinastatin inhibits macrophage M1 polarization to improve acute pancreatitis-associated intestinal barrier dysfunction by promoting Nrf2 signaling pathway activation

Abstract

Background

Intestinal barrier dysfunction plays a significant role in the development of pancreatic necrosis and multiple organ failure in AP. This study aimed to investigate the therapeutic effects and potential mechanisms of ulinastatin (UTI) on L-arginine-induced acute pancreatitis (AP)-associated intestinal barrier dysfunction in rats.

Methods

Experimental rats were randomly divided into five subgroups as follows: control, AP, AP + UTI, AP + ML-385 and AP + UTI + ML-385. The pancreatic and intestinal injuries were assessed by enzyme-linked immunosorbent assay (ELISA), western blot, pathology, laser Doppler and transmission electron microscope (TEM). The inflammatory biomarkers were determined by western blot and the indicators of oxidative stress were also measured. The Nrf2 signaling pathway and macrophage polarization were evaluated by immunofluorescence staining, western blot and qRT–PCR analysis.

Results

Ulinastatin treatment effectively improved both AP and AP-associated intestinal barrier dysfunction. Moreover, ulinastatin treatment significantly decreased the levels of pro-inflammatory factors and peroxides while significantly increasing the levels of anti-inflammatory factors and antioxidants. Mechanistically, ulinastatin treatment inhibited M1 macrophage polarization, achieved by activating the Nrf2 signaling pathway and facilitating Nrf2 nuclear translocation. The application of ML-385 to intercept Nrf2 eliminated ulinastatin-mediated suppression of macrophage M1 polarization and inflammation.

Conclusions

Ulinastatin protected against both AP and the associated intestinal barrier dysfunction. It suppressed the inflammatory response and oxidative stress by promoting Nrf2 nuclear translocation and inhibiting M1 macrophage polarization through the activation of the Nrf2 signaling pathway.

Introduction

Acute pancreatitis (AP) is a heterogeneous and complex gastrointestinal disease with variable acute inflammatory course. The incidence of AP is estimated at 110–140 per 100000 population, whereas one-fifth of AP patients develop severe acute pancreatitis (SAP) characterized by infected pancreatic necrosis (IPN) and multisystem organ failure (MSOF), with a mortality rate of nearly 20% [1, 2]. Survivors of SAP experience prolonged intensive care unit stay, frequent readmissions and poor quality of life [3]. As shown in Fig. 1, AP starts with premature and excessive activation of trypsin within pancreatic acinar cells, which leads to acinar cell injury and activation of immune cells, including neutrophils and M1 macrophages, amplifying the inflammatory response, and increasing trypsinogen activation and oxidative stress by releasing oxidizing substances [4, 5]. Meanwhile, trypsin gains direct access to intestinal epithelial cells (IECs), inducing damage followed by the formation of cytotoxic mediators [6]. The above-mentioned pathophysiological changes jointly cause IECs injury and intestinal barrier dysfunction, characterized by abnormal bowel sounds, abdominal distension, increased intra-abdominal pressure, diarrhea, constipation, gastrointestinal bleeding and feeding intolerance in SAP patients with gastrointestinal tract (GIT) disorders [7].

Fig. 1.

Mechanism of acute pancreatitis-associated intestinal barrier dysfunction

Intestinal barrier dysfunction during AP plays a significant role in the mechanism of superinfection of the pancreas and peri-pancreatic necrosis, acute peri-pancreatic fluid collection, post-necrotic fluid collection, and walled-of-pancreatic necrosis, as well as in multiple organ failure in SAP [8]. In view of the pathophysiology described above, it appears crucial to improve intestinal barrier dysfunction by inhibiting M1 macrophage polarization and activating antioxidant signaling pathways. Relevant research has shown that bicarbonate Ringer's solution can improve AP in rats via the Nrf2 antioxidant pathway [9]. However, early aggressive fluid resuscitation results in a higher incidence of fluid overload without improvement in hypovolemia or intestinal hypoperfusion [10].

