Protocol for development and use of spike-in control for chromatin immunoprecipitation of chromatin-binding proteins in Schizosaccharomyces pombe

Summary

Chromatin immunoprecipitation (ChIP) assays provide quantitative information about the genomic localization of chromatin-binding proteins; however, their sensitivity is limited by several technical variables. Here, we present a protocol for developing and using Saccharomyces cerevisiae chromatin as an exogenous spike-in control for ChIP of chromatin-binding proteins in Schizosaccharomyces pombe. We describe steps for preparing and validating the spike-in control. We then detail the procedure for adding spike-in control to S. pombe chromatin in ChIP assay and its use in data normalization.

For complete details on the use and execution of this protocol, please refer to Khanduja et al.¹

Graphical abstract

Highlights

• •Procedure for preparing and validating SIR3-FLAG exogenous spike-in control
• •Steps for adding spike-in control in the ChIP assay of S. pombe chromatin proteins
• •Guidance on ChIP data normalization using the exogenous spike-in control

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Chromatin immunoprecipitation (ChIP) assays provide quantitative information about the genomic localization of chromatin-binding proteins; however, their sensitivity is limited by several technical variables. Here, we present a protocol for developing and using Saccharomyces cerevisiae chromatin as an exogenous spike-in control for ChIP of chromatin-binding proteins in Schizosaccharomyces pombe. We describe steps for preparing and validating the spike-in control. We then detail the procedure for adding spike-in control to S. pombe chromatin in ChIP assay and its use in data normalization.

Before you begin

Chromatin immunoprecipitation (ChIP) is a powerful and widely used technique for detecting and quantifying the association of histone posttranslational modifications (PTMs) or specific proteins with different genomic regions in living cells. Considering the multi-step nature of the ChIP protocol several variables can be introduced. These variables can lead to inaccurate data interpretation, making data normalization an integral step of ChIP assays to ensure robust, reproducible, and biologically relevant results.

Analytical and spike-in control methods are two broad approaches for ChIP data normalization which help mitigate or eliminate technical biases or variations across samples. Analytical methods rely on internal features of the data (such as input DNA control) to adjust for variability and focus on computational and statistical approaches to normalize data without introducing external experimental controls.^2,3,4,5 On the other hand, spike-in controls add a known, distinct species-specific chromatin, chromatin from engineered cells, or synthetic DNA to the samples before IP. These provide an external reference for IP normalization to reduce or mitigate IP as a variable from the ChIP protocol.^6,7,8,9 The use of spike-in controls is especially important for the detection of low-frequency DNA-protein or -PTM interactions where signal to noise ratio is generally low.^7,9 An ideal spike-in control should have a similar chromatin structure as the experimental chromatin, its addition should not interfere with the IP of the target PTM or protein, and provide broad applicability.^7,9 Overall, spike-in controls allow for direct normalization to help reduce technical biases and support accurate cross-sample comparison under different experimental conditions.

Specifically, ChIP-Rx (ChIP with Reference exogenous genome) is a widely used and commercially available “spike-in” control for the ChIP of histone PTMs.⁸ Also, the Internal Standard Calibrated ChIP (ICeChIP) is another commercially available spike-in control for the ChIP of histone PTMs,⁶ where nucleosomes reconstituted from recombinant histones and barcoded DNA serve as the spike-in control. These spike-in controls take advantage of the highly conserved nature of histone PTMs across eukaryotes. Despite this, spike-in controls for the ChIP of chromatin-associated proteins are not available currently. This is mainly because chromatin-associated proteins are not highly conserved across eukaryotes, so an antibody generated against a chromatin-associated protein in one species often fails to interact robustly with its homolog in other organisms.

In recent years, the application of CRISPR technology has availed a range of new genome engineering tools for manipulating the metazoan genomes. These include the ability to add protein tags, such as FLAG, HA, GFP, GST, MYC, TAP, etc. to the C- or N-terminus of the protein of interest by inserting the tag sequence in-frame in the endogenous copies of the target gene. The availability of highly specific antibodies against the tags now has provided an opportunity to develop spike-in controls for the ChIP of chromatin-associated proteins in metazoans. To demonstrate this point, recently we used the chromatin from a S. cerevisiae strain expressing SIR3-FLAG from a plasmid as an exogenous FLAG spike-in control for the ChIP of FLAG-tagged heterochromatin proteins in S. pombe. SIR3 is a cerevisiae-specific protein which binds to the budding yeast silent chromatin regions. Moreover, the size of the heterochromatin in the two yeast species is roughly similar, thus providing a suitable control for our ChIP assays in S. pombe. By using primers against S. cerevisiae regions to which SIR3 binds, we were able to normalize IP efficiency across all ChIP samples. In this protocol, we provide details on the FLAG spike-in control preparation and its validation, ChIP of S. pombe heterochromatin proteins with the FLAG spike-in control, and ChIP-qPCR data normalization using the FLAG spike-in control.

Cell growth, yeast cell transformation, and pre-inoculum preparation for S. cerevisiae

Timing: 8–10 days

• 1.Streak S. cerevisiae strain from a glycerol stock stored in the −80°C freezer on a yeast extract, peptone with dextrose (YPD)-agar plate and incubate the plate at 30°C for 2–3 days until well-isolated single colonies appear.
• 2.Select a well-isolated colony and inoculate it in 7 mL of liquid YPD media in a tube and incubate it at 30°C on a roller drum for 12–16 h.
• 3.From this starter culture of S. cerevisiae, inoculate 100 mL of YPD media at a starting OD₆₀₀ of 0.01, and incubate the flask at 30°C while shaking at 200 rpm.
• 4.At OD₆₀₀ ∼0.6, remove the flask, spin down and wash the cells, and divide them into two equal cell pellets.
• 5.Using a standard protocol for the transformation of S. cerevisiae, transform one cell pellet with the SIR-3XFLAG expression plasmid (pDM832) and the other with the empty vector (pRS315).
• 6.Plate the transformed cells on Yeast SD-Leu (synthetic dropout minus leucine) agar plates and incubate the plates at 30°C for 3–4 days until well-isolated single colonies appear.
• 7.Select a well-isolated colony for each transformed strain and inoculate it in 7 mL of Yeast SD-Leu media to initiate the pre-cultures. Incubate the pre-cultures at 30°C on a roller drum for 12–16 h.

