Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Feb 16.
Published in final edited form as: Biochem Biophys Res Commun. 2025 Jan 20;749:151346. doi: 10.1016/j.bbrc.2025.151346

Expression of Fatty Acid Binding Proteins in Mesenteric Adipose Tissue

Shayla R Fish 1, Catherine L Halley 1, Mythili Dileepan 1,2, Ann V Hertzel 1,2, Deborah M Dickey 1, David A Bernlohr 1,2,3
PMCID: PMC12312445  NIHMSID: NIHMS2051465  PMID: 39855040

Abstract

Adipose is a complex tissue comprised of adipocytes, immune cells, endothelial and progenitor stem cells. In humans, there are at least nine defined adipose depots, each containing variable numbers of genetically identified adipocyte clusters suggesting remarkable heterogeneity and potential functionality in each depot with respect to lipid metabolism. Although subcutaneous and visceral depots are commonly analyzed for biochemical and molecular functions, the mesenteric depot has been overlooked yet strongly implicated in lipid mediated immune surveillance. Since fatty acid binding proteins (FABPs) are primary cellular conduits to lipid trafficking, we evaluated the expression patterns for four major fatty acid binding proteins (FABP1, FABP3, FABP4 and FABP5) using a combination of gene expression, immunoblotting, and immunofluorescence in mesenteric fat from both young and old, male and female C57Bl/6J mice. All four FABPs were expressed at the mRNA and protein level in murine mesenteric adipose tissue. While there was no statistical change in expression of mesenteric FABP isoforms with sex or age, the expression of mesenteric FABP1 was increased, and FABP4 decreased, in both males and females as compared to perigonadal and inguinal depots. Surprisingly, immunofluorescence staining revealed that compared to subcutaneous or perigonadal depots, mesenteric fat expresses FABP3, but little FABP5, in adipocytes. These results highlight the diversity in adipose tissue and the importance of evaluating the mesenteric depot in the context of lipid transport and metabolism.

Keywords: Mesentery, visceral adipose, fatty acid binding proteins, lipid trafficking

INTRODUCTION:

In adipose biology, an emphasis is often placed on the difference in physiological function between subcutaneous and visceral adipose tissues (SAT and VAT, respectively). VAT is known to be more metabolically detrimental than SAT depots with respect to pathologies such as cardiovascular disease and diabetes, with proteomic analyses demonstrating increased roles of VAT in energy metabolism and protein translation (Hruska et al., 2022). In contrast, SAT expresses much higher levels of beige and brown fat implying a greater role than VAT in thermogenesis (Li et al., 2021). The largest component of VAT is the mesenteric depot, a region of adipose surrounding various intestinal segments that acts as a mediator for intestinal communication with other body systems (Zhang et al., 2022).

Mesenteric adipose tissue (MAT) exhibits distinct expression properties from omental fat, the more commonly profiled visceral fat depot (Tchkonia et al., 2007). MAT is considered an endocrine organ and a source of both proinflammatory cytokines and C-reactive protein (Gu et al., 2023) while mesenteric fat thickness has been identified as an independent determinant of metabolic syndrome (Liu et al., 2006). Furthermore, previous studies have shown increased macrophage migration and proinflammatory molecule production in MAT with respect to other depots (Yu et al., 2006; Zwick et al., 2018).

Obesity, high fat diets and insulin resistance are correlated with increased inflammation of MAT (Wang et al., 2010). In comparison to SAT depots and the omental VAT depot, MAT demonstrates impaired glycerol release following isoproterenol stimulation suggesting an important role in metabolism and insulin resistance (Yang et al., 2008). The mesentery plays a key role in trafficking lipids between the intestines and other organ systems. Specifically, the mesenteric lymphatics strongly influence lipid metabolism as dietary lipids are transported via chylomicrons and both murine and human models have shown lipid deposition in MAT as a result of obesity-associated leakage in mesenteric lymphatic vessels (Mikrani et al., 2022). Interestingly, despite its demonstrated importance in immune modulation and metabolism, there is limited literature on specific MAT biology. This supports the importance of further analyzing lipid transport and metabolism within MAT.