Ulinastatin is a glycoprotein belonging to a broad range of serine protease inhibitors that are used to treat acute inflammatory disorders and acute circulatory failure caused by sepsis, toxic shock, and hemorrhagic shock [11]. Ulinastatin can inhibit the activity of a variety of proteolytic enzymes, including trypsin and elastase, and exhibits anti-inflammatory and antioxidant properties by downregulating inflammatory cytokines and removing oxygen-free radicals [12, 13]. Ulinastatin has been shown to alleviate systemic inflammatory response syndrome (SIRS) and improves MSOF in AP in animal and clinical trials [14, 15]. However, the effects of ulinastatin on intestinal barrier dysfunction and tissue injury in AP have been poorly studied. A recent study demonstrated that ulinastatin can significantly improve renal perfusion in renal microcirculation during septic shock, although the mechanism has not yet been clarified [16]. The main purpose of this study was to verify the therapeutic effectiveness of ulinastatin in alleviating AP and improving AP-associated intestinal barrier dysfunction in an experimental rat model of L-arg-induced AP. Furthermore, the potential mechanism of ulinastatin intervention in AP-associated intestinal barrier dysfunction is explored.

Methods

Animals and diets

All animal experimental procedures were approved and performed in accordance with the ARRIVE guidelines and ethical standards of the Animal Protection and Use Committee of Anhui Medical University (No. LLSC20231041). Sprague–Dawley rats (Wild Type) in this experiment were obtained from (Laboratory Animal Center of Anhui Medical University, Hefei, China; aged 3–4 months; weight 2.0–2.5 kg) and housed in a specific pathogen-free room under a 12/12 h light–dark cycle at room temperature and 50% humidity, with free access to water and standard laboratory diet during the experiment.

Establishment of the AP model and experimental design

Experimental rats were randomly divided into five subgroups (n = 10 per group): control, AP, AP + UTI, AP + ML-385, and AP + UTI + ML-385. The AP model was induced in rats by intraperitoneal injection of 20% L-arginine in phosphate-buffered saline (PBS) at a dose of 2.5 g/kg body-weight (BW) twice with a 1-h interval. Rats in the control group were intraperitoneally injected with PBS in the same manner. Rats in the AP + UTI group were intraperitoneally injected with ulinastatin at a dose of 10000 U/kg BW immediately after the final L-arginine injection, and the ulinastatin injection was repeated at an interval of 24 h. Rats in the AP + ML-385 and AP + UTI + ML-385 groups were administered ML-385 before the first L-arginine injection, whereas those in the AP + UTI + ML-385 group were intraperitoneally injected with ulinastatin in the same manner as the AP + UTI group, and rats in the AP + ML-385 group were intraperitoneally injected with the same volume of PBS. The rats in the AP group were administered the same volume of PBS at the same timepoint.

Biochemical assays

Experimental rats were anesthetized by intraperitoneal injection (2 ml/kg BW) of 3% pentobarbital sodium (P3761, Sigma-Aldrich, Shanghai, China). Blood samples were collected using heparinized syringes from the caudal veins at 0, 24 and 48 h after the initial l-arginine injection, and the upper serum was separated by centrifugation at 4000r/min for 10 min at 4 °C. The Serum was placed in an EP tube and cryopreserved in 80 °C liquid nitrogen for unified detection. Serum levels of amylase (LE-B1215, Lai Er Bio-Tech, Hefei, China), lipase (LE-1–139, Lai Er Bio-Tech, Hefei, China), intestinal fatty acid-binding protein (I-FABP) (LE-B0433, Lai Er Bio-Tech, Hefei, China) and diamine oxidase (DAO) (LE-H1628, Lai Er Bio-Tech, Hefei, China) were determined using ELISA kits. The entire process was performed in accordance with the manufacturer’s instructions and the standard laboratory procedures.

Pathological examination

Experimental rats were intraperitoneally injected with 3% pentobarbital sodium and then sacrificed. Then, Segmental fresh pancreatic and terminal ileal tissues were harvested under sterile conditions, fixed in 4% paraformaldehyde solution (P6148, Sigma-Aldrich, Shanghai, China) at 4 °C, followed by embedding in paraffin, and the sections were dewaxed. Pancreatic and terminal ileal sections were stained with hematoxylin and eosin solution (H&E). Finally, the sections were dehydrated and sealed with optical resin adhesive. H&E-stained sections were randomly assigned to two pathologists blinded to the experimental treatments, and they observed and evaluated the damage in pancreatic and terminal ileal tissues under 200 × optical electron microscopes. The degrees of pancreatic injury were evaluated by scoring the grading system according to Schmidt’s scoring system [17] (Table 1), and the degrees of terminal ileal injury were evaluated by scoring the grading system according to Chiu’s scoring system [18] (Table 2).

Table 1.

