Abstract
Mitochondrial DNA (mtDNA) methylation may be associated with mitochondrial damage; this study investigates their relationship in contrast-induced renal tubular epithelial cell (RTEC) injury. We stimulated HK-2 cells with iohexol to establish an in vitro model and analyzed the methylation level of mtDNA by bisulfite amplicon sequencing. The mitochondrial membrane potential, mitochondrial reactive oxygen species (mtROS), intracellular ROS, and changes in mitochondrial ultrastructure were evaluated as indicators of mitochondrial damage. Iohexol significantly inhibited cell viability and induced cell apoptosis, increasing both mtROS and intracellular ROS levels. Additionally, the methylation levels of mtDNA-encoded genes cytochrome c oxidase subunit I (COX I) (3.09%, *p < 0.05), cytochrome c oxidase subunit II (COX II) (4.51%, **p < 0.01), cytochrome c oxidase subunit III (COX III) (3.50%, **p < 0.01) and cytochrome B (CYTB)(4.66%, *p < 0.05) were increased, accompanied by enhanced transcription of both COX I and COX III. 5-Aza-dC, as a DNA methylation inhibitor, was dissolved in dimethyl sulfoxide (DMSO) vehicle to explore the role and mechanism of inhibiting mtDNA methylation in contrast-induced RTEC injury. HK-2 cells were further divided into four groups: vehicle control (DMSO alone), vehicle pretreated contrast - induced group (CI) (DMSO-CI), inhibitor control (5-Aza-dC), and inhibitor pretreated CI (5-Aza-dC-CI). Intriguingly, administration of 5-Aza-dC effectively attenuated mtDNA methylation, leading to improvements in these parameters and restoration of cell viability while reducing apoptosis. In conclusion, mtDNA methylation is involved in the mechanism of contrast-induced RTEC injury, potentially mediated by over-transcription of COX I and III, abnormal mtROS production, and subsequent mitochondrial damage and dysfunction. Inhibiting mtDNA methylation can provide protective effects against contrast - induced RTEC injury by reducing ROS (mtROS) production.
Keywords: Mitochondrial DNA methylation, CI-AKI, mitochondrial damage, ROS, apoptosis
Graphical abstract

1. Introduction
Contrast-induced acute kidney injury (CI-AKI) is a hospital-acquired acute kidney injury, frequently observed as a complication of coronary angiography and percutaneous coronary intervention [1–3]. The incidence of CI-AKI is intimately connected with risk factors such as patients’ clinical characteristics, contrast medium (CM) dosage, and administration route [3,4]. Therefore, the incidence exhibits significant variation, with a low occurrence rate (<2%) in the general population and exceeding 50% in high-risk patients [5,6]. The pathogenesis underlying CI-AKI is extremely intricate, and the prevailing views emphasize that it is related to the cytotoxic effects of CM and the direct or indirect consequences of hemodynamic disturbances, ultimately resulting in mitochondrial dysfunction, heightened oxidative stress, and subsequent cellular injury/apoptosis in renal tubular epithelial cell(s) (RTEC(s)) [7,8]. However, the specific mechanisms have not been fully elucidated, and there is currently no effective treatment for CI-AKI.
Mitochondrial DNA (mtDNA) is a circular, double-stranded DNA molecule that exists independently of the nuclear genome [9]. The coding region contains 37 genes, 13 of which are responsible for encoding the protein complex subunits of the electron transport chain, involved in mitochondrial oxidative phosphorylation (OXPHOS) [10,11]. Like nuclear DNA methylation, mtDNA can also undergo methylation modification catalyzed by DNA methyltransferases (DNMTs) [10,12,13], that is, mtDNA methylation.
Numerous studies have observed that mtDNA methylation plays a significant role in various diseases characterized by mitochondrial dysfunction, including cancer [14–16], Alzheimer’s disease [17], nonalcoholic fatty liver disease [18], and diabetic retinopathy [19] among others [11]. However, the study of mtDNA methylation in the field of kidney disease, particularly acute kidney injury, is still insufficient information. We thus hypothesized that mtDNA methylation is the key molecular mechanism underlying contrast-induced RTEC injury. Specifically, sustained CM stimulation may trigger methylation modification of mtDNA in RTECs, thereby affecting the transcriptional activity of related mtDNA protein-coding genes, subsequently inducing mitochondrial dysfunction, and exacerbating oxidative stress, ultimately leading to apoptosis. This study aims to determine whether mtDNA methylation is involved in contrast-induced RTEC injury and elucidate the underlying mechanism, to provide a novel therapeutic target for CI-AKI.