Fatty acid binding proteins (FABP) are a family of ~ 15 kDa intracellular lipid chaperones with known roles in regulating cellular lipid responses; FABPs bind long-chain free fatty acids (FFAs) and influence lipid-sensitive metabolic and inflammatory processes (Furuhashi & Hotamisligil, 2008). FABPs share 20%−70% amino acid identify and fold as ten stranded β-barrel proteins binding their ligands within a central interior water-filled cavity. Although the proteins bind a hydrophobic ligand, the amino acids that line the interior cavity of FABPs are highly charged and polar (Coe & Bernlohr, 1998). All FABPs bind long-chain FFAs, though selectivity and binding mechanisms differ between FABP family members (Smathers & Petersen, 2011). Aside from FABP1 (liver), which can simultaneously bind two ligands, FABPs 2–6 bind a single ligand per molecule (Smathers & Petersen, 2011). Binding affinity across all FABPs has been associated with FFA hydrophobicity, with affinity decreasing with higher FFA solubility (Richieri et al., 2000). While dissociation constant values are in the nanomolar range across FABP members, varying FFA affinity between FABPs of different tissues suggests a role of these proteins in maintaining tissue-specific intracellular FFA concentrations (Richieri et al., 1999). Notably, FFA affinity is higher for FABPs from heart (FABP3) and liver (FABP1) tissues, as compared to intestinal and adipocyte FABPs (FABP2 and 4, respectively) (Richieri et al., 1999).

Previous work has noted depot-specific expression profiles of select FABPs in adipose tissue and highlighted corresponding implications in lipid metabolism, namely between SAT and VAT depots (Fisher et al., 2001, 2002). However, FABP expression has yet to be characterized in MAT as a representative visceral depot. Due to the importance of MAT in lipid metabolism and lack of literature on lipid carriers in mesenteric adipocytes, we have profiled FABPs 1, 3, 4 and 5 through gene expression, immunoblotting, and immunofluorescence staining in murine MAT. FABPs 2 and 6 were preliminarily characterized but due to cross contamination of intestinal tissue in mesenteric fat isolates, these FABPs were not further analyzed. Herein we report the surprising finding that FABP3, most commonly associated with skeletal and cardiac tissue, is expressed robustly by mesenteric adipocytes.

MATERIALS AND METHODS

Animals.

C57Bl/6J mice were bred and housed in the animal facility at the University of Minnesota. Mice were fed a standard chow diet. Young male and female mice were euthanized from four to six months of age while old mice were euthanized between 25 and 26 months of age. Tissue was harvested from the perigonadal, inguinal, and mesenteric adipose depots of each mouse following euthanasia. All experiments were approved by the University of Minnesota Institutional Animal Care and Use Committee (IACUC) and performed in accordance with guidelines and regulations (protocol 2310-41440A).

Immunoblotting.

For protein extraction, tissue samples from inguinal, perigonadal, and mesenteric adipose were ground TSE buffer (50mM TRIS pH 8, 50mM NaCl, 1mM EDTA). Tissue was ground in 250uL TSE buffer per 100mg tissue using a homogenizer. Samples were spun at 100,000 xg for 30 minutes to separate excess lipids and insoluble proteins. After the spin, the supernatant beneath the floating lipid layer was collected for protein extracts.

Equivalent protein was loaded onto polyacrylamide gels, either ten or twenty micrograms of each sample (14–15% hand-cast gels; 4–20% gradient gels, Bio-Rad #4561096EDU). Proteins were separated by SDS-PAGE and transferred to polyvinylidene fluoride membranes. Membranes were blocked with PBS Intercept blocking buffer (927–70001, Li-Cor Biosciences) and incubated with primary antibodies at 4°C overnight. Subsequently, membranes were washed and incubated with a Li-Cor IRDye-conjugated secondary antibody (1:10,000) for 1 hour and imaged using Odyssey infrared imaging (Li-Cor Biosciences). Primary antibodies used were GAPDH (Cell Signaling #2118, 1:1,000), FABP1 (Cell Signaling #13368, 1:1,000), FABP3 (Protein Tech #10676-1-AP, 1:2,000), FABP4 (1:10,000, (Hertzel et al., 2002)), and FABP5 (1:10,000, (Hertzel et al., 2002)).

Quantitative Real Time Polymerase Chain Reaction (qRT-PCR).

Tissue samples were homogenized in 1mL TRIzol reagent (Invitrogen) to isolate total RNA. One microgram of cDNA was synthesized per manufacturer’s protocol using iScript (Bio-Rad), and sequence amplification was measured with a Bio-Rad CFX 96 real-time system utilizing SYBR Green Supermix (1725271, Bio-Rad). Ribosomal protein lateral stalk subunit P0 (RPLP0) was used to normalize expression as an internal control. The primer sequences used are listed in Table 1.

Table 1.

Primer sequences used for qRT-PCR gene expression quantification.