Cell growth and pre-inoculum preparation for S. pombe

Timing: 3–4 days

The following steps (steps 8 and 9) are adapted from Khanduja et al.¹⁰

• 8.Streak yeast strains from stocks stored in the −80°C freezer on yeast extract with adenine (YEA)-agar plates supplemented with appropriate antibiotics and incubate plates at 32°C for 2–3 days until well-isolated single colonies appear.
• 9.Select a well-isolated colony for each strain and inoculate it in 7 mL of liquid YEA media to initiate pre-cultures. Incubate at 32°C on a roller drum for 12–16 h.

Formaldehyde crosslinking of the SIR3-FLAG spike-in control

Timing: 1 day

• 10.
  Inoculation of cultures for crosslinking.

  • a.
    Measure the OD₆₀₀ of the pre-cultures and inoculate 400 mL of Yeast SD-Leu media at a starting OD₆₀₀ between 0.01 and 0.02.
  • b.
    Incubate the cultures for 12–14 h at 30°C while shaking at 200 rpm.

Note: Allow for at least 6–8 cell doublings in cultures. In our hands, the S. cerevisiae strain transformed with a plasmid carrying the auxotrophic selection marker had a doubling time of ∼2.5 3 h in SD-Leu media at 30°C. Ideally, the user should determine the doubling time of the S. cerevisiae strain transformed with the control or SIR3-3XFLAG plasmid and accordingly inoculate the cell cultures for crosslinking.

• 11.The next morning, measure the OD₆₀₀ of the cultures. At OD₆₀₀ ∼1.6, remove the cultures from the shaker and place them on an orbital shaker in a fume hood.
• 12.
  Crosslinking of chromatin.

  • a.
    Add 10.81 mL of 37% formaldehyde stock solution to 400 mL of the culture to achieve a final concentration of 1% formaldehyde in the cell cultures.
  • b.
    Incubate the flasks on an orbital shaker for 15 min while shaking at a low speed.

Stop the crosslinking reaction by adding 20 mL of 2.5 M glycine stock solution (final concentration of 125 mM glycine) in the cell cultures. Incubate the flasks on an orbital shaker for 5 min with shaking at a low speed.

• 13.
  Washing of cells and storage of cell pellets.

  • a.
    Transfer the cultures to two 200 mL centrifuge bottles and spin down the cells at 5524 rcf for 2 min at 4°C. Discard the supernatant in the fume hood in a biohazard container for formaldehyde disposal.
  • b.
    Add 20 mL of ice-cold 1× TBS to each bottle and mix by vortexing. Transfer the resuspended cells to 50 mL conical tubes and spin down the cells at 3000 rcf for 2 min at 4°C. Discard the supernatant.
  • c.
    Wash the pellets with 20 mL of ice-cold 1× TBS as in Step 13b.
  • d.
    Resuspend the cell pellets in 2 mL of ice-cold 1× TBS, transfer to pre-weighed and labeled 1.5 mL screw-cap conical tubes using a 1 mL micropipette.
  • e.
    Spin down the cells at 9402 rcf for 2 min at 4°C, remove the supernatant with a micropipette, weigh the tubes, and note the wet pellet weight.
  • f.
    Flash-freeze the cell pellets in liquid nitrogen and store them at −80°C for future use.

Double cross-linking for S. pombe cells for ChIP

Timing: 1 day

The following steps (steps 14–17) are adapted from Khanduja et al.¹⁰

• 14.
  Inoculation of cultures for cross-linking.

  • a.
    Measure the OD₆₀₀ of the pre-cultures and inoculate them in 100 mL of YEA media at a starting OD₆₀₀ between 0.01 and 0.02.
  • b.
    Incubate the cultures for 12–14 h at 32°C while shaking at 200 rpm.
• 15.
  Harvesting of cells for cross-linking of chromatin.

  • a.
    The next day, when the OD₆₀₀ of the cultures has reached 2.2 to 2.5, transfer the cells to pre-labeled 50 mL conical tubes and spin down the cells at 3000 rcf for 2 min at 25°C.
  • b.
    Discard the supernatant and drain the residual media by inverting the tubes on paper towels.
  • c.
    Add 15 mL 1× PBS (at 25°C) to the tubes and mix by gentle vortexing.
  • d.
    Spin down the cells at 3000 rcf for 2 min at 25°C and discard the supernatant.
  • e.
    Wash the cells once again with 15 mL 1× PBS and drain the residual liquid by inverting the tubes on paper towels.
• 16.
  Cross-linking of chromatin.

  • a.
    Add 4.6 mL of 1× PBS and resuspend the cells by gentle vortexing. At this step, the total volume of resuspended cells should be 6 mL.
  • b.
    Add 60 μL of 150 mM EGS stock solution (to achieve a final concentration of 1.5 mM of EGS) to the resuspended cells.
  • c.
    Incubate the tubes horizontally on an orbital shaker for 30 min with shaking at a low speed.
  • d.
    After 30 min, add 162 μL of 37% formaldehyde stock solution to a final concentration of 1% formaldehyde in the resuspended cells.
  • e.
    Incubate the tubes horizontally on an orbital shaker for 30 min with shaking at a low speed.
  • f.
    Add 265 μl of 2.5 M glycine stock solution (final concentration of 110 mM glycine) in the resuspended cells to stop the cross-linking reaction. Incubate the tubes horizontally on an orbital shaker for 5 min with shaking at a low speed.
• 17.
  Washing of cells and storage of cell pellets.