Histopathologic grades of pancreatic tissue by Schoenberg

Grade	Histopathologic finding
	Edema	Inflammation	Necrosis
0	Absent	Absent	Absent
1	Diffuse expansion of interlobar septa	6–10 intralobular or perivascular leukocytes/HPF	Diffuse occurrence of 1–4 necrotic cells/HPF
2	1 (+) Diffuse expansion of interlobular septa	16–20 intralobular or perivascular leukocytes/HPF	Diffuse occurrence of 5–10 necrotic cells/HPF
3	2 (+) Diffuse expansion of interacinar septa	26–30 intralobular or perivascular leukocytes/HPF	Diffuse occurrence of 11–16 necrotic cells/HPF
4	3 (+) Diffuse expansion of intercellular septa	> 35 leukocytes/HPF or confluent microabscesses	> 16 necrotic cells/HPF

Table 2.

Histopathologic grades of intestinal tissue by Chiu

Grade	Histopathologic finding
0	Normal mucosal villi
1	Development of a subepithelial space, usually at the tip of the villus, with capillary congestion
2	Extension of the subepithelial space with the moderate lifting of the epithelial layer
3	Massive epithelial lifting down the sides of villi
4	Denuded villi with lamina propria, dilated capillaries exposed, increased cellularity of the lamina propria
5	Digestion and disintegration of the lamina propria, hemorrhage and ulceration

Laser Doppler blood flow meter

The rats were anesthetized with an intraperitoneal injection of 3% pentobarbital sodium. A laparotomy was performed, and the terminal ileum tissue was exposed. The probe was used to touch the mucosa in the terminal ileal tissue without pressure and the blood flow was measured using a laser Doppler blood flow meter (MoorFLPI-2, Moor Instruments Ltd, Devon, UK) connected to a computer with the matching software moorVMS-PC v3.1 to process data. The perfusion unit (PU) refers to blood perfusion within the measured area. The concentration of moving blood cells (CMBC) refers to the number of associated moving blood cells that cause Doppler shift. Velocity is the average movement rate of associated blood cells within the measured area. The relationship between the above three signals is

$$\text{PU}=\text{CMBC}\times \text{Velocity}$$

Transmission electron microscope

Segmental fresh terminal ileal tissue was harvested on ice, and 2 mm sections were fixed for 2 h with buffered glutaraldehyde, post-fixed with 1% OsO₄, dehydrated through graded alcohols, infiltrated through Epon12, and then embedded in resin. Sections were cut at 1–2 mm thickness and then stained with uranyl acetate and lead citrate, and photographed using a Hitachi HT-7800 (Hitachi, Tokyo, Japan) electron microscope operated at 75 kV. Morphological and structural changes in the IECs, microvilli, and TJs between IECs were observed using TEM.

Western blot analysis

The Terminal ileal tissue was ground and homogenized with pyrolysis liquid containing PMSF for 30 min on ice, and the homogenized tissue was centrifuged at 4 °C for 15 min. The supernatants were collected and equal amounts of protein were electrophoretically separated using 10% SDS–PAGE and transferred to nitrocellulose membranes. Membranes were blocked with 5% skim milk and incubated with antibodies against rat claudin-1 (SAB4200462, Sigma-Aldrich, Shanghai, China), occludin (SAB5700784, Sigma-Aldrich, Shanghai, China), tumor necrosis factor (TNF-α) (SAB5700698, Sigma-Aldrich, Shanghai, China), interleukin-6 (IL-6) (SAB5700181, Sigma-Aldrich, Shanghai, China), interleukin-1β (IL-1β) (ab315084, Abcam, Shanghai, China), interleukin-10 (IL-10) (ab9969, Abcam, Shanghai, China), nuclear factor erythroid 2-related factor 2 (Nrf2) (SAB4501984, Sigma-Aldrich, Shanghai, China), heme oxygenase-1 (HO-1) (SAB5700731, Sigma-Aldrich, Shanghai, China), iNOS (SAB4502011, Sigma-Aldrich, Shanghai, China), CD86 (SAB5700710, Sigma-Aldrich, Shanghai, China), Arg-1 (SAB5700762, Sigma-Aldrich, Shanghai, China), CD206 (ab64693, Abcam, Shanghai, China), and GAPDH (AB2302, Sigma-Aldrich, Shanghai, China), followed by incubation with secondary goat anti-rabbit antibody or secondary goat anti-mouse antibody conjugated to horseradish peroxidase for 1 h at room temperature. Protein bands were quantified using the mean ratio of the integral optical density normalized to GAPDH expression.