2. Material and methods
2.1. Cell culture and treatment
Human renal tubular epithelial cells (HK-2) (CL-0109, Pricella, Wuhan, China) were cultured in DMEM-F12 (6123041, Gibco) medium containing 5% fetal bovine serum (10099-141, Gibco) and 1% Penicillin-streptomycin double antibody (XQ-CC004, Sin-troch, China), and they were cultured at 37 °C with 5% CO2. In the first part of the experiment, after the HK-2 cells were starved, they were divided into the control (CON) group and CM - stimulated groups (contrast - induced group (CI) 6 h, 12 h, and 24h). Iohexol (H10970324, Yangtze River Pharmaceutical Group Co., Ltd, Jiangsu, China), an iodinated CM, was used to incubate HK-2 cells at a concentration of 100 mg I/mL based on previous work [20], for 6, 12, and 24 h. In the second part of the experiment, HK-2 cells were further divided into four groups: vehicle control (DMSO), vehicle pretreated CI (DMSO-CI), inhibitor control (5-Aza-dC), and inhibitor pretreated CI (5-Aza-dC-CI) group. 5-Aza-2′-deoxycytidine (5-Aza-dC) (A3656, Sigma-Aldrich, USA), a DNA methylation inhibitor, was dissolved in dimethyl sulfoxide (DMSO) to prepare a 10 mM stock solution. In these groups, the cells were pretreated with either DMSO or 5-Aza-dC (1 μM) for 1 h before iohexol treatment or replacement with normal culture medium. The final concentration of DMSO (D8371, Solarbio, Beijing, China) was 0.01%.
2.2. Cell viability assay and analysis of apoptotic cells
Cell viability was detected by the CCK-8 Assay Kit (CK04, Dojindo, Japan). HK-2 cells were inoculated in 96-well plates at a density of 1 × 104cells/well. The supernatant was discarded, and the 96-well plates were replenished with a new medium containing10μL of CCK-8 reagent per well. After three hours of incubation at 37 °C and 5% CO2, these samples were taken to measure absorbance at 450 nm by a ALLSHENG Microplate reader (FlexA-200HT). The Annexin V-FITC/PI Apoptosis Detection Kit (CA1020-100, Solarbio Life Sciences, China) was used to assess cell apoptosis by flow cytometry. After drug stimulation, the cells were resuspended with 1 × Binding Buffer. The cells suspension was incubated with 5 μL Annexin V-FITC for 5 min. Finally, the cells mixture was supplemented with 5 µL PI and 400 µL PBS and then immediately monitored by flow cytometer (Beckman Coulter).
2.3. DNA methylation analysis by bisulfite amplicon sequencing
Bisulfite amplicon sequencing (BSAS) was performed by Shanghai Biowing Applied Biotechnology Co. Ltd (China). MtDNA isolated from the samples was bisulfite-treated by using EpiTect Bisulfite Kits (59104, Qiagen) according to the manufacturer’s instruction. After bisulfite treatment, the target fragment was amplified by multiplex PCR. We sequenced the bisulfite-PCR products were applied to sequence on Illumina NovaSeq second-generation sequencing platform. Methylation degree analysis was conducted utilizing Bismark (v0.15.0), samtools, and the R package methylKit (v 0.9.5) [21–23]. The sequences of primers are listed in Supplementary Table S1.
2.4. Mitochondrial membrane potential assessment
JC-1 kit (C2006, Beyotime, China) was used to visualize mitochondrial membrane potential (MMP). According to the manufacturer’s protocol, HK-2 cells were washed with PBS and then stained with the JC-1 probe for 20 min at 37 °C/5%CO2 in the dark. Subsequently, cells were washed with cold JC-1 staining buffer to remove free probes. Finally, images were captured with Nikon ECLIPSE Ts2 inverted fluorescence microscope. MMP is expressed as the ratio of the red/green fluorescence intensity of the JC-1 dye.