  • a.
    Spin down the cells at 3000 rcf for 2 min at 4°C and discard the supernatant in the fume hood in a biohazard container for formaldehyde disposal.
  • b.
    Add 20 mL of ice-cold 1× TBS to each tube, mix by vortexing, and spin down the cells at 3000 rcf for 2 min at 4°C. Discard the supernatant.
  • c.
    Wash the pellets again with 20 mL of ice-cold 1× TBS as in Step 17b.
  • d.
    Resuspend the cell pellets in 1 mL of ice-cold 1× TBS, transfer to a pre-weighed and labeled 1.5 mL screw-cap conical tubes using a 1 mL micropipette.
  • e.
    Spin down the cells at 9402 rcf for 2 min at 4°C, remove the supernatant with a micropipette, weigh the tubes, and note the wet pellet weight.
  • f.
    Flash-freeze the cell pellets in liquid nitrogen and store them at −80°C for future use.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Monoclonal anti-FLAG M2 antibody produced in mouse (use 1 μg antibody/120 μL cell lysate)	MilliporeSigma	F1804-1MG
Chemicals, peptides, and recombinant proteins
Trizma base	Sigma-Aldrich	T1503
Ethylenediaminetetraacetic acid disodium salt dihydrate	Sigma-Aldrich	E5134-500G
Sodium dodecyl sulfate	Sigma-Aldrich	L3771-500G
Lithium chloride	Sigma-Aldrich	62476-500G
Triton X-100	Sigma-Aldrich	X100-100ML
Sodium deoxycholate	Sigma-Aldrich	D6750-100G
Sodium chloride	Sigma-Aldrich	746398-1KG
HEPES	Sigma-Aldrich	H3375-500G
PMSF	Thermo Fisher Scientific	36978
Glycine	Sigma-Aldrich	G7126-5KG
Electron Microscopy Sciences formaldehyde 37% microfiltered	Fisher Scientific	50-980-485
Quick Start Bradford 1× dye reagent	Bio-Rad	500-0205
Yeast extract	Fisher Scientific	BP1422-2
Adenine	Sigma-Aldrich	A8626-100G
Bacto peptone	BD	211840
D-(+)-glucose	Sigma-Aldrich	G8270-1KG
EGS (ethylene glycol bis(succinimidyl succinate))	Thermo Scientific	21565
Glycogen	MilliporeSigma	10901393001
Proteinase K solution, RNA grade	Invitrogen	25530-049
cOmplete EDTA-free protease inhibitor	MilliporeSigma	5056489001
Ribonuclease A from bovine pancreas	MilliporeSigma	R4875-500MG
1 Kb Plus DNA ladder	Invitrogen	10787-018
Phenol:chloroform:isoamyl alcohol 25:24:1, saturated with 10 mM Tris pH 8.0 EDTA 1 mM	MilliporeSigma	P2069-100mL
Chloroform	Fisher Scientific	C298-500
Yeast synthetic drop-out medium supplements without leucine	Sigma-Aldrich	Y1376
Yeast nitrogen base without amino acids	BD Difco	BD-291920
Experimental models: Organisms/strains
S. pombe strains	Khanduja et al.1
S. cerevisiae strains	Khanduja et al.1
DMY3315 W303-1a SIR3Δ::KanR hmrΔE::TRP1 TELVII-L::URA3	Buchberger et al.11	N/A
Oligonucleotides
Primers	Khanduja et al.1
TEL (X-element) Forward 1 CGTACTTACACAGGCCATAC	Behrouzi et al 201612	N/A
TEL (X-element) Reverse 1 GTTTGAGCCACTACCGTATTA	Behrouzi et al 201612	N/A
TEL (X-element) Forward 2 CTTGTGGTAGCAACACTATCA	Behrouzi et al 201612	N/A
TEL (X-element) Reverse 2 GGCCTGTGTAAGTACGAAAT	Behrouzi et al 201612	N/A
CUP1 Forward CATGAGTGCCAATGCCAATG	Khanduja et al.1	N/A
CUP1 Reverse TTCAGACTTGTTACCGCAGG	Khanduja et al.1	N/A
Recombinant DNA
pDM832 (Sir3-3XFLAG under endogenous promoter in pRS315)	Buchberger et al.11	N/A
Other
1.5 mL microcentrifuge tubes without caps, polystyrene	Caplugs Evergreen	214-3721-010
Stopper caps for 11 mm tubes, natural	Caplugs Evergreen	300-2911-020
1.5 mL conical screw cap tube, natural	USA Scientific	1415-8700
Falcon 5 mL round bottom polypropylene tubes	Corning	352063
Falcon 50 mL polypropylene conical tubes	Corning	352070
0.5 mm diameter glass beads	BioSpec Products	11079105
BrandTech Brand 0.5 mL thin wall PCR tubes	Fisher Scientific	1388261
23G × 1 in BD PrecisionGlide needle	BD	305145
DNA LoBind tubes, 1.5 mL	Eppendorf	30108418
Fisherbrand disposable cuvettes	Fisher Scientific	14-955-127
Eppendorf centrifuge 5810R	Eppendorf	5811000015
MagNA lyser instrument	Roche	03-358-968-001
QSonica 800R1	Qsonica	Q800R1-110
Q Sonica chiller	Qsonica	#4905
Sample tube holder (8 slots)	Qsonica	#440
DynaMag-2 magnet	Thermo Fisher Scientific	12321D
Tube rotator	VWR	10136-084
Rotisserie plate assembly for thirty-six 1.5/2.0 mL tubes	VWR	13916-830
Eppendorf thermomixer 5350	Eppendorf	NA
NanoDrop 2000c spectrophotometer	Thermo Fisher Scientific	ND-2000

The following table is adapted from Khanduja et al.¹⁰

Materials and equipment

The following media and buffer recipes are adapted from Khanduja et al.¹⁰

YEA (yeast extract supplemented with adenine) media

Reagent (stock)	Amount
Yeast Extract	5 g
Glucose	20 g
Adenine	0.225 g
ddH2O	1 L

Autoclave and store at 25°C. This media can be used for up to 2 months if it is without visible contamination.

YPD (yeast extract, peptone, dextrose) media

Reagent (stock)	Amount
Yeast Extract	10 g
Peptone	20 g
Dextrose	20 g
ddH2O	1 L

Autoclave and store at 25°C. Take out the media from the autoclave immediately after the sterilization cycle to avoid the caramelization of glucose. This media can be used for up to 2 months if not discolored and is without visible contamination.

ChIP buffer

Reagent (stock)	Final concentration	Volume
HEPES.KOH pH 7.4 (1 M)	50 mM	2.5 mL
Sodium Chloride (5 M)	140 mM	1.4 mL
EDTA pH 8.0 (0.5 M)	10 mM	0.1 mL
Triton X-100 (20%)	1%	2.5 mL
Sodium Deoxycholate (10%)	0.1%	0.5 mL
Protease Inhibitor tablet (1 tablet in 1 mL of sterile water)	N/A	1 mL
Phenyl methyl Sulfonyl Fluoride (PMSF) (0.1 M)	1 mM	0.5 mL
ddH2O	N/A	41.5 mL
Total	N/A	50 mL

Make ChIP buffer fresh and keep it on ice throughout the experiment.