Quantitative reverse transcription PCR (qRT–PCR) analysis

The terminal ileal tissue was ground and dissolved in TRIzol reagent (Life Technologies, Carlsbad, CA, USA). The mixture was transferred to 1.5 mL RNase-free tubes and centrifuged at 4 °C for 15 min in chloroform. The supernatants were collected and centrifuged at 4 °C for 10 min with an equal volume of isopropyl alcohol. Then, the supernatants were removed and 75% ethanol was added to the precipitate and centrifuged at 4 °C for 5 min. Finally, RNA extraction lysis buffer was obtained by dissolving in diethylprocarbonate. Total RNA was extracted using an RNA Prep Pure Micro Kit (DP420, Tiangen Biotech, Beijing, China). RNA concentration was measured using a spectrophotometer (NanoDrop 2000c, Thermo Fisher Scientific, Waltham, MA, USA). Equal amounts of samples were reverse-transcribed using the FastQuant RT Kit (KR-106–02, Tiangen Biotech, Beijing, China). SYBR-based qPCR was performed using the Bestar qPCR Mastermix (DBI-2223, DBI Bioscience, Ludwigshafen, Germany) on an ABI StepOnePlus platform (Thermo Fisher Scientific). Various mRNAs were quantified, and GAPDH was used as an internal control. The mRNA expression levels of Nrf2 and HO-1 in the terminal ileal tissue were measured using the comparative 2^−(ΔΔCq) method. The primer sequences of Nrf2 (ZN-YW0758, Zhien Biology, Hefei, China), HO-1 (ZN-YW0531, Zhien Biology, Hefei, China) and GAPDH (ZN-NYW006, Zhien Biology, Hefei, China) used to amplify the mRNAs are listed in Table 3.

Table 3.

Primer sequences for RT-PCR

Primer		Sequence (5′ to 3′)
Nrf2	Forward	CAGTGCTCCTATGCGTGAA
	Reverse	GCGGCTTGAATGTTTGTC
HO-1	Forward	ACAGATGGCGTCACTTCG
	Reverse	TGAGGACCCACTGGAGGA
GAPDH	Forward	GGAGCGAGATCCCTCCAAAAT
	Reverse	GGCTGTTGTCATACTTCTCATGG

Immunofluorescence staining

Histological sections of terminal ileal tissues were deparaffinized in xylene and graded in water using different concentrations of ethanol ranging from 100 to 50%. The sections were blocked with 5% bovine serum albumin for 1 h at room temperature and incubated with primary antibodies (1:100 dilution) against iNOS (ab178945, Abcam, Shanghai, China), CD86 (SAB5700710, Sigma-Aldrich, Shanghai, China), Arg-1 (SAB5700762, Sigma-Aldrich, Shanghai, China), CD206 (ab64693, Abcam, Shanghai, China), and Nrf2 (SAB4501984, Sigma-Aldrich, Shanghai, China) overnight at 4 °C. For co-immunostaining, two primary antibodies from distinct species were incubated with the sections. The sections were washed with PBS and incubated with tetramethylrhodamine-5-(and 6)-isothiocyanate (46950, Sigma-Aldrich, Shanghai, China) conjugated secondary antibodies (1:200 dilution) for 1 h at room temperature. Nuclei were labeled by incubation with 4′,6-diamidino-2-phenylindole (32670, Sigma-Aldrich, Shanghai, China), and fluorescence images of randomly selected fields were observed under a fluorescence microscope, and the photographs were obtained using an Olympus CKX41 camera (Olympus Company, Japan).

Measurement of antioxidants and peroxides activities

Terminal ileal tissue was weighed, homogenized, and centrifuged. The GPx and GR activities were measured by calculating the consumption of NADPH as a cofactor for the reduction of GSSG to GSH. The GST activity was measured using 1-chloro-2,4-dinitrobenzene (1.02427, Sigma-Aldrich, Shanghai, China) as the substrate. The T-SH activity was determined by Ellman’s reaction using 5,5’-dithio-bis-2-nitrobenzoic acid (D8130, Sigma-Aldrich, Shanghai, China). MDA content was measured using thiobarbituric acid reactive substances, and ROS levels were measured using an Oxiselect In Vitro ROS Assay Kit (STA-347-T, Cell Biolabs, San Diego, USA).

Statistical analysis

All data were recorded in Excel 2019, and IBM SPSS (version 21.0) was used for statistical analysis. Graphs were generated using the GraphPad Prism 8 software. Normality and homogeneity of variances were assessed for all key data sets using Shapiro–Wilk and Levene’s tests, respectively. The measured values that followed a normal distribution are expressed as mean ± standard deviation (SD). Statistical significance was determined by one-way ANOVA with Student–Newman–Keuls and Mann–Whitney rank-sum tests. P < 0.01 was regarded as a statistically significant difference.

