Abstract
Gastric cancer (GC) is the third leading cause of cancer‐related mortality worldwide. The Epstein–Barr virus (EBV) may play a role in certain cases of GC. Therefore, this study aimed to investigate the prevalence of EBV in the gastric tissue of both gastric cancer patients and non‐cancer patients in Shiraz, Iran. In this cross‐sectional study, 159 formalin‐fixed paraffin‐embedded (FFPE) tissues from gastric cancer patients and 137 from non‐cancer patients were assessed. All samples were assessed using PCR on the β‐globin gene. The nested PCR method was used to investigate the presence of the EBNA‐1‐EBV gene. The results were analysed using chi‐squared statistical tests. The mean age of the GC group and the control group was 62.08 ± 13.45 and 63.97 ± 9.13. In the GC and control groups, 33.33% (53/159) and 35.04% (48/137) were female. The results showed that in the cancer group, 1.88% (3/159) of tissue samples were positive for EBV, while this statistic was 22.62% (31/137) for non‐cancer samples (p < .0001). All EBV‐positive cancer patients were female with a mean age of 64.66 ± 7.37 while in the control group, 20.83% (10/48) of females and 23.59% (21/89) of males were positive for EBV, which was not statistically significant (p = .832). The low frequency of EBV infection in GC tissue might indicate the ‘hit and run’ mechanism of EBV in GC carcinogenesis. Additionally, the abundance of B lymphocytes in the inflamed samples of the healthy control group might influence the high frequency of EBV in this group. More investigations are recommended to verify these results.
Keywords: EBNA‐1, Epstein–Barr virus, gastric cancer, nested PCR
1. INTRODUCTION
Gastric cancer (GC), with more than 968,000 new cases and 660,000 deaths in 2022, is known as the fifth leading cause of cancer and cancer‐related deaths. 1 In many South‐Central Asian countries, including Iran, gastric cancer is the most common cause of cancer and death in men. 2 GC is mostly adenocarcinoma and is divided into two types: intestinal and diffuse. 3 Smoking, alcohol consumption and infections including Helicobacter pylori (H. pylori) and Epstein–Barr virus (EBV) are among the main risk factors for GC worldwide. 4
EBV, the first discovered oncogenic virus, is a DNA virus that belongs to the Herpesviridae family and is also known as human gammaherpesvirus 4 (HHV‐4). It infects almost 100% of the population during childhood and causes a permanent latent infection in B‐lymphocytes. 5 Although EBV acute infections often remain asymptomatic, they sometimes appear as mononucleosis, especially in young individuals. Moreover, EBV is responsible for some malignancies, including Burkitt's lymphoma, nasopharyngeal carcinoma (NPC), Hodgkin's and non‐Hodgkin's lymphoma, post‐transplant lymphoproliferative lymphoma, diffuse large B‐cell lymphoma (DLBCL) and NK/T‐cell lymphoma. 6
For the first time in 1990, this virus was reported in gastric lymphoepithelial carcinoma. About 10% of stomach cancers worldwide have been identified as related to this virus. 7 Recently, EBV‐associated gastric cancer (EBVaGC) has been introduced as one of the subgroups of gastric carcinoma. The exact carcinogenic mechanism of EBV in relation to GC is unknown, but viral oncoproteins, including LMP and EBNAs, can largely explain the important pathways of cell carcinogenesis. Researchers believe EBVaGC is associated with lymphoid stroma and has a relatively good prognosis. 8
Three types of latency (I, II, III) are reported based on the expression pattern of viral genes in malignancies. 9 It has been shown that EBVaGC follows the type I latent pattern with the expression of EBER, EBNA‐1 and BART mRNA. 10 Research has stated that latent EBV infection can be related to genomic abnormalities such as aberrant DNA methylation. The most relevant viral protein that causes abnormalities is LMP2A, which plays a role in the development and survival of EBVaGC. 11 EBNA‐1 is expressed in all EBV‐related tumours to maintain viral episomes. 12 Cell studies show that EBNA‐1 can have an oncogenic function by contributing to genomic instability. 13 , 14 The findings indicate that EBNA‐1 is continuously and permanently expressed in EBVaGC 15 , 16 It has been shown that mutations in the EBNA‐1 gene may contribute to the development of EBVaGC by altering the function of PLOSs, which are known to be an important prognostic marker in gastric cancer. 16
So far, the prevalence of EBV in GC patients in Iran is generally low, averaging up to 10%. In Kerman, about 11% (10/90) of GC patients were positive for EBV. 17 In Isfahan and Tehran, 6% (9/150) and 3% (9/273) of patients with this cancer were EBV‐positive. 18 , 19 Contrary to these findings, some studies reported a very high frequency of this virus; for example, the statistics of EBVaGC patients in Khorasan were reported as 62.5% (32/56). 20 In other countries, such as Mexico, 10.67% (8/75) of GC patients were EBV‐positive. 21 Additionally, in Honduras and Central America, 64% (48/64) of the GC samples were declared EBV‐positive. 22 Therefore, this study was conducted to investigate the frequency of EBV infection in gastric cancer patients compared to a healthy control group in Fars province, Iran.