Caution: Add Protease Inhibitor and PMSF only to the volume of ChIP buffer to be used immediately at each step.

Elution buffer 1

Reagent (stock)	Final concentration	Volume
Tris.HCl pH 8.0 (1 M)	50 mM	50 μl
EDTA pH 8.0 (0.5 M)	10 mM	20 μl
Sodium Dodecyl Sulfate (SDS) (10%)	1%	100 μl
ddH2O	N/A	830 μl
Total	N/A	1 mL

Make fresh while the washing steps are in progress, and keep at 25°C.

Elution buffer 2

Reagent (stock)	Final concentration	Volume
Tris.HCl pH 8.0 (1 M)	10 mM	10 μl
EDTA pH 8.0 (0.5 M)	1 mM	2 μl
Sodium Dodecyl Sulfate (SDS) (10%)	0.68%	68 μl
ddH2O	N/A	920 μl
Total	N/A	1 mL

Make fresh while the washing steps are in progress and keep at 25°C.

Input buffer

Reagent (stock)	Final concentration	Volume
Tris.HCl pH 8.0 (1 M)	10 mM	10 μl
EDTA pH 8.0 (0.5 M)	1 mM	2 μl
Sodium Dodecyl Sulfate (SDS) (10%)	1%	100 μl
ddH2O	N/A	888 μl
Total	N/A	1 mL

Make fresh while elution from beads is in progress.

10× PBS

Reagent (stock)	Amount
Sodium Chloride	80 g
Potassium chloride	2 g
Disodium Hydrogen Phosphate	14.4 g
Potassium dihydrogen Phosphate	2.7 g
Water	900 mL

Adjust pH to 7.4 with HCl and bring up the final volume to one liter with water. Autoclave and store at 25°C. This solution can be stored at 25°C and used for one year.

Proteinase K-Glycogen mix

Reagent (stock)	Volume
Proteinase K (20 mg/mL)	20 μL
Glycogen (20 mg/mL)	12 μL
1× T.E.	968 μL

• •10× TBS - Dissolve 24 g Tris and 88 g NaCl in 900 mL of water. Adjust pH to 7.6 with HCl and bring up the final volume to one liter with water. Store at 25°C and can be used for six months or longer.

Step-by-step method details

SIR3-3XFLAG spike-in control ChIP and its validation

Timing: 2–3 days

Timing: 45 min (for step 1)

Timing: 1 h 30 min (for step 2)

Timing: 45 min (for step 3)

Timing: 40 min (for step 4)

Timing: 6 h (for step 5)

Timing: 15 h 30 min (for step 6)

Timing: 6 h 30 min (for step 7)

In this step, SIR3-3XFLAG spike-in control is prepared and validated (troubleshooting problems 1 and 2). Formaldehyde cross-linked S. cerevisiae cells were lysed using bead-beating followed by chromatin shearing in a circulating water bath cup-horn sonicator. Normalized sonicated cell lysates were used to ChIP SIR3-3XFLAG using a highly specific anti-FLAG antibody, followed by ChIP-qPCR based determination of SIR3-FLAG enrichment at its target locus.

The following steps (steps 1–7) are adapted from Khanduja et al.¹⁰

• 1.
  Cell lysate preparation for ChIP.

  • a.
    Remove the cross-linked cell pellets from −80°C freezer, thaw them at 25°C, and then place them on ice. Add 500 μL of freshly prepared ChIP buffer.

    CRITICAL: For efficient cell lysis by bead beating in 1.5 mL conical screw cap tubes on a MagNA Lyser the ideal cell pellet weight is 0.12–0.14 g.

  • b.
    Vortex the tubes to resuspend the cell pellets and then add 1 “scoop” of cold glass beads to each tube in the cold room.

    Note: Here, 1 scoop = 0.5 mL PCR tube full of glass beads.

  • c.
    Bead beat the cells at 6000 rpm for 30 s at 4°C in MagNA Lyser.
  • d.
    Remove the tubes from MagNA Lyser and place them on ice for 3 min.
  • e.
    Repeat steps 1c and 1d three more times. Remove the tubes from the MagNA Lyser and keep them on ice.

    Note: At this stage, fill chilled Milli Q water in the Q Sonica 800R1 water bath sonicator, switch on the attached circulating water chiller, and set the temperature on the chiller at 4°C.

  • f.
    Using a needle, punch a hole at the bottom of 1.5 mL conical screw cap tube containing the lysed cells and place it in a pre-chilled 5 mL polypropylene tube on ice. Repeat this for all the tubes, one at a time.
  • g.
    Spin the 5 mL tubes using the swing bucket rotor at 2500 rcf for 1 min at 4°C.
  • h.
    Remove the 5 mL tubes from the centrifuge and place them on ice. Discard the 1.5 mL screw-cap tubes.
  • i.
    Resuspend the cell lysate in the 5 mL tubes by gently pipetting with a P1000 micropipette, transfer the cell lysate to 1.5 mL pre-chilled polystyrene tubes on ice, and cap the tubes.
• 2.
  Chromatin shearing by sonication of cell lysates.

  • a.
    Load the 1.5 mL polystyrene sonication tubes in the 8-slot tube rack and attach the rack to the sonicator rack holder.
  • b.
    Attach the sonicator controller, power it on, and set sonication parameters as: Pulse on: 20 s; Pulse off: 40 s; Time: 30 min; Amplitude: 100%. Start the sonication cycle.
  • c.
    At the end of the sonication cycle, remove the tube rack from the sonicator and place the tubes on ice.
  • d.
    Spin the cell lysate in tubes at 17136 rcf/10 min/4°C. Transfer the supernatant from each tube into a pre-chilled Eppendorf tube on ice.
  • e.
    Spin the cell lysate in Eppendorf tubes at 17136 rcf /10 min/4°C and transfer the supernatant from each tube into a pre-chilled Eppendorf tube on ice.
• 3.
  Quantification of total protein in the sonicated cell lysates.