Results

L-arg-induced AP was alleviated by ulinastatin treatment.

As shown in Fig. 2A, the serum amylase and lipase at 24 h in the AP group were significantly higher than those in the control group. Compared to the control group, pancreatic tissue injuries in the AP group were mainly characterized by obvious edema, inflammatory cell infiltration, and necrosis (Fig. 2B). The above evidence indicated that the AP rat model was successfully established in this experiment.

Fig. 2.

AP was alleviate by ulinastatin treatment. A Serum levels of amylase and lipase from different groups. B Pathological images and scores of pancreatic tissues from different groups. The images have magnification index of 200 ×. ** represents P < 0.01

Meanwhile, serum amylase and lipase levels in the AP + UTI group were significantly lower than those in the AP group (P < 0.01) (Fig. 2A). Pancreatic tissue injuries in the AP + UTI group were clearly alleviated, with a significant increase in normal acinar cells compared to that in the AP group. The pathological scores, including edema, inflammatory cell infiltration, and necrosis of the pancreatic tissues, in the AP + UTI group were significantly lower than those in the AP group (P < 0.01) (Fig. 2B).

AP-associated intestinal barrier dysfunction was improved by ulinastatin treatment

As shown in Fig. 3A, the serum levels of DAO and I-FABP at 24 h in the AP group were significantly higher than in the control group. The serum levels of DAO and I-FABP in the AP + UTI group were significantly lower than those in the AP group (P < 0.01).

Fig. 3.

AP-associated intestinal barrier dysfunction was improved by ulinastatin treatment. A Serum DAO and I-FABP levels in the different groups. B Pathological images and scores of terminal ileum tissues from different groups. Images were captured at 200 × magnification. C Laser Doppler records of blood flow in terminal ileal tissue from different groups. D TEM images of the mucosa of terminal ileal tissues from different groups. E Western blot analysis of claudin-1 and occludin in the different groups. ** represents P < 0.01

AP-associated pathological injury of the terminal ileal tissue was mainly characterized by dilated subepithelial space, denuded microvilli, capillary hemorrhage, digestion, and disintegration of the lamina propria in the AP group, which improved after ulinastatin treatment. The pathological scores of the terminal ileal tissue in the AP + UTI group were significantly lower than those in the AP group (P < 0.01) (Fig. 3B).

As shown in Fig. 3C, blood perfusion of the mucosa in the terminal ileal tissue was observed using a laser Doppler blood flow meter, and ulinastatin increased mucosal blood perfusion in the terminal ileal tissue. The PU and velocity were significantly lower in the AP and AP + UTI groups than in the control group. After ulinastatin treatment, the PU and velocity were significantly higher than those in the AP group. Notably of attention that CMBC in the AP group and AP + UTI group was significantly higher than that in the control group (P < 0.01).

The ultrastructure of the mucosa in the terminal ileal tissue was observed by TEM. As shown in Fig. 3Da, it was observed that the IECs within the tissue in the control group were intact, the surface microvilli were long and dense, the arrangement was regular, and the TJs of adjacent cells were in close opposition, which represents the stable permeability of the intestinal barrier. However, in the AP group, edema or even shedding of IECs was observed, which was accompanied by typical TJs dilatation, atrophy, sparseness of the surface microvilli, and enlargement of the intercellular space (Fig. 3D, b), manifesting as increased permeability of the intestinal mucosa. In the AP + UTI groups, although atrophy, sparseness, and irregular arrangement of the microvilli could also be observed, TJs of adjacent cells recovered into close opposition and the permeability was improved compared with that in the AP group (Fig. 3D, c).

The expression levels of TJs proteins, including claudin-1 and occludin, were also measured. As shown in Fig. 3E, the results showed that the protein expression levels of claudin-1 and occludin in the AP group were remarkably lower than those in the control group (P < 0.01). However, the protein expression levels of claudin-1 and occludin were significantly higher in the AP + UTI group than in the AP group (P < 0.01).

Ulinastatin inhibited inflammation and oxidative stress in the terminal ileal tissue of L-arg-induced AP rats

As shown in Fig. 4A, the results showed that the levels of inflammatory cytokines, including TNF-α, IL-1β, and IL-6, were remarkably higher in the AP group than in the control group (P < 0.01). However, the levels of TNF-α, IL-1β, and IL-6 in the AP + UTI group were significantly lower than those in the AP group (P < 0.01). IL-10 levels were significantly higher in the AP group than in the control group. After treatment with ulinastatin, the level of IL-10 markedly decreased compared to that in the AP group (P < 0.01).