2. MATERIALS AND METHODS
A total of 159 formalin‐fixed paraffin‐embedded (FFPE) tissues from GC patients and 137 samples from non‐cancer subjects were included in this cross‐sectional study. Samples were selected and collected from Shahid Faghihi and Namazi Hospitals, affiliated with Shiraz University of Medical Sciences (SUMS), Shiraz, Iran, during the Years 2014 to 2021. The stained slides were rechecked and confirmed by a pathologist for cancer and its type. This study was approved by the local ethics committee of SUMS with the ethics number: (IR.SUMS.REC.1402.257).
2.1. DNA extraction and qualification
Ten sections with a thickness of 10 μm were collected from each FFPE tissue block in separate sterile microtubes. Deparaffinization was performed according to a previous study. 23 Genomic DNA was extracted using a commercial extraction kit (Yekta Tajhiz Azma, Tehran, Iran) according to the manufacturer's instructions. The quantity of extracted DNA was determined using OD‐metry (Nanodrop™ Spectrophotometer, Thermo Scientific, USA). Additionally, to evaluate the quality of the extracted DNA, all samples were assessed using PCR on the β‐globin gene according to previous instructions. 24 The samples that were positive for the β‐globin gene were stored at −20°C for the nested polymerase chain reaction assay.
2.2. Nested polymerase chain reaction assay
To detect the EBV genome, two pairs of primers that amplify the EBNA‐1 gene were used in the nested PCR assay (Table 1). For the amplification reaction, 1 μL of each DNA extracted solution, 10 μL of MasterMix (Amplicon, Denmark) and 0.5 μL of the forward and reverse external primers in a final volume of 20 μL were used. Thermal cycling conditions (95°C for 7 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 35 s, extension at 72°C for 45 s and final extension at 72°C for 10 min) were used for the first step. 1 μL of each PCR product was used for nested PCR after preparing a 1:100 dilution. The same thermal cycling program as the first stage was repeated with 30 cycles. After gel electrophoresis, the results were examined using UV light as indicated in Figure 1. Positive and negative controls were included in each assay to control the experimental condition.
TABLE 1.
The sequences, target location and the length of product of each primer pair used in the study.
| Length of product (bp) | Location | Sequence (5′ → 3′) | Primer | Target | References |
|---|---|---|---|---|---|
| 110 | 62,170–62,190 | ACACAACTGTGTTCACTAGC | Forward | β‐globin | 24 |
| 62,279–62,299 | CAACTTCATCCACGTTCACC | Reverse | |||
| 806 | 1092–1109 | GAAGTCGTGAAAGAGCCA | Outer forward | EBNA‐1 | 25 |
| 1879–1896 | ATCACCTCCTTCATCTCC | Outer reverse | |||
| 743 | 1152–1173 | CAGTAGTCAGTCATCATCATCC | Inner forward | ||
| 1875–1894 | CACCTCCTTCATCTCCGT | Inner Reverse |
FIGURE 1.
PCR gel electrophoresis of GC patients and Healthy group: A single band obtained from nested PCR with a length of 743 bp; (L: 100 bp + 3 kb DNA ladder (SMOBIO, Taiwan), 1: EBV negative cancer group, 2: EBV negative healthy group, 3–6: EBVaGC, 7: EBV‐positive healthy group, 8: Positive control, 9: Negative control).
2.3. Statistical Analysis
Statistical analysis was performed using the spss software version 26 (Chicago, IL, USA) with the chi‐squared test. A p‐value of <.05 was considered significant.