  • a.
    Make a 1:10 dilution of an aliquot of each sonicated cell lysate with water and transfer 2 μL of the diluted sonicated lysates to 1 mL cuvettes.
  • b.
    Add 1 mL of Bradford reagent to the cuvettes, mix the solution by gentle vortexing, and let them stand at 25°C for at least 3 min for the color to develop.
  • c.
    Measure protein concentration of sonicated cell lysates using Bradford’s Assay option on a NanoDrop spectrophotometer.
  • d.
    Normalize the protein concentration across the sonicated cell lysates and transfer 500 μL of each normalized lysate into a pre-chilled Eppendorf DNA LoBind tube on ice.
  • e.
    Aliquot 2% of each normalized cell lysate into a pre-chilled Eppendorf DNA LoBind tube on ice and label them as Input. Store the inputs at −20°C for reversal of cross-links later.
• 4.Washing and pre-equilibration of Protein G Dynabeads.
  Wash Protein G Dynabeads (or other beads suitable for the ChIP assay).

  • a.
    Take 40 μL of Protein G Dynabeads/sample in an Eppendorf tube and incubate it on a magnetic rack for 30 s.
  • b.
    Remove the supernatant with a P1000 micropipette, add 1 mL of ChIP buffer, cap the Eppendorf tubes, and incubate them on the tube rotator with rotation for 10 min at 4°C.
  • c.
    Remove the tubes from the tube rotator and place them in the magnetic rack for 30 s.
  • d.
    Remove the supernatant with a P1000 micropipette and wash the Protein G Dynabeads at least two more times with 1 mL of the ChIP buffer.
  • e.
    Resuspend the beads in the original bead volume of ChIP buffer and place the tubes on ice.
• 5.
  Chromatin immunoprecipitation using protein/epitope tag-specific antibody.

  • a.
    Pre-Clearing.
    Pre-clear each lysate by adding 10 μL of pre-equilibrated Protein G Dynabeads and incubating the Eppendorf tubes on a tube rotator with rotation for 1 h at 4°C in a cold room.
  • b.
    Immunoprecipitation.

    • i.
      Briefly spin the Eppendorf tubes in a mini microfuge and place the tubes in a magnetic rack for 30 s to collect the Protein G magnetic beads.
    • ii.
      Carefully remove the supernatant from each tube into a pre-chilled Eppendorf DNA LoBind tube on ice and add 4 μg of anti-FLAG antibody to each.
    • iii.
      Incubate the Eppendorf tubes on a tube rotator with rotation for 1 h at 4°C in a cold room.
    • iv.
      Add 30 μL of pre-equilibrated Protein G Dynabeads to each Eppendorf tube and further incubate them on a tube rotator with rotation for 2 h at 4°C in a cold room.
  • c.
    Washing.

    • i.
      Briefly spin the Eppendorf tubes in a mini microfuge and place the tubes in a magnetic rack for 30 s to collect the Protein G magnetic beads.
    • ii.
      Carefully remove the supernatant, add 1 mL of ice-cold ChIP buffer to each Eppendorf tube, and incubate them on a tube rotator with rotation for 5 min at 4°C in a cold room.
    • iii.
      Repeat step 5c (i) above and remove supernatant.
    • iv.
      Add 1 mL of ice-cold ChIP buffer to each Eppendorf tube, gently resuspend the beads with a P1000 micropipette, and transfer them to new pre-chilled Eppendorf DNA LoBind tubes on ice. Incubate the Eppendorf tubes on a tube rotator with rotation for 5 min at 4°C in a cold room.
    • v.
      Repeat step 5c (iii), followed by washing one more time with ice-cold ChIP buffer and removing supernatant as in step 5c (iii).
    • vi.
      Add 1 mL of ice-cold 1× T.E. buffer to each Eppendorf tube and incubate them on a tube rotator with rotation for 5 min at 4°C in a cold room.
    • vii.
      Spin and remove supernatant (see step 5c (iii) above).
    • viii.
      Add 1 mL of ice-cold 1× T.E. buffer to each Eppendorf tube, gently resuspend the beads with a P1000 micropipette, and transfer them to new pre-chilled Eppendorf DNA LoBind tubes on ice.
    • ix.
      Incubate the Eppendorf tubes on a tube rotator with rotation for 5 min at 4°C in a cold room.
    • x.
      Repeat step 5c (iii) and keep the Eppendorf tubes on a tube rack at 25°C.
  • d.
    Elution.

    • i.
      Add 100 μL of pre-warmed Elution buffer 1 to each tube, gently resuspend the beads and incubate them at 65°C in a thermomixer with shaking at 1000 rpm for 15 min.
    • ii.
      Briefly spin the Eppendorf tubes in a mini microfuge and place them in a magnetic rack for 30 s to collect the Protein G magnetic beads.
    • iii.
      Transfer the supernatant to new pre-labeled Eppendorf DNA LoBind tubes at 25°C and label them as Elution 1.
    • iv.
      Add 150 μL of pre-warmed Elution buffer 2 to each Eppendorf tube with Protein G beads, gently resuspend the beads and incubate them at 65°C in a thermomixer with shaking at 1000 rpm for 5 min.
    • v.
      Repeat step 5d (ii) and then transfer the supernatant from each Eppendorf tube to the corresponding Eppendorf tubes containing Elution 1 for each sample.
    • vi.
      Remove the ChIP Inputs from −20°C freezer (from Step 3e) and add 240 μL of Input Buffer to each tube. Mix by vortexing briefly.

      Pause point: The protocol can be paused at this point and samples can be stored at −80°C/−40°C.

• 6.
  Reversal of cross-links and degradation of RNAs and proteins in the ChIP inputs and elutions

  • a.
    Incubate the ChIP Elutions and Inputs, from steps 5d (v) and 5d (vi) respectively, 12–14 h at 65°C in a thermomixer with shaking at 1000 rpm.
  • b.
    Remove the Eppendorf tubes from the thermomixer, briefly spin the tubes in a mini microfuge and place them on a tube rack at 25°C.
  • c.
    Add 50 μg of RNase A to each Eppendorf tube, mix gently and incubate them at 37°C for 1 h. After incubation, briefly spin the Eppendorf tubes in a mini microfuge and place them on a tube rack at 25°C.
  • d.
    Add 258 μL of Proteinase K-Glycogen mix to each Eppendorf tube, gently vortex, and incubate the samples at 55°C in a thermomixer with shaking at 1000 rpm for 2 h.
  • e.
    Briefly spin the Eppendorf tubes in a mini microfuge and place them on a tube rack at 25°C.