Fig. 4.

A Western blot analysis of inflammatory cytokines including TNF-α, IL-1β, IL-6 and anti-inflammatory cytokine including IL-10 in the terminal ileal tissue from different groups. B Levels of antioxidant markers, including GPx, GR, GST, and T-SH, and peroxidant markers, including MDA and ROS, in the terminal ileal tissue from different groups. ** represents P < 0.01

As shown in Fig. 4B, the results showed that the levels of antioxidant markers, including GPx, GR, GST, and T-SH, were remarkably lower in the AP group than in the control group (P < 0.01). However, the levels of GPx, GR, GST, and T-SH were significantly higher in the AP + UTI group than in the AP group (P < 0.01). The levels of oxidative stress markers including MDA and ROS were measured in this experiment and were both significantly higher in the AP group than in the control group. After ulinastatin treatment, the levels of MDA and ROS were higher than those in the control group, although they were markedly lower than those in the AP group (P < 0.01).

Ulinastatin inhibited M1 macrophage polarization and induced M2 macrophage polarization

As shown in Fig. 5A, the results showed that the levels of M1 macrophage markers, including iNOS and CD86, were remarkably higher in the AP group than in the control group (P < 0.01). However, iNOS and CD86 levels in the AP + UTI group were significantly lower than those in the AP group (P < 0.01). Meanwhile, the levels of M2 macrophage markers, including Arg-1 and CD206, were measured in this experiment, and they were significantly higher in the AP + UTI group than in the AP group (P < 0.01), whereas there were no differences between the control group and AP group.

Fig. 5.

A Western blot analysis of iNOS, CD86, Arg-1 and CD206 from different groups. ** represents P < 0.01, NS represents P > 0.05. B Representative immunofluorescence images of single-immunofluorescent staining of macrophages (green), CD86 (red) and CD206 (red) in the terminal ileal tissue from different groups. Nuclei were counterstained with DAPI (blue)

As shown in Fig. 5B, CD86 positive M1 macrophages expression in the AP group was significantly higher than in the control group, and there were no differences in CD206 positive M2 macrophages expression between the control and AP groups. After treatment with ulinastatin, CD86 positive M1 macrophages expression was obviously decreased and CD206 positive M2 macrophages expression was markedly increased compared to that in the AP group.

Ulinastatin promoted the Nrf2 activation and nuclear translocation

The protein and mRNA expressions of Nrf2 and HO-1 were measured in this experiment. The protein expression of Nrf2 and HO-1 was significantly higher in the AP group and AP + UTI group than in the control group (P < 0.01), and expression was further increased after ulinastatin treatment compared to that in the AP group (P < 0.01).

The design parameters have been specially optimized and the efficiencies of all primers have been verified (Nrf2: 98%, HO-1: 105%, GAPDH: 101%) through gradient dilution standard curves. The stability of the internal reference genes was confirmed by geNorm analysis: the M value of GAPDH was 0.32 (< 0.5), and the paired variation value of the combination with RPLP0 was V2/3 = 0.12 (< 0.15), indicating that it was applicable. Results similar to the protein levels for the relative mRNA levels of Nrf2 and HO-1 were observed in the control group, AP group and AP + UTI group (P < 0.01) (Fig. 6A).

Fig. 6.

A Western blot and qRT–PCR analysis of Nrf2 and HO-1 from different groups. ** represents P < 0.01. B Representative immunofluorescence images of single-immunofluorescent staining of Nrf2 (red) in the terminal ileal tissue from different groups. Nuclei were counterstained with DAPI (blue)

Nuclear translocation of Nrf2 was measured in this experiment. As shown in Fig. 6B, low Nrf2 expression was observed in both the cytoplasm and the nucleus of the control group. The expression of Nrf2 in both the cytoplasm and nucleus was higher in the AP group than in the control group, and a small amount of Nrf2 was transferred from the cytoplasm to the nucleus. It is worth noting that ulinastatin treatment significantly increased Nrf2 expression and nuclear translocation compared to those in the AP group.