Primer Forward Primer Sequence
(5’ -> 3’)		 Reverse Primer Sequence
(5’ -> 3’)		 Annealing Temperature
(°C)
RPLP0 AGATTCGGGATATGCTGTTGGC TCGGGTCCTAGACCAGTGTTC 61
FABP1 GGAAGGACATCAAGGGGGTG TCACCTTCCAGCTTGACGAC 62
FABP3 TTCTGGAAGCTAGTGGACAG TGATGGTAGTAGGCTTGGTCAT 58
FABP4 CAGAAGTGGGATGGAAAGTCG CGACTGACTATTGTAGTGTTTGA 61
FABP5 GGAAGGAGAGCACGATAACAAGA GGTGGCATTGTTCATGACACA 62
Open in a new tab

Immunofluorescence Staining and FABP Quantification.

To determine the expression of FABPs in mesenteric adipose tissue, immunofluorescence staining was performed on histology sections from young male and female mice as follows: The tissues were fixed in 10% neutral formalin, embedded in paraffin, and cut into 4 μm thick sections. After deparaffinization and hydration of the tissue sections, antigen retrieval was conducted using sodium citrate buffer to unmask the antigen epitopes. Following washing, the tissue sections were blocked with 10% normal goat serum in TBS (blocking buffer) for one hour at room temperature. Subsequently, the sections were incubated overnight at 4°C with the following primary antibodies: monoclonal antibody against rabbit FABP1 (Cell Signaling cat#13368, at 1:100), polyclonal antibody against rabbit FABP3 (Pro-tech cat#10676-1-AP, at 1:100), monoclonal antibody against rabbit FABP4 ((Hertzel et al., 2002), at 1:500), monoclonal antibody against mouse FABP5 ((Hertzel et al., 2002), at 1:500), monoclonal antibody against F4/80 (Abcam cat#AB6640-1001, at 1:50), and monoclonal antibody against CD34 (Life Technologies cat#14-0341-81, at 1:50). As secondary antibodies, goat anti-rabbit Alexa 568, goat anti-mouse Alexa 568, and goat anti-rat Alexa 488 were used at 1:500 dilution against the respective primary antibodies and incubated for 1 hour at room temperature. After DAPI staining and additional washes, coverslips were mounted with Prolong Gold Antifade Mounting Medium. Stained slides were examined using a Leica microscope, and images were captured with a Leica DFC310 FX camera.

Statistical Analysis.

Immunoblotting results are presented as mean ± standard deviation. qRT-PCR results are presented as geometric mean ± geometric standard deviation. One-way or two-way ANOVA analyses were completed with GraphPad Prism software to determine statistical significance, as noted in the figure legends. Significance is noted by asterisks: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. p-values of less than or equal to 0.15 are also noted. Individual data points are shown and sample sizes for each group are noted in figure legends.

RESULTS

Murine MAT Expresses Four Common Fatty Acid Binding Proteins.

To profile FABPs in MAT, we measured gene expression of four common FABP family members (FABP1; liver, FABP3; muscle, FABP4; adipose, FABP5; macrophage) using qRT-PCR constructed from mRNA isolated from bulk tissue. Ileal (FABP6) and intestinal (FABP2) were present in some, but not all samples suggesting variable levels of intestinal tissue contamination in mesenteric isolates. Because of this, FABP2 and FABP6 were not characterized in this study. All four FABPs profiled were expressed in MAT across all sample groups (Figure 1 a–d). There was a large variance in gene expression between individual FABPs but a similar relative difference for each FABP across sex and age groups (Figure 1e). Amongst all groups, the expression of FABP4> FABP1> FABP5 > FABP3.

Figure 1. Quantification of qRT-PCR gene expression analysis for FABPs in MAT.

Figure 1.

Open in a new tab

qRT-PCR was performed on total RNA extract from mesenteric adipose tissue dissections of young and old, male and female mice. (a-d): Relative quantification of each FABP across each sex and age category. Data is shown as relative fold change expression in comparison to young males. (e): Heat map showing relative abundance of each FABP as expressed through differences in cycle threshold (Ct) between each FABP target and RPLP0. Data represents the average of delta Ct values across each group. N=4 for young male and young female samples; N=4 for old female, N=2 for old male samples. Two-way geometric ANOVA analyses were performed to determine statistical significance.

Protein Expression FABP Targets in MAT

To extend the analysis of FABP expression from the mRNA level to that of protein, we profiled protein expression through immunoblotting. We measured expression of FABP1, FABP3, FABP4, and FABP5 in all samples (Figure 2a). There were no statistical differences seen between sex or age groups for any FABP and the protein abundance largely mirrored that for mRNA. FABP1 demonstrated a general trend of decreased expression with age in males but increased in females. The expression of FABPs 1, 3, 4 and 5 increased with age in female mice.