Pause point: The protocol can be paused at this point, and samples can be stored at −40°C.

• 7.
  Purification of ChIP DNA.

  • a.
    Phenol-Chloroform Extractions.

    • i.
      Add 500 μL of phenol-chloroform-isoamyl alcohol mix (25:24:1) to each Eppendorf tube and mix well.
    • ii.
      Spin the Eppendorf tubes in a centrifuge at 19357 rcf for 12 min at 25°C. Transfer the supernatant from each tube into a pre-labeled new Eppendorf DNA LoBind tube.

      Note: Do not disturb the interface while pipetting out the aqueous phase. We generally recover 450–460 μL of aqueous solution at this step.

    • iii.
      Add 450 μL of chloroform to each Eppendorf tube and mix well.
    • iv.
      Spin the Eppendorf tubes in a centrifuge at 19357 rcf for 12 min at 25°C. Transfer the supernatant from each Eppendorf tube into a pre-labeled new Eppendorf DNA LoBind tube.
  • b.
    Ethanol Precipitation of ChIP DNA.

    • i.
      Add 50 μL of 4 M LiCl solution and 960 μL of chilled 100% Ethanol to each Eppendorf tube. Mix well and then incubate the tubes at −40°C for at least 2 h.

      Pause point: The protocol can be paused at this point and samples can be stored at −80°C/−40°C.

    • ii.
      Remove the Eppendorf tubes from the −40°C freezer and spin them at 19357 rcf for 15 min at 4°C.
    • iii.
      Remove the supernatant with a P1000 micropipette.
    • iv.
      Add 500 μL of 70% Ethanol to each Eppendorf tube, gently tap them, and spin them at 19357 rcf for 15 min at 4°C.
    • v.
      Remove the supernatant with a P200 micropipette, without disturbing the DNA pellet, and discard it.
    • vi.
      Dry the DNA pellets by keeping the Eppendorf tubes open in a tube rack at 37°C for 30 min.
    • vii.
      Resuspend the ChIP DNA pellets in 40 μL of 0.1× T.E. buffer and the Input DNA in 50 μL of 0.1× T.E. buffer.
    • viii.
      Incubate the Eppendorf tubes at 37°C for 1 h on a thermomixer with shaking at 1000 rpm.
    • ix.
      Remove the tubes from the thermomixer, briefly spin them in a mini microfuge, and store the resuspended DNA at −80°C/−40°C for downstream applications.
• 8.Validate the ChIP using qPCR assay with primers designed to calculate % IP enrichment of SIR3-3XFLAG at its target loci (telomeres, TEL) and a negative control locus in euchromatin (CUP1).

ChIP of S. Pombe chromatin binding proteins with FLAG spike-in control

Timing: 2–3 days

In this step, sonicated chromatin prepared from S. cerevisiae cells carrying the SIR3-3XFLAG plasmid is added as the FLAG spike-in control for the ChIP of 3XFLAG-tagged heterochromatin proteins in S. pombe.

• 9.S. pombe cell lysate preparation, chromatin shearing by sonication, and quantification of total proteins in the cell lysate.

Follow steps 1a–3d under “step-by-step method details” to obtain a normalized cell lysate concentration for each ChIP sample.

• 10.Addition of the FLAG spike-in control troubleshooting- problem 3.

Add 150 μL of the FLAG spike-in control (chromatin prepared from S. cerevisiae cells carrying the SIR3-3XFLAG plasmid) to each tube.

Note: We use 500 μL of normalized sonicated S. pombe cell lysate for each ChIP.

Note: For robust detection of the spike-in control using ChIP-qPCR, add 150 μL of 335 ng/μL SIR3-FLAG spike-in chromatin (Total-50 μg of spike-in chromatin) to each sample. The spike-in chromatin corresponds to 25% of total chromatin/sample in a ChIP assay for chromatin binding proteins. For ChIP-seq based detection, the total amount of spike-in chromatin can be reduced by 2–3 fold; however, the users need to determine this empirically.

CRITICAL: Add the same volume of FLAG spike-in control to each tube. The spike-in control should come from the same batch of chromatin prepared from S. cerevisiae cells carrying the SIR3-3XFLAG plasmid. Any variation in the amount, batch, or quality of spike-in control could lead to biases in data normalization.

• 11.Incubate the Eppendorf tubes on a tube rotator for 5 min at 4°C in a cold room.
• 12.Save 2% (13 μL) of each normalized cell lysate containing the FLAG spike-in control in a pre-chilled Eppendorf DNA LoBind tube on ice and label them as Input. Store the Inputs at −20°C until the ChIP samples are ready for crosslinking reversal.
• 13.Washing and pre-equilibration of Protein G Dynabeads for the ChIP assay.

Follow step 4 under “step-by-step method details” except that take 52 μL (13 μL for pre- clearing + 39 μL for immunoprecipitation steps) of Protein G Dynabeads/sample.

Note: For 8 different samples, we will need 416 μL of Protein G Dynabeads. However, we start with Protein G Dynabeads for 9 reactions (468 μL), to account for any loss during washing and pipetting.

• 14.
  Chromatin immunoprecipitation using epitope tag-specific antibody.

  • a.
    Pre-clearing.
    Pre-clear each lysate by adding 13 μL of pre-equilibrated Protein G Dynabeads and incubating the Eppendorf tubes on a tube rotator with rotation for 1 h at 4°C in a cold room.

    Note: The monoclonal anti-FLAG M2 antibody produced in mouse has a higher affinity for Protein G. However, users must select the appropriate Protein G or Protein A or Protein G/A beads depending on the antibody used for immunoprecipitation.

  • b.
    Immunoprecipitation.
    Follow steps 5b (i-iv) under “step-by-step method details” except that in step 5b (ii) add 5.2 μg of anti-FLAG antibody to each tube and in step 5b (iv) add 39 μL of Protein G Dynabeads to each tube.
  • c.
    Washing and Elution.
    Follow steps 5c and 5d under “step-by-step method details”.
• 15.Reversal of Crosslinks, Purification and ethanol precipitation of ChIP DNA.