Interruption of Nrf2 pathway eliminated ulinastatin-mediated inhibition of M1 polarization and inflammation

To investigate the possible mechanisms underlying the impact of ulinastatin on macrophage polarization and regulation of the inflammatory response, further studies were conducted by intervening with ML-385 (an Nrf2 blocker). As shown in Fig. 7A, the protein expression levels of Nrf2 and HO-1 in the AP + ML-385 group were significantly lower than those in the AP group were. Moreover, the expression of Nrf2 and HO-1 in the AP + UTI + ML-385 group was significantly lower than that in the AP + UTI group (P < 0.01).

Fig. 7.

A Western blot analysis of Nrf2, HO-1, TNF-α, IL-1β, IL-6 and IL-10 from different groups. ** represents P < 0.01. B Representative immunofluorescence images of single-immunofluorescent staining of macrophages (green), CD86 (red) and CD206 (red) in the terminal ileal tissue from different groups. Nuclei were counterstained with DAPI (blue)

As shown in Fig. 7B, CD86 positive M1 macrophages expression in the AP + ML-385 group was significantly higher than that in the AP group, while CD206 positive M2 macrophages expression was decreased. Meanwhile, after treatment with ML-385, CD86 positive M1 macrophages expression in the AP + UTI + ML-385 group was obviously increased and CD206 positive M2 macrophages expression was markedly decreased compared with the AP + UTI group. Furthermore, ML-385 treatment upregulated the expression of pro-inflammatory cytokines, including TNF-α, IL-1β, and IL-6, and downregulated the expression of anti-inflammatory cytokine IL-10.

Discussion

AP is a local or systemic inflammatory disease with high morbidity and mortality rates. Genetic, biochemical, and animal model studies have shown that inflammation and oxidative stress play central roles in AP onset and progression [[19]]. An imbalance between oxidative and antioxidant actions occurs during oxidative stress in AP [20]. Oxidative intermediates such as oxygen radicals and lipid peroxides are produced by activated immune cells and are recognized to be important in driving distant organ injury, including IEC damage and intestinal barrier dysfunction in the early stages of AP [21]. M1 macrophages are rapidly activated in early stage AP and aggravate pancreatitis by releasing large amounts of inflammatory factors, which trigger intense inflammation and subsequently worsen damage to pancreatic tissue and distant organs, especially intestinal barrier dysfunction [22], which is characterized by enhanced mucosal layer permeability, disturbed mucosal perfusion, and the development of tissue edema [23]. Therefore, it is important to inhibit inflammation and oxidative stress in the early stages of AP to prevent SIRS and MOSF. Our research showed that ulinastatin treatment in rats with AP can alleviate intestinal barrier dysfunction. Further research found that ulinastatin treatment alleviated inflammation and oxidative stress by inhibiting M1 macrophage polarization through the Nrf2 signaling pathway activation. As described above, we demonstrated that ulinastatin exerts protective effects against both AP and AP-associated intestinal barrier dysfunction.

Ulinastatin, an intrinsic trypsin inhibitor derived from the urine of healthy adults, has been studied for AP management. This study showed that ulinastatin treatment reduced serum amylase and lipase levels and pathological scores. In addition, a systematic review and meta-analysis of randomized controlled trials confirmed that ulinastatin combined with a somatostatin analog significantly decreased complication rates in AP, including acute respiratory distress syndrome (ARDS), acute kidney injury (AKI), and multiple organ dysfunction syndrome (MODS), compared with somatostatin analog monotherapy [24]. However, it is worth noting that ulinastatin was also shown to relieve histological damage to the intestinal mucosa and decrease the levels of DAO and I-FABP, which are specific proteins of intestinal function during SAP. Therefore, we demonstrated that ulinastatin can also improve AP-associated complications with intestinal injury according to this study. Findings from Song et al. also indicated that ulinastatin showed a protective effect on the intestinal mucosal barrier against sepsis and it may be mediated through the TLR4/MyD88/NF-κB pathway [25].

As the most important defense system in the human body, the normal intestinal barrier is based on intact IECs and TJ between the epithelial cells [26]. The homeostatic status of the intestinal barrier is essentially supported by the maintenance of intestinal barrier integrity, and the damaged IECs and disruption of TJs trigger significant alterations in intestinal barrier homeostasis, which may result in profound generation and secretion of intestinal proteolytic enzymes, increased intestinal permeability, and impaired integrity of the intestinal barrier [27]. Accumulating evidence supports the concept that intestinal hypoperfusion and ischemia/reperfusion injury secondary to AP contribute primarily to intestinal barrier dysfunction and increased bacterial translocation, leading to IPN and eventual development of SAP [28, 29]. Massive death of IECs and TJ structure damage appeared under the stress state caused by SAP resulted in a pathological increase in intestinal mucosal permeability [30, 31]. In addition, TJ protein expression may be affected by oxidative stress during AP [32]. This study corroborates these findings, observing intestinal epithelial cell (IEC) damage, widened tight junctions (TJ), intestinal hypoperfusion, and increased permeability in AP rats. Furthermore, we confirmed that ulinastatin treatment improves AP-associated intestinal barrier dysfunction, demonstrated by the recovery of IEC numbers, TJ structure, mucosal blood perfusion, and mucosal permeability. A similar finding was made by Yu et al. who pointed out that ulinastatin treatment corrected the abnormalities of the TJ proteins in colitis, and hence preserved the intestinal barrier function [33].