2.5. Intracellular and mitochondrial reactive oxygen species (ROS) levels determination
HK-2 cells were divided into corresponding groups and treated with reactive oxygen species assay kit (S0033S, Beyotime, China) to assess intracellular ROS levels and MitoSOX Red dye (M36007, Invitrogen, USA) to measure mitochondrial ROS (mtROS) levels. In brief, HK-2cells were incubated with DCFH-DA (10 μM) or MitoSOX (1 μM) for 15 min, or 30 min at 37 °C in the dark, and fluorescence was measured using an inverted fluorescence microscope (Nikon ECLIPSE Ts2) or an Olympus biological microscope (BX53F2C). Then, the fluorescence intensity was analyzed using Image J software.
2.6. Real-time PCR (qPCR)
According to the manufacturer’s instructions, HK-2 cells were processed for total RNA extraction using MolPure® Cell/Tissue Total RNA Kit (19221ES50, Yeasen Biotechnology (Shanghai) Co., Ltd. China). PrimeScript™ RT reagent Kit (RR047A) was used for reverse transcription into cDNA, followed by real-time PCR (qPCR) using TB Green® Premix Ex Taq™ II (RR820A) to quantify gene expression. Both kits were purchased from Takara Biomedical Technology (Beijing) Co., Ltd.). The reaction was performed in QuantStudio TM3 Real-Time PCR system (Thermo Fisher Scientific Inc., USA). The mRNA levels of the target genes were normalized to glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) levels and analyzed using the 2^−ΔΔCt method. Specific primers sequences can be found in Table 1.
Table 1.
Primer design of real-time PCR.
| Genes | Forward Primer | Reverse Primer |
|---|---|---|
| GAPDH | TGACTTCAACAGCGACACCCA | CACCCTGTTGCTGTAGCCAAA |
| COX I | TTCAAAACTTCTGGCAAGATGG | CTTAAAGAGCCGCAGTTGATAC |
| COX II | TGTCAAAACCGAGGTGTATGTA | AACGTTCCAAAATCCCTTGAAG |
| COX III | CCATAACGCTCCTCATACTAGG | GGTATGTGCTTTCTCGTGTTAC |
| CYTB | ATTATGGCTGAATCATCCGCTA | CAGAATGATATTTGGCCTCACG |
The complete gene sequences were searched from the National Center for Biotechnology Information (NCBI) database. Specific primers for each gene were designed and screened using Primer Premier primer design software. All primers were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. and purified via ULTRAPAGE.
COX I: cytochrome c oxidase subunit I; COX II: cytochrome c oxidase subunit II, COX III: cytochrome c oxidase subunit III; CYTB: cytochrome B.
2.7. Transmission electron microscopy
Mitochondrial ultrastructure changes in HK-2 cells were evaluated by transmission electron microscopy (TEM). HK-2 cells treated by grouping were prefixed in 2.5% glutaraldehyde and subsequently refixed with 1% osmium tetroxide. The samples were dehydrated with an acetone gradient and underwent a series of subsequent processing steps, including embedding, sectioning, and staining. Finally, observations and imaging were conducted using TEM (JEM-1400FLASH, Japan).
2.8. Statistical analysis
GraphPad Prism 9 was used to analyze experimental data. The results were shown as the mean ± standard deviation (SD). Statistical significance between two groups was determined by Student’s t-test, while significance among multiple groups was determined by one-way ANOVA followed by Tukey’s post hoc test. p < 0.05 indicated a statistically significant difference. All experiments were repeated at least three times independent biological replicates.
3. Results
3.1. Iohexol injured cell viability and induced apoptosis in RTECs
As shown in Figure 1a, the cell viability decreased to 63.37%, 48.86%, and 29.65% after HK-2 cells were stimulated with iohexol for 6, 12, and 24 h respectively, indicating a significant inhibitory effect of iohexol (VS.CON). According to the Figure 1b and c, iohexol induced