Figure 2. Immunoblotting analysis of FABPs 1,3,4,5 in MAT.

Figure 2.

Open in a new tab

Protein extracts were separated via SDS-PAGE and transferred to PVDF membranes prior to antibody incubation. Data is presented as fold change with respect to the young males. (a): Raw immunoblotting images for each protein target and normalizing control. (b): Quantification of expression shown in (a). Individual data points are shown. Data is presented as mean ± SD. N=3 for all data sets. Two-way ANOVA analyses were performed to determine statistical significance.

Differential FABP Expression in MAT Compared to SAT and VAT

We next assessed the expression of FABP1, FABP3, FABP4, and FABP5 in MAT compared with SAT and VAT as a function of sex and age. Intriguingly, we measured depot-specific differences in FABP expression through both qRT-PCR and immunoblotting. On a gene expression level, there was a significant increase in FABP1 mRNA level in the mesenteric compared with perigonadal depot in young and old females (Figure 3a). There was also a consistent trend of downregulation in FABP3, FABP4, and FABP5 in MAT as compared to the perigonadal depot. FABP3 was trending down in the mesenteric versus perigonadal depots in all groups (Figure 3b). FABP4 was generally decreased in MAT versus perigonadal in young females and trending downward in old females, and young males (Figure 3c). Along similar trends, FABP5 was also significantly decreased in young males and exhibited a trend towards decrease in older males (Figure 3d). Overall, gene expression analyses revealed distinct differences in FABP member expression not only between subcutaneous (inguinal) and visceral (perigonadal, mesenteric) depots, but also between the two profiled visceral depots.

Figure 3. Quantification of qRT-PCR gene expression analysis for FABP1, FABP3, FABP4, and FABP5 in perigonadal, inguinal, and mesenteric adipose tissues.

Figure 3.

Open in a new tab

(a-d): Quantification of fold change expression of each FABP relative to the perigonadal depot. RPLP0 was used as a housekeeping gene to normalize expression. Individual data points are shown, with data presented as geometric mean ± geometric SD. N=4 for young male samples; N=2 for old male, excluding N=1 for old male inguinal (a,b); N=4 for young female, excluding N=3 for young female inguinal (a,b,d); N=4 for old female samples. One-way geometric ANOVA analyses were performed to determine statistical significance.

Immunoblotting analyses demonstrated further distinct trends in FABP expression between visceral depots. FABP1 protein expression showed increasing trends in MAT across sample groups, increasing 18-fold in young males, 3-fold in old males compared with young females and old females (Figure 4a–b). Though exhibiting smaller magnitudes of upregulation, this increasing trend of FABP1 in MAT corresponded with previous gene expression analyzes. FABP3 showed significant downregulation in protein levels in MAT of young males and was trending down in young females (Figure 4 c–d). Immunoblotting for FABP4 showed significant downregulation across three of the four groups in MAT (Figure 4 e–f) while FABP5 protein expression was trending downward in MAT of young females and old males (Figure 4 g–h).

Figure 4. Immunoblotting analysis of FABP1, FABP3, FABP4, and FABP5 in perigonadal, inguinal, and mesenteric adipose depots.

Figure 4.

Open in a new tab

Data is presented as fold change with respect to the perigonadal depot. GAPDH was used as a loading control. (a,c,e,g): Raw immunoblotting images for each FABP and normalizing control. (b,d,f,h): Quantification of FABP expressions. Individual data points are shown. Data is presented as mean ± SD. N=4 for all data sets. One-way ANOVA analyses were performed to determine statistical significance.

FABP Expression Across MAT Adipocyte and SVF Populations

To further characterize FABP expression in MAT, we evaluated immunofluorescence staining of young male MAT samples to visualize deposition of the proteins in various cell populations. Through staining tissue sections with FABP targets in addition to either F4/80 (macrophage) or CD34 (endothelial cells), we visualized expression of FABP1 and FABP5 in both macrophage and SVF cell populations (Figure 5a–b). Interestingly, we also visualized expression of FABP3 and FABP4 in adipocytes, as denoted by the characteristic adipocyte morphology of these staining patterns (Figure 5a–b). Overall, these results illustrate the complexity in FABP expression within adipose and allude to the heterogeneity and importance of MAT as a visceral adipose depot.

Figure 5. Immunofluorescence localization of FABP family members in murine MAT.

Figure 5.