Follow steps 6 and 7 under “step-by-step method details”.

ChIP-qPCR data normalization using the FLAG spike-in control

Timing: 1 day

In this step, the IP efficiency of the FLAG spike-in control in each sample is calculated and is used to normalize the ChIP enrichment of the S. pombe heterochromatin protein at the target loci in the corresponding samples.

• 16.
  Use qPCR to calculate the ChIP % IP value for the spike-in control enrichment at the target locus and at a negative control locus in each sample in an experiment.

  • a.
    Equation to calculate % IP value for the spike-in control enrichment at the target locus (here, telomere X element in heterochromatin in S. cerevisiae):

    • (2^∧ (-Ct value of SIR3-FLAG IP)/2^∧ (-Ct value of SIR3-FLAG Input))∗100
  • b.
    Equation to calculate % IP value for the spike-in control enrichment at the control locus (here, CUP1 in euchromatin in S. cerevisiae): (2^∧ (-Ct value of SIR3-FLAG IP)/2^∧ (-Ct value of SIR3-FLAG Input))∗100.
• 17.Calculate the normalization factor as:

$$\text{Normalization}\text{factor}=(\%\text{IP}\text{value}\text{for}\text{the}\text{spike}\text{-}\text{in}\text{control}\text{enrichment}\text{at}\text{the}\text{target}\text{locus}\text{in}S.cerevisiae)-(\%\text{IP}\text{value}\text{for}\text{the}\text{spike}\text{-}\text{in}\text{control}\text{enrichment}\text{at}\text{the}\text{control}\text{locus}\text{in}S.cerevisiae)$$

• 18.For each sample, calculate the ChIP enrichment (% IP) of the protein of interest (Protein X) at the genome region of interest as:

$$\%\text{IP}\text{of}\text{protein}\text{of}\text{interest}\left(\text{Protein}\mathrm{X}\text{in}S.pombe\right)=\left(2^{\wedge }\left(-\text{Ct}\text{value}\text{of}\text{Protein}\mathrm{X}\text{IP}\right)/2^{\wedge }\left(-\text{Ct}\text{value}\text{of}\text{Protein}\mathrm{X}\text{Input}\right)\right)\ast 100$$

• 19.For each sample, normalize the ChIP enrichment (% IP) of the protein of interest (Protein X) at the target locus in S. pombe to the normalization factor calculated in step 17 above.

$$\text{Normalized}\text{ChIP}\text{enrichment}\text{of}\text{Protein}\text{of}\text{Interest}\text{in}S.pombe\left(\text{Protein}\mathrm{X},\%\text{IP}\right)=\%\text{IP}\text{of}\text{protein}\text{of}\text{interest}\left(\text{Protein}\mathrm{X}\text{in}S.pombe\right)/\text{Normalization}\text{Factor}$$

Expected outcomes

A validated spike-in control in ChIP assays provides an external reference for data normalization and reproducible detection of low-level ChIP signal enrichment across different mutant backgrounds or experimental conditions. Given the modest Clr4 signal enrichment at pericentromeric repeats in cells lacking H3K9me and sRNAs, we developed a FLAG spike-in control to normalize immunoprecipitation efficiency across all ChIP samples. We first tested the efficiency of the anti-FLAG antibody to ChIP SIR3-FLAG. Consistent with a previous study,¹³ we found that SIR3-FLAG was efficiently immunoprecipitated and primarily bound telomeric DNA sequences in S. cerevisiae (Figures 1A–1C).

Figure 1.

S. cerevisiae SIR3 is enriched at the telomeres

Graph depicting Sir3 ChIP-qPCR (mean percent IP) at TEL (X element) (A and B) and control CUP1 gene (C). Error bars - S.E.; n=2 biological replicates.

Using SIR3-FLAG-containing S. cerevisiae chromatin as the FLAG spike-in control, we observed consistent, low-level de novo enrichment of Clr4 at SPNCRNA.230 in cells lacking small RNAs and HDACs (sir2Δ clr3Δ ago1Δ) (Figure 2A). Similarly, reintroducing wild-type clr4 or the catalytic mutant clr4 (clr4.H410D.C412A) into the clr4Δ ago1Δ strain led to de novo enrichment at SPNCRNA.230 (Figure 2B). In contrast, the catalytic mutant clr4 (clr4.H410D.C412A) did not spread on pericentromeric repeats, unlike wild-type clr4 (Figures 2C–2E). The SIR3-FLAG-IP efficiency in the various mutant strains was comparable to that in the wild-type cells (Figure 2F). This confirmed our approach for normalizing the Clr4 ChIP signal using the FLAG spike-in control, ensuring reproducible detection of low-level Clr4 enrichment in the mutants.

Figure 2.

SPNCRNA.230 can recruit Clr4 de novo and its spreading on chromatin requires its read-write activities

(A) Graph depicting 3XFLAG-Clr4 ChIP-qPCR (mean percent IP) at SPNCRNA.230 in the indicated strains. ‘sir2Δ clr3Δ clr4Δ → clr4+’ denotes a sir2Δ clr3Δ ago1Δ clr4Δ strain into which clr4+ was reintroduced by transformation. The 3XFLAG-Clr4 ChIP-qPCR signals in the indicated strains were normalized to the S. cerevisiae SIR3-3XFLAG signal (FLAG spike-in control). Error bars - S.D.; n=4 biological replicates.

(B–E) Graphs depicting 3XFLAG-Clr4 ChIP-qPCR (mean percent IP) at SPNCRNA.230 (B), 174 bp downstream from the annotated end (on the sense strand) of SPNCRNA.230 (C), dh (D), and dg (E) sequences in the indicated strains. clr4Δ::3xflag was used as background control. The 3XFLAG-Clr4 ChIP-qPCR signals in the indicated strains were normalized to the S. cerevisiae SIR3-3XFLAG signal (FLAG spike-in control). Error bars - S.D.; n=4 biological replicates.