3. RESULTS
The mean age of participants was 62.95 ± 11.67 years, with a range of 30–89 years. The mean age of the GC and healthy control groups was 62.08 ± 13.45 and 63.97 ± 9.13 years (Table 2). Out of 296 participants, 195 were male and 101 were female. In the GC group, out of 159 patients, 33.33% (53/159) were female and 66.67% (106/159) were male, with mean age of 59.1 ± 14.6 and 63.5 ± 12.6 years. In the healthy control group, out of 137 subjects, 35.04% (48/137) were female and 64.96% (89/137) were male, with mean age of 63.33 ± 8.7 and 64.31 ± 9.3 years.
TABLE 2.
Comparison of demographic information in EBV+/− GC cancer and non‐cancer patients.
| Non‐gastric cancer | Gastric cancer | ||||||
|---|---|---|---|---|---|---|---|
| EBV (+) | EBV (−) | p‐value | EBV (+) | EBV (−) | p‐value | ||
| Mean age | 64.03 ± 8.04 | 63.95 ± 9.46 | .9 | 64.66 ± 7.37 | 62.03 ± 13.55 | .73 | |
| Gender | Male | 23.59% (21/89) | 76.41% (68/89) | p = .832 | 0% (0/106) | 100% (106/106) | .03 |
| Female | 20.83% (10/48) | 79.1% (38/48) | 5.66% (3/53) | 94.34% (50/53) | |||
The results of the molecular assay showed that 1.88% (3/159) of cancerous tissues and 22.62% (31/137) of the healthy control tissues were positive for EBV, a statistically significant difference (p < .0001). The results also showed that in the case group, all EBV‐positive samples were female, which was significantly different from male samples that were negative for EBV (p = .03). Moreover, in the healthy control group, 20.83% (10/48) of females and 23.59% (21/81) of males were positive for EBV, which was not statistically significant (p = .832).
4. DISCUSSION
Gastric cancer often correlates with environmental factors including infectious agents such as H. pylori and EBV. It is probable that EBV contributes to gastric cancer development through oncogenic processes, such as aberrant DNA methylation following latent infection. 11
The results of our study showed that only 1.88% (3/159) of the cancerous tissues were EBV‐positive. Globally, EBV prevalence in GC patients averages around 10%. 26 However, rates vary widely in different regions. In line with our findings, the first study in Iran and the Middle East by Abdirad et al. 27 showed that only 3% (9/273) of patients were EBV‐positive. Another report from Iran showed a 6.66% (6/90) frequency of EBV. 28 Using similar methodology, nested PCR, Gharibzadeh et al. 29 reported that the EBNA‐1 gene fragment was detected in 7% (5/70) of GC patients. Moreover, Estaji et al. 18 showed that the frequency of EBV was 6% in Iranian GC patients (9/150). Furthermore, in Kerman, Iran, the frequency of EBV in gastric cancer patients was reported as 11% (10/90). 17
Outside Iran, some studies showed a relatively low frequency of EBV infection in GC patients. For example, Martínez‐López et al. 21 in Mexico reported a 10.67% (8/75) prevalence of EBV in GC patients. Böger et al. 30 reported the frequency of EBV‐RNA in GC patients to be about 5% (22/484). In South Korea, researchers showed that 10% (4/40) of GC patients were positive for EBV. 31 These studies indicate that although the prevalence of GC in Iran is high, there is little correlation between EBV infection and gastric cancer.