Open in a new tab

Mesenteric fat samples were obtained from young male C57Bl/6 mice fed a chow diet. (a): Tissue sections stained with anti-FABP (red) and anti-F4/80 (green) antibodies and co-labeled with DAPI (blue). (b): Tissue sections stained anti-FABP (red) and anti-CD34 (green) antibodies and co-labeled with DAPI (blue). Five independent fields were analyzed for imaging with one representative field shown. Yellow boxes show magnified image sections designated by the yellow arrow annotations. Scale bar represents 50 μm.

DISCUSSION

FABPs are abundant lipid carriers expressed in a variety of tissues and cell types with active lipid metabolism (Coe & Bernlohr, 1998). While the FABP family is characterized by similar structural properties, they exhibit wide variation in amino acid sequence and binding capabilities (Chmurzyńska, 2006). Despite the long-standing appreciation of FABPs as lipid carriers, their presence in mesenteric adipose tissue has not been analyzed. Herein we profiled the expression of four FABP family members within murine MAT as a function of sex and age and compared such analyses to that in subcutaneous and perigonadal adipose tissue. The mesenteric depot is unique in its location directly surrounding the intestines, which makes it the first adipose depot to encounter lipids travelling from gut chylomicrons into the lymphatic system (Tchkonia et al., 2013). Due to its proximity to major sites of lipid absorption and transport, it has been proposed that lipids are a major contributor to signaling pathways and innate immune responses in MAT (Tchkonia et al., 2013). Numerous studies have aimed to investigate metabolic signatures of this depot and shown distinct functions of MAT in lipid biosynthesis and lipolysis as opposed to other visceral depots (Catalano et al., 2010; Edens et al., 1993; Fried et al., 1998). The presence of multiple FABP family members in MAT further defines the unique metabolic role and signature of this adipose depot in inflammatory and metabolic processes (Hotamisligil & Bernlohr, 2015).

Our identification of FABP4 as the most abundant family member in MAT agrees well with prior studies in mature subcutaneous adipose tissue (Spiegelman & Green, 1980). Regulation of FABP levels in tissue occurs primarily at the transcriptional level due to their conserved gene promoter motifs (Chmurzyńska, 2006). Largely expressed in the liver and abdominal organs, FABP1, along with FABPs 3–5, are controlled by peroxisome proliferator-activated receptors (PPAR) and FABP1 has been proposed as a co-activator of PPAR-mediated gene regulation (Furuhashi & Hotamisligil, 2008; Schachtrup et al., 2004; Wolfrum et al., 2001). FABP5 also demonstrated high gene expression, which corresponds with its established presence in adipocytes and functions within a wide array of tissues (Furuhashi & Hotamisligil, 2008). FABP3 is known to be widely distributed across multiple tissues, including heart and skeletal muscle as well as kidney, pancreas, and adrenal tissues (Coe & Bernlohr, 1998). While FABP3 exhibited the lowest overall mean abundance through qRT-PCR analyses, it did demonstrate consistent protein expression in MAT across all sex and age groups. Overall, the expression of these various FABPs in MAT could reflect a key role of this VAT depot in facilitating transport of a multitude of dietary lipids from the proximal intestine to the lymphatic system and surrounding tissues.

Although this study did not identify any significant changes in expression of any FABP member across sex or age groups, we did note significant trends in both gene expression and protein levels which discriminated MAT from other profiled depots. The increased levels of FABP1 in MAT could reflect the proximity of MAT to the lymphatic transfer system to the liver; MAT is considered vital for the development of hepatic disease progression due to its direct exposure to released factors travelling from MAT to the liver through the portal vein (Choe et al., 2016). The differential FABP profile of FABPs 3–5 could likewise be attributed to unique metabolic activity occurring in mesenteric tissue.

Recently, MAT has been connected to the development of Crohn’s Disease (CD), an inflammatory bowel disease characterized by intestinal inflammation. MAT is implicated largely in CD through observed changes in adipocytokine release of hypertrophied mesenteric tissue (Gu et al., 2023). A hallmark of CD is an expansion of MAT, designated “creeping fat,” which is thought to act as a defense function from the invasion of intestinal bacteria (Zwick et al., 2018). Exhibited release of C-reactive protein from MAT under inflammation conditions, as well as elevated MAT MCP-1 release further support a vital role of this adipose depot in modulating immune responses (Peyrin-Biroulet et al., 2012; Yu et al., 2006). The novel expression levels observed of various FABPs in MAT may reflect specific lipid-binding characteristics in this depot which relate to its unique lipid trafficking and immune modulating activities. Future studies are needed to further elucidate the role of MAT in inflammatory responses and explore how FABP activity impacts MAT biology.