(F) Graphs depicting the SIR3-3XFLAG ChIP-qPCR mean fold change (percent IP) at the TEL X element found in the S. cerevisiae telomeres. The specific SIR3 enrichment at the TEL X element was calculated relative to the SIR3 signal at the control euchromatic CUP1 gene. The telomeric TEL X element and CUP1 gene primers do not show significant homology to the S. pombe genome. Error bars - S.D.; n=4 biological replicates. ^∧- indicates catalytically inactive version of clr4 (clr4.H410D.C412A). § indicates strain in which clr4+ was reintroduced by yeast genetic crosses. # indicates strain in which clr4.H410D.C412A allele was introduced by yeast genetic crosses. For panels A–E, Statistical significance was determined using a two-tailed unpaired Student’s t-test. For panel F, Statistical significance was determined using ordinary one-way ANOVA with multiple comparisons. ns p >0.05; ∗p <0.05; ∗∗p <0.01; ∗∗∗p <0.001; ∗∗∗∗p <0.0001. In panels A-F, data was reused for figures with permission from Khanduja J.S. et al.¹ The data for clr4Δ::3xflag, wild-type, and ago1Δ controls in panel A have also been used in panel B.

Additionally, using the FLAG spike-in control in a ChIP of Sir2 (an H3K9 deacetylase) from hydroxyurea-synchronized cells, the normalized ChIP signal showed reproducible, low-level enrichment of Sir2 on pericentromeric repeats during the S-phase of the cell cycle (Figures 3A and 3B).

Figure 3.

S. pombe Sir2 is enriched at the pericentromeres during S-phase of the cell cycle

Graph depicting Sir2-3XFLAG ChIP-qPCR (mean percent IP) at SPNCRNA.230 (A) and a dh sequence (B) from S-phase cells synchronized by HU block and release and asynchronous cells (Unsync). sir2Δ::3xflag was used as FLAG background control. The Sir2-FLAG ChIP-qPCR signals in the indicated strains were normalized to the S. cerevisiae SIR3-3XFLAG signal (FLAG spike-in control). Error bars - S.D.; n=3 biological replicates. Statistical significance was determined using a two-tailed unpaired Student’s t-test. ns p >0.05; ∗p <0.05; ∗∗p <0.01; ∗∗∗∗p <0.0001. In panels A and B, data was reused for figures with permission from Khanduja J.S. et al.¹.

Quantification and statistical analysis

The statistical significance of the qPCR data was determined using a two-tailed unpaired Student’s t-test in GraphPad Prism Version 8.3.0 (538). n represents the number of biological replicates and error bars show standard deviation (SD). The statistical significance was determined using GraphPad Prism Version 8.3.0, where, ∗p <0.05; ∗∗∗p <0.001; ∗∗∗∗p <0.0001.

Limitations

We developed and used the FLAG spike-in control to normalize the IP efficiency in the ChIP assay of FLAG-tagged S. Pombe heterochromatin proteins in different mutant backgrounds, where we anticipated low to moderate enrichment of these proteins on the chromatin (troubleshooting- problem 4). This FLAG spike-in control was ideal for our study as both the SIR3 protein of the FLAG spike-in control and S. pombe proteins of our interest bind to heterochromatin (a repressed chromatin domain) sequences in the genome, and the size of the heterochromatin in the two evolutionary divergent yeast species is comparable.

This FLAG spike-in control is not suitable for a ChIP assay where the protein of interest in the target chromatin is not FLAG-tagged. Moreover, users should comprehensively evaluate the suitability of our FLAG spike-in control for use in the ChIP of euchromatin-associated factors.

Our protocol for cell lysis and chromatin fragmentation to make the FLAG spike-in control is identical to the protocol we use for S. pombe cell lysis and chromatin fragmentation for the ChIP of heterochromatin proteins of our interest. Any variation of the cell lysis and sonication procedure for preparing the FLAG spike-in control could affect its IP efficiency and, in turn, its effectiveness as a spike-in control.

Troubleshooting

Problem 1

Inefficient incorporation of spike-in control in sample chromatin due to species-specific differences.

The spike-in control from the chromatin of a different species may not be efficiently incorporated in the IP reaction due to differences in chromatin structure (open versus close chromatin) impacting antibody binding efficacy and consequently leading to a biased spike-in based normalization.

Potential solution

Confirm that the spike-in control is efficiently co-precipitated by the antibody used in the IP step. In case of variable IP of the spike-in control, use spike-in control from a different source or use synthetic DNA spike-ins which do not interfere with IP of sample chromatin and have no chromatin structure related issues.

Problem 2

Inconsistent immunoprecipitation efficiency.

Differences in chromatin preparation and sample handling my lead to variation in IP efficiency of test chromatin and spike-in control, which in turn, can distort the spike-in based normalization.

Potential solution

Optimize the IP protocol to achieve equally high IP efficiency for both the test chromatin and spike-in control in the same tube.

Problem 3

Inconsistent spike-in DNA quantification.

Inconsistent quantification of spike-in DNA can also lead to incorrect normalization.

Potential solution

Ensure that the amount of spike-in control added is consistent across all the samples in an experiment. Moreover, use the spike-in control from the same batch for all the biological replicates of an experiment.

Problem 4

Spike-in control does not address all potential biases in ChIP data.

Spike-in controls can address the biases that arise from variability in IP and for sequencing depth in a ChIP-seq experiment. However, they do not address issues that might arise due to GC content variation, chromatin fragmentation, and accessibility biases.

Potential solution

In these situations, use a comprehensive ChIP data normalization strategy that combines the use of spike-in controls and analytical methods (such as quantile normalization and GC bias correction) for robust analysis.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Mo Motamedi (mmotamedi@hms.harvard.edu).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Jasbeer S. Khanduja (jsk.acad1@gmail.com).

Materials availability

This study generated new unique reagents.

Data and code availability

This study did not generate new datasets or code.

Acknowledgments

This work was supported by the National Institutes of Health grant (GM125782), American Cancer Society Research Scholar Grant (18-056-01-RMC), V Scholar grant, and Ludwig Center at Harvard grant to M.M.

Author contributions

J.S.K.: protocol development, optimization, experimentation and data analysis, manuscript conceptualization, writing, editing, and final approval. M.M.: supervision, funding, manuscript conceptualization, editing, and final approval.

Declaration of interests

M.M. and J.S.K. have a pending US provisional patent application related to the data from this paper.