In other countries, some studies reported a relatively high frequency of EBV infection in GC patients. For instance, in Brazil, de Souza reported a 20% (62/302) prevalence of EBV in patients with metastatic gastric cancer. 32 In Thailand, the frequency of EBV in gastric adenocarcinoma was relatively high, with 33.3% (11/33) of GC tissues being positive for EBV. 33 In China, using the nested PCR method, researchers showed that 53.7% (51/95) of GC tissues were EBV‐positive. 34 In the United States, Ryan et al. reported that EBV‐DNA was detected in 64% (48/64) of GC patients. 22 In Portugal, a study showed a high prevalence of EBV in GC tissues, with 90.2% (74/82) of GC patients testing positive for EBV. 35
Taken together, the frequency of EBV infection in GC tissue in different geographic areas and countries varies greatly, ranging from less than 2% to more than 90%. Therefore, the association between GC and EBV might vary in different parts of the world. The rare occurrence of EBV infection in GC tissue in our study suggests that additional factors may influence the association between EBV and GC; for example, specific EBV strains prevalent in certain geographic regions may have carcinogenic potential. 19 , 25
Moreover, the results of the study showed that 22.62% (31/137) of the healthy control group were positive for EBV. Similarly, a study in Portugal showed that the frequency of EBV was 27.3% (9/33) in the healthy control group. 35 In Mexico, Martínez‐López et al. 21 found that only 2% (2/148) of healthy control tissue was infected with EBV. In contrast, using nested PCR, Gharibzadeh et al. 29 reported that the EBNA‐1 gene fragment was not detected in the healthy control group.
Our findings showed that the frequency of EBV in GC tissues is significantly lower than in healthy control tissues. We have two interpretations for these findings: First, given that healthy control samples are typically obtained from inflamed areas of stomach tissue with non‐cancerous origins, the abundance of B lymphocytes harbouring the latent virus may have led to the heightened detection of the virus in individuals without any apparent health issues. 36 Second, the higher number of EBV infections in the control group compared to the GC group might be related to the ‘hit‐and‐run’ mechanism, as many studies show that the non‐detection of the EBV genome in cancer cells may be due to this phenomenon. 37 According to this hypothesis, the majority of the EBV genome might be lost as a result of the deficient duplication and asymmetric partitioning of EBV episomes during the S‐phase and M‐phase. 38 It is proposed that once a viral infection such as EBV has induced an adequate number of mutations in cellular oncogenes, the expression of viral proteins or viral infection is no longer essential for tumour maintenance, and, thus, the virus may vanish during cancer progression, similar to a chemical carcinogen. 39 In this regard, Sadeghi et al. 40 reported a significantly higher frequency of EBV in healthy chronic cervicitis than in cervical cancer samples. This mechanism has been proposed for the carcinogenesis of some viruses, including β‐HPV and BK virus. 39 This phenomenon has also been suggested for the pathogenesis of EBV in cervical cancer recently. 40 It is essential to point out that the methodology applied in these projects is distinct from our methodology.
In situ hybridization (ISH) technique is considered the gold standard for detecting latent EBV infection in biopsy specimens due to its high specificity. 41 However, PCR‐based molecular methods include nested PCR have been used in various studies to detect this virus. Although these methods have lower specificity, they can detect low virus copy numbers in tissue due to their higher sensitivity. 7 , 42 Moreover, the advantage of EBER‐ISH is in identifying the location of EBV genome amplification and differentiating tissue specific infected cells from virus‐carrying lymphocytes. In studies that use non‐fresh samples, such as the present study, the chance of detection by this method may be reduced.
Regarding the age of participants, the results of the study showed that there is no significant relationship between age and EBV infection in cancer patients. Moreover, although the number of EBVaGC patients in our study was low, there was no significant relationship between ages in the EBV‐positive control group. In Iran, similar to our study, a study reported no significant relationship between age and EBVaGC. 27 However, some studies state that patients in a certain age range are more likely to be affected by EBVaGC. In this regard, a study in Germany showed that the prevalence of EBV is higher in gastric cancer patients under the age of 45. 43 Additionally, two studies in China confirmed that EBVaGC is more common in people under 65 and 67 years. 19 , 44 This difference can be caused by environmental and genetic factors as well as the number of EBVaGC samples that were investigated.
In the present study, there was a significant relationship between the gender of subjects and the frequency of EBV infection in cancerous tissues. In other studies, it has been shown that despite the lack of a significant relationship between gender and EBV infection in cancer patients, the number of infected men was higher than that of women. For example, in studies conducted by Leila et al. and Estaji et al., 17 , 18 although the number of men with EBVaGC was higher than that of women, the difference was not significant. Moreover, two other studies from Iran did not show a significant relationship between gender and EBV infection despite more men suffering from EBVaGC. 20 , 27 However, a study in Japan showed that the number of men with EBVaGC was significantly higher than that of women. 45 It seems that the non‐significance of the relationship between gender and EBVaGC is influenced by the small number of EBV‐positive samples in each study, which affects the detection power of statistical tests.