Data collected through immunofluorescence staining further supports the heterogeneity within adipose tissue in terms of differential expression of FABP targets among different cell populations. As opposed to SAT, VAT is characterized as having increased immune-cell content, increased metabolic activity in adipocytes, and higher pro-inflammatory cytokine expression (Kredel & Siegmund, 2014). Adipose tissue consists of adipocytes, energy-storage cells with large internal fat droplets and distinguished secretory activities, as well as stromal vascular fraction (SVF) cells, which consists of various cell types including fibroblasts, stem cells, macrophages, and blood cells (Kredel & Siegmund, 2014; Ramakrishnan & Boyd, 2018). In inflammatory states such as obesity and CD, there is an accumulation of macrophage and immune cells in adipose tissue, reflecting transient heterogeneity in resident cell distributions within adipose tissue (Kredel & Siegmund, 2014). Interestingly, we found evidence of FABP3 and FABP4 expression in both SVF and adipocyte cells within MAT, whereas FABP1 and FABP5 showed expression solely within the SVF populations. Importantly, this information could not have been gleaned from bulk RNAseq expression analysis adding significance to the immunofluorescence evaluation. Considering adipocytes’ roles in lipid storage and secretory pathways, expression of FABP3 and FABP4 by the adipocyte population may allude to specialized roles of mesenteric adipocytes in FABP3 and FABP4-related lipid metabolism.

HIGHLIGHTS.

  • FABP3 is expressed to high levels in mesenteric adipocytes

  • FABP5 is expressed in the mesenteric stromal vascular fraction but undetectable in mesenteric adipocytes

  • FABP1 expression is highest in mesenteric fat compared to FABP1 expression in inguinal or perigonadal fat

  • FABP4 expression in highest expressing FABP in mesenteric adipose tissue

ACKNOWLEDGEMENTS

The authors would like to thank the members of the Bernlohr laboratory for helpful discussions during the development of this manuscript. Supported by NIH NIA R01AG069819 to DAB.

LIST OF ABBREVIATIONS:

FFA

Free Fatty Acid

FABP

Fatty Acid Binding Proteins

GAPDH

Glyceraldehyde 3-phosphate Dehydrogenase

MAT

Mesenteric Adipose Tissue

SAT

Subcutaneous Adipose Tissue

SD

Standard Deviation

SVF

Stromal Vascular Fraction

VAT

Visceral Adipose Tissue

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

CONFLICT OF INTEREST STATEMENT

All authors certify that no conflict of interest exists for any part of this study