The imbalance in cellular redox reactions in IECs induced by oxidative stress during SAP contributes to damage to the structure of the intestinal mucosa, aggravates the inflammatory response, and further damages the intestinal mucosal barrier [34]. Nrf2 signaling pathway is known as an important protective factor against AP-induced intestinal barrier dysfunction, which can accelerate intestinal vascular perfusion and restore intestinal barrier dysfunction [35, 36]. The current study identified that Nrf2 signaling pathway activation can regulate macrophage polarization [37, 38]. However, the therapeutic mechanism of ulinastatin in AP-associated intestinal barrier dysfunction has not yet been elucidated. Our research showed that ulinastatin treatment increased the protein and relative mRNA expression levels of Nrf2 and HO-1, and promoted Nrf2 nuclear translocation. Moreover, ulinastatin treatment reduced the levels of MDA and ROS, and increased the levels of GPx, GR, GST, and TSH, which confirmed that the antioxidative stress during AP was promoted through Nrf2 signaling pathway activation by ulinastatin treatment. Notably, ulinastatin treatment also inhibited M1 macrophage polarization and promoted M2 macrophage polarization during intestinal barrier dysfunction in AP, which resulted in a significantly reduced release of inflammatory factors, including TNF-α, IL-1β, and IL-6 while increasing the activity of the anti-inflammatory cytokine IL-10.

Subsequently, ML-385 (an Nrf2 inhibitor) was used after ulinastatin treatment in this experiment. We observed that ML-385 intervention suppressed Nrf2 and HO-1 expression, promoted M1 macrophage and inhibited M2 macrophage infiltration—culminating in elevated proinflammatory mediator release and reduced IL-10 expression. These findings showed that ML-385 intervention partially eliminated the therapeutic effects of ulinastatin on intestinal barrier dysfunction, which indicated that Nrf2 pathway may be involved in the mechanism of ulinastatin treatment. A previous study also demonstrate that ulinastatin attenuates LPS-induced inflammation in renal tubular epithelial cells, which achieved by increasing the HO-1 expression and prompting the translocation of Nrf2 from the cytoplasm to the nucleus, while the alleviated effects were abolished by ML385 [39].

However, this work has certain limitations, including the dosage of ulinastatin, sample size and the clinical transformation. On one hand, the dosage of ulinastatin used in this animal experiment is 10000 U/kg BW, although it confirms to the safe and effective dosage, the optimal dosage and administration regimen remain to be further explored in subsequent experiments. We will also expand the sample size of animal experiments and select as many patient sample sizes as possible in subsequent clinical trials. On the other hand, the results and conclusions of this work, while promising, are based on animal experiments. The safety and efficacy need to be further verified in larger clinical trials to establish the therapeutic potential of ulinastatin in human.

Conclusion

This study demonstrated that ulinastatin inhibits macrophage M1 polarization to improve acute pancreatitis-associated intestinal barrier dysfunction by promoting Nrf2 signaling pathway activation, which further expanded the application of ulinastatin in the complications of organ dysfunction associated with AP.

Author contributions

W.Q., F.JH. and Z.SQ. Finished all the experiments. W.Q wrote the main manuscript text. F.JH. and Z.SQ. prepared all the figures and tables. G.M. guided and supervised this study. All authors reviewed the manuscript.

Funding

This work was supported by the Natural Science Foundation of Anhui Medical University (Grant No. 2023xkj036).

Data availability

All data supporting the findings of this study are available. Website: 10.4121/e5371749-f236-408e-ab12-cba7b15ec3a2.

Declarations

Ethics approval and consent to participate

The study was conducted in accordance with ARRIVE guidelines, and all animal experiments were conducted following the ethical standards of the Ethics Committee of Anhui Medical University (No. LLSC20231041).

Competing interests

The authors declare no competing interests.