The relatively low number of GC patient samples and the method of EBV detection might account for the limitations of the study, which would be overcome using more GC samples as well as the ISH technique for identifying the infected cells in future studies.
In conclusion, the lower frequency of EBV infection in cancerous tissue might be linked to the ‘hit‐and‐run’ mechanism of carcinogenesis reported for some cancerous viruses, including EBV. Moreover, the higher frequency of EBV in healthy tissue might be related to the type of control tissue, as these are often obtained from inflamed areas of the stomach. The abundance of B lymphocytes harbouring the latent virus may have led to the heightened detection of EBV in healthy control tissues. The results also indicated that the gender of participants might be associated with the frequency of EBV infection in GC patients. More studies with a higher number of GC and healthy tissue samples from different parts of Iran are recommended to verify these results.
AUTHOR CONTRIBUTIONS
Study concept: Sarvari J, Farhadi A; Sample collection: Shokripour M, Omidifar N and Vafapour Z; Bench work: Sahel Faraji F, Ansari M, Farahani F, Abuei H; Data analysis: Hashemi MA and Hosseini Tabatabaie F; Manuscript drafting: Hosseini Tabatabaie F and Vafapour Z; Critical revision of the manuscript: Sarvari J, Farhadi A, Shokripour M, Omidifar N. All authors read and approved the final manuscript.
CONFLICT OF INTEREST STATEMENT
The authors have no relevant financial or non‐financial interests to disclose.
ETHICS STATEMENT
This study was approved by the local ethics committee of SUMS with the ethics number: (IR.SUMS.REC.1402.257).
CONSENT TO PARTICIPATE
Informed consent was obtained before sample collection.
ACKNOWLEDGEMENTS
This study was extracted from the MD dissertation by Mohammad Ansari and Sahel Faraji, which received financial support from SUMS (grant nos. 28494 and 28679).
Tabatabaie FH, Faraji S, Ansari M, et al. Molecular epidemiology of Epstein–Barr virus in gastric cancer patients compared to healthy control group in Shiraz, Iran. Int J Exp Path. 2025;106:e70004. doi: 10.1111/iep.70004
DATA AVAILABILITY STATEMENT
The datasets generated during this study are available from the corresponding author upon reasonable request.
REFERENCES
- 1. Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;74:229‐263. [DOI] [PubMed] [Google Scholar]
- 2. Shin WS, Xie F, Chen B, et al. Updated epidemiology of gastric cancer in Asia: decreased incidence but still a big challenge. Cancer. 2023;15(9):2639. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Lauren P. The two histological main types of gastric carcinoma: diffuse and so‐called intestinal‐type carcinoma: an attempt at a histo‐clinical classification. Acta Pathol Microbiol Scand. 1965;64(1):31‐49. [DOI] [PubMed] [Google Scholar]
- 4. Tan P, Yeoh K‐G. Genetics and molecular pathogenesis of gastric adenocarcinoma. Gastroenterology. 2015;149(5):1153‐1162.e3. [DOI] [PubMed] [Google Scholar]
- 5. Yin H, Qu J, Peng Q, Gan R. Molecular mechanisms of EBV‐driven cell cycle progression and oncogenesis. Med Microbiol Immunol. 2019;208(5):573‐583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Stanland LJ, Luftig MA. The role of EBV‐induced hypermethylation in gastric cancer tumorigenesis. Viruses. 2020;12(11):1222. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Tavakoli A, Monavari SH, Solaymani Mohammadi F, Kiani SJ, Armat S, Farahmand M. Association between Epstein‐Barr virus infection and gastric cancer: a systematic review and meta‐analysis. BMC Cancer. 2020;20(1):493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Usui G, Matsusaka K, Mano Y, et al. DNA methylation and genetic aberrations in gastric cancer. Digestion. 1964;102(1):25‐32. [DOI] [PubMed] [Google Scholar]
- 9. Young LS, Rickinson AB. Epstein‐Barr virus: 40 years on. Nat Rev Cancer. 2004;4(10):757‐768. [DOI] [PubMed] [Google Scholar]