Declaration of interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

REFERENCES

  1. Catalano KJ, Stefanovski D, & Bergman RN (2010). Critical role of the mesenteric depot versus other intra-abdominal adipose depots in the development of insulin resistance in young rats. Diabetes, 59(6), 1416–1423. 10.2337/db08-0675 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Chmurzyńska A (2006). The multigene family of fatty acid-binding proteins (FABPs): Function, structure and polymorphism. Journal of Applied Genetics, 47(1), 39–48. 10.1007/BF03194597 [DOI] [PubMed] [Google Scholar]
  3. Choe SS, Huh JY, Hwang IJ, Kim JI, & Kim JB (2016). Adipose Tissue Remodeling: Its Role in Energy Metabolism and Metabolic Disorders. Frontiers in Endocrinology, 7. 10.3389/fendo.2016.00030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Coe NR, & Bernlohr DA (1998). Physiological properties and functions of intracellular fatty acid-binding proteins. Biochimica et Biophysica Acta (BBA) - Lipids and Lipid Metabolism, 1391(3), 287–306. 10.1016/S0005-2760(97)00205-1 [DOI] [PubMed] [Google Scholar]
  5. Edens NK, Fried SK, Kral JG, Hirsch J, & Leibel RL (1993). In vitro lipid synthesis in human adipose tissue from three abdominal sites. The American Journal of Physiology, 265(3 Pt 1), E374–379. 10.1152/ajpendo.1993.265.3.E374 [DOI] [PubMed] [Google Scholar]
  6. Fisher RM, Eriksson P, Hoffstedt J, Hotamisligil GS, Thörne A, Rydén M, Hamsten A, & Arner P (2001). Fatty acid binding protein expression in different adipose tissue depots from lean and obese individuals. Diabetologia, 44(10), 1268–1273. 10.1007/s001250100643 [DOI] [PubMed] [Google Scholar]
  7. Fisher RM, Thörne A, Hamsten A, & Arner P (2002). Fatty acid binding protein expression in different human adipose tissue depots in relation to rates of lipolysis and insulin concentration in obese individuals. Molecular and Cellular Biochemistry, 239(1–2), 95–100. [PubMed] [Google Scholar]
  8. Fried SK, Bunkin DA, & Greenberg AS (1998). Omental and Subcutaneous Adipose Tissues of Obese Subjects Release Interleukin-6: Depot Difference and Regulation by Glucocorticoid 1. The Journal of Clinical Endocrinology & Metabolism, 83(3), 847–850. 10.1210/jcem.83.3.4660 [DOI] [PubMed] [Google Scholar]
  9. Furuhashi M, & Hotamisligil GS (2008). Fatty acid-binding proteins: Role in metabolic diseases and potential as drug targets. Nature Reviews. Drug Discovery, 7(6), 489–503. 10.1038/nrd2589 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gu P, Dube S, & McGovern DPB (2023). Medical and Surgical Implications of Mesenteric Adipose Tissue in Crohn’s Disease: A Review of the Literature. Inflammatory Bowel Diseases, 29(3), 458–469. 10.1093/ibd/izac120 [DOI] [PubMed] [Google Scholar]
  11. Hertzel AV, Bennaars-Eiden A, & Bernlohr DA (2002). Increased lipolysis in transgenic animals overexpressing the epithelial fatty acid binding protein in adipose cells. Journal of Lipid Research, 43(12), 2105–2111. 10.1194/jlr.M200227-JLR200 [DOI] [PubMed] [Google Scholar]
  12. Hotamisligil GS, & Bernlohr DA (2015). Metabolic functions of FABPs—Mechanisms and therapeutic implications. Nature Reviews. Endocrinology, 11(10), 592–605. 10.1038/nrendo.2015.122 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hruska P, Kucera J, Pekar M, Holéczy P, Mazur M, Buzga M, Kuruczova D, Lenart P, Fialova Kucerova J, Potesil D, Zdrahal Z, & Bienertova-Vasku J (2022). Proteomic Signatures of Human Visceral and Subcutaneous Adipocytes. The Journal of Clinical Endocrinology & Metabolism, 107(3), 755–775. 10.1210/clinem/dgab756 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kredel LI, & Siegmund B (2014). Adipose-tissue and intestinal inflammation—Visceral obesity and creeping fat. Frontiers in Immunology, 5, 462. 10.3389/fimmu.2014.00462 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Li Y, Ping X, Zhang Y, Li G, Zhang T, Chen G, Ma X, Wang D, & Xu L (2021). Comparative Transcriptome Profiling of Cold Exposure and β3-AR Agonist CL316,243-Induced Browning of White Fat. Frontiers in Physiology, 12, 667698. 10.3389/fphys.2021.667698 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Liu KH, Chan YL, Chan WB, Chan JCN, & Chu CWW (2006). Mesenteric fat thickness is an independent determinant of metabolic syndrome and identifies subjects with increased carotid intima-media thickness. Diabetes Care, 29(2), 379–384. 10.2337/diacare.29.02.06.dc05-1578 [DOI] [PubMed] [Google Scholar]
  17. Mikrani R, Styles IK, Hoang TA, Abdallah M, Senyschyn D, Porter CJH, Cao E, & Trevaskis NL (2022). Obesity-associated mesenteric lymph leakage impairs the trafficking of lipids, lipophilic drugs and antigens from the intestine to mesenteric lymph nodes. European Journal of Pharmaceutics and Biopharmaceutics: Official Journal of Arbeitsgemeinschaft Fur Pharmazeutische Verfahrenstechnik e.V, 180, 319–331. 10.1016/j.ejpb.2022.10.019 [DOI] [PubMed] [Google Scholar]