- 10. Iizasa H, Nanbo A, Nishikawa J, Jinushi M, Yoshiyama H. Epstein‐Barr virus (EBV)‐associated gastric carcinoma. Viruses. 2012;4(12):3420‐3439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Nishikawa J, Iizasa H, Yoshiyama H, et al. Clinical importance of Epstein–Barr virus‐associated gastric cancer. Cancers (Basel). 2018;10(6):167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Farrell PJ. Epstein–Barr virus and cancer. Annu Rev Pathol Mech Dis. 2019;14:29‐53. [DOI] [PubMed] [Google Scholar]
- 13. Sivachandran N, Dawson CW, Young LS, Liu FF, Middeldorp J, Frappier L. Contributions of the Epstein‐Barr virus EBNA1 protein to gastric carcinoma. J Virol. 2012;86(1):60‐68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Gruhne B, Sompallae R, Marescotti D, Kamranvar SA, Gastaldello S, Masucci MG. The Epstein–Barr virus nuclear antigen‐1 promotes genomic instability via induction of reactive oxygen species. Proc Natl Acad Sci. 2009;106(7):2313‐2318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Borozan I, Zapatka M, Frappier L, Ferretti V. Analysis of Epstein‐Barr virus genomes and expression profiles in gastric adenocarcinoma. J Virol. 2018;92(2):e01239‐17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Salnikov MY, MacNeil KM, Mymryk JS. The viral etiology of EBV‐associated gastric cancers contributes to their unique pathology, clinical outcomes, treatment responses and immune landscape. Front Immunol. 2024;15:1358511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Leila Z, Arabzadeh SA, Afshar RM, Afshar AA, Mollaei HR. Detection of Epstein‐Barr virus and cytomegalovirus in gastric cancers in Kerman, Iran. Asian Pac J Cancer Prev. 2016;17(5):2423‐2428. [PubMed] [Google Scholar]
- 18. Estaji F, Nasr Esfahani B, Zibaee S, Sanei MH, Moghim S. Epstein‐barr virus/Helicobacter pylori coinfection and gastric cancer: the possible role of viral gene expression and shp1 methylation. Iran J Microbiol. 2022;14(6):901‐912. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Thuan L, Kha ND, Minh NT, Thuy LHA. Novel patterns of the Epstein‐Barr nuclear antigen (EBNA‐1) V‐Val subtype in EBV‐associated nasopharyngeal carcinoma from Vietnam. Balk J Med Genet. 2019;22(1):61‐68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Amoueian S, Attaranzadeh A, Gholamimoallem Z, Sadeghi M, Hashemi S‐M, Allahyari A. Epstein–Barr virus infection in adult patients with gastric cancer in northeast of Iran. Indian J Med Paediatr Oncol. 2018;39(02):206‐209. [Google Scholar]
- 21. Martínez‐López JL, Torres J, Camorlinga‐Ponce M, Mantilla A, Leal YA, Fuentes‐Pananá EM. Evidence of Epstein‐Barr virus association with gastric cancer and non‐atrophic gastritis. Viruses. 2014;6(1):301‐318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Ryan JL, Morgan DR, Dominguez RL, et al. High levels of Epstein‐Barr virus DNA in latently infected gastric adenocarcinoma. Lab Invest. 2009;89(1):80‐90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Mahmoudvand S, Zamani K, Safaei A, et al. No detection of Streptococcus gallolyticus and Helicobacter pylori in colorectal cancer tissue samples in Shiraz, Iran. Iran J Cancer Prev. 2017;10(1):e6337. [Google Scholar]
- 24. Dowran R, Joharinia N, Safaei A, et al. No detection of EBV, BKV and JCV in breast cancer tissue samples in Iran. BMC Res Notes. 2019;12(1):1‐5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Vafapour Z, Tabatabaie FH, Hosseini SY, et al. Sequence variation of the Epstein‐Barr virus nuclear antigen 1 (EBNA1) gene in chronic lymphocytic leukemia and healthy volunteer subjects. Arch Virol. 2024;169(1):1. [DOI] [PubMed] [Google Scholar]
- 26. Akiba S, Koriyama C, Herrera‐Goepfert R, Eizuru Y. Epstein‐Barr virus associated gastric carcinoma: epidemiological and clinicopathological features. Cancer Sci. 2008;99(2):195‐201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Abdirad A, Ghaderi‐Sohi S, Shuyama K, et al. Epstein‐Barr virus associated gastric carcinoma: a report from Iran in the last four decades. Diagn Pathol. 2007;2:25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Faghihloo E, Saremi MR, Mahabadi M, Akbari H, Saberfar E. Prevalence and characteristics of Epstein‐Barr virus‐associated gastric cancer in Iran. Arch Iran Med. 2014;17(11):767‐770. [PubMed] [Google Scholar]
- 29. Gharibzadeh M, Jalilian S, Makvandi M, Seyedian SS, Azaran A. Molecular detection of Epstein‐Barr virus in paraffin‐embedded tissue samples of patients suffering gastric cancer in Ahvaz, Iran: a case–control study. Iran J Microbiol. 2024;16(5):689‐697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Böger C, Krüger S, Behrens HM, et al. Epstein‐Barr virus‐associated gastric cancer reveals intratumoral heterogeneity of PIK3CA mutations. Ann Oncol. 2017;28(5):1005‐1014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Lee MA, Hong YS, Kang JH, et al. Detection of Epstein‐Barr virus by PCR and expression of LMP1, p53, CD44 in gastric cancer. Korean J Intern Med. 2004;19(1):43‐47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. de Souza CRT, Almeida MCA, Khayat AS, et al. Association between Helicobacter pylori, Epstein‐Barr virus, human papillomavirus and gastric adenocarcinomas. World J Gastroenterol. 2018;24(43):4928‐4938. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Wanvimonsuk S, Thitiwanichpiwong P, Keelawat S, Mutirangura A, Kitkumthorn N. Distribution of the Epstein‐Barr virus in the normal stomach and gastric lesions in Thai population. J Med Virol. 2019;91(3):444‐449. [DOI] [PubMed] [Google Scholar]
- 34. Guo C, Wei J, Scott RS, et al. Prevalence and characteristics of Epstein‐Barr virus associated gastric carcinoma in Gansu Province, Northwest China with mRNA expression of glycoprotein BMRF2. J Med Virol. 2020;92(3):356‐363. [DOI] [PubMed] [Google Scholar]
- 35. Nogueira C, Mota M, Gradiz R, et al. Prevalence and characteristics of Epstein‐Barr virus‐associated gastric carcinomas in Portugal. Infect Agent Cancer. 2017;12:41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Chen K, Wang M, Zhang R, Li J. Detection of Epstein‐Barr virus encoded RNA in fixed cells and tissues using CRISPR/Cas‐mediated RCasFISH. Anal Biochem. 2021;625:114211. [DOI] [PubMed] [Google Scholar]
- 37. Joharinia N, Faghihinejad S, Seyedi K, et al. Co‐existing of HSV1/2 or EBV infection with the presence of high‐risk HPV DNA in cervical lesions in the southwest of Iran. Asian Pac J Cancer Prev. 2020;21(5):1459‐1464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Siciliano MC, Tornambè S, Cevenini G, et al. EBV persistence in gastric cancer cases conventionally classified as EBER‐ISH negative. Infect Agent Cancer. 2022;17(1):57. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Gaglia MM, Munger K. More than just oncogenes: mechanisms of tumorigenesis by human viruses. Curr Opin Virol. 2018;32:48‐59. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Sadeghi F, Mostaghimi T, Taheri M, et al. Investigating the role of Epstein‐Barr virus and human papillomavirus types 16 and 18 co‐infections in cervical disease of Iranian women. Front Oncol. 2024;14:1331862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Gulley ML, Tang W. Laboratory assays for Epstein‐Barr virus‐related disease. J Mol Diagn. 2008;10(4):279‐292. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394‐424. [DOI] [PubMed] [Google Scholar]
- 43. Moore A, Hikri E, Goshen‐Lago T, et al. Young‐onset gastric cancer and Epstein–Barr virus (EBV) – a major player in the pathogenesis? BMC Cancer. 2020;20(1):34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Jia X, Guo T, Li Z, et al. Clinicopathological and Immunomicroenvironment characteristics of Epstein–Barr virus‐associated gastric cancer in a Chinese population. Front Oncol. 2021;10:586752. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Osumi H, Kawachi H, Murai K, et al. Risk stratification for lymph node metastasis using Epstein–Barr virus status in submucosal invasive (pT1) gastric cancer without lymphovascular invasion: a multicenter observational study. Gastric Cancer. 2019;22:1176‐1182. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets generated during this study are available from the corresponding author upon reasonable request.