  18. Peyrin-Biroulet L, Gonzalez F, Dubuquoy L, Rousseaux C, Dubuquoy C, Decourcelle C, Saudemont A, Tachon M, Béclin E, Odou M-F, Neut C, Colombel J-F, & Desreumaux P (2012). Mesenteric fat as a source of C reactive protein and as a target for bacterial translocation in Crohn’s disease. Gut, 61(1), 78–85. 10.1136/gutjnl-2011-300370 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ramakrishnan VM, & Boyd NL (2018). The Adipose Stromal Vascular Fraction as a Complex Cellular Source for Tissue Engineering Applications. Tissue Engineering. Part B, Reviews, 24(4), 289–299. 10.1089/ten.TEB.2017.0061 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Richieri GV, Ogata RT, & Kleinfeld AM (1999). Fatty acid interactions with native and mutant fatty acid binding proteins. In Banaszak L & Bernlohr DA (Eds.), Lipid Binding Proteins within Molecular and Cellular Biochemistry (pp. 77–85). Springer US. 10.1007/978-1-4615-4929-1_9 [DOI] [PubMed] [Google Scholar]
  21. Richieri GV, Ogata RT, Zimmerman AW, Veerkamp JH, & Kleinfeld AM (2000). Fatty Acid Binding Proteins from Different Tissues Show Distinct Patterns of Fatty Acid Interactions. Biochemistry, 39(24), 7197–7204. 10.1021/bi000314z [DOI] [PubMed] [Google Scholar]
  22. Schachtrup C, Emmler T, Bleck B, Sandqvist A, & Spener F (2004). Functional analysis of peroxisome-proliferator-responsive element motifs in genes of fatty acid-binding proteins. The Biochemical Journal, 382(Pt 1), 239–245. 10.1042/BJ20031340 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Smathers RL, & Petersen DR (2011). The human fatty acid-binding protein family: Evolutionary divergences and functions. Human Genomics, 5(3), 170. 10.1186/1479-7364-5-3-170 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Spiegelman BM, & Green H (1980). Control of specific protein biosynthesis during the adipose conversion of 3T3 cells. The Journal of Biological Chemistry, 255(18), 8811–8818. [PubMed] [Google Scholar]
  25. Tchkonia T, Lenburg M, Thomou T, Giorgadze N, Frampton G, Pirtskhalava T, Cartwright A, Cartwright M, Flanagan J, Karagiannides I, Gerry N, Forse RA, Tchoukalova Y, Jensen MD, Pothoulakis C, & Kirkland JL (2007). Identification of depot-specific human fat cell progenitors through distinct expression profiles and developmental gene patterns. American Journal of Physiology. Endocrinology and Metabolism, 292(1), E298–307. 10.1152/ajpendo.00202.2006 [DOI] [PubMed] [Google Scholar]
  26. Tchkonia T, Thomou T, Zhu Y, Karagiannides I, Pothoulakis C, Jensen MD, & Kirkland JL (2013). Mechanisms and metabolic implications of regional differences among fat depots. Cell Metabolism, 17(5), 644–656. 10.1016/j.cmet.2013.03.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Wang Y, Li J, Tang L, Wang Y, Charnigo R, de Villiers W, & Eckhardt E (2010). T-lymphocyte responses to intestinally absorbed antigens can contribute to adipose tissue inflammation and glucose intolerance during high fat feeding. PloS One, 5(11), e13951. 10.1371/journal.pone.0013951 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Wolfrum C, Borrmann CM, Borchers T, & Spener F (2001). Fatty acids and hypolipidemic drugs regulate peroxisome proliferator-activated receptors alpha - and gamma-mediated gene expression via liver fatty acid binding protein: A signaling path to the nucleus. Proceedings of the National Academy of Sciences of the United States of America, 98(5), 2323–2328. 10.1073/pnas.051619898 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Yang Y-K, Chen M, Clements RH, Abrams GA, Aprahamian CJ, & Harmon CM (2008). Human mesenteric adipose tissue plays unique role versus subcutaneous and omental fat in obesity related diabetes. Cellular Physiology and Biochemistry: International Journal of Experimental Cellular Physiology, Biochemistry, and Pharmacology, 22(5–6), 531–538. 10.1159/000185527 [DOI] [PubMed] [Google Scholar]
  30. Yu R, Kim C, Kwon B, & Kawada T (2006). Mesenteric Adipose Tissue-Derived Monocyte Chemoattractant Protein-1 Plays a Crucial Role in Adipose Tissue Macrophage Migration and Activation in Obese Mice. Obesity, 14(8), 1353–1362. 10.1038/oby.2006.153 [DOI] [PubMed] [Google Scholar]
  31. Zhang H, Ding Y, Zeng Q, Wang D, Liu G, Hussain Z, Xiao B, Liu W, & Deng T (2022). Characteristics of mesenteric adipose tissue attached to different intestinal segments and their roles in immune regulation. American Journal of Physiology-Gastrointestinal and Liver Physiology, 322(3), G310–G326. 10.1152/ajpgi.00256.2021 [DOI] [PubMed] [Google Scholar]
  32. Zwick RK, Guerrero-Juarez CF, Horsley V, & Plikus MV (2018). Anatomical, Physiological, and Functional Diversity of Adipose Tissue. Cell Metabolism, 27(1), 68–83. 10.1016/j.cmet.2017.12.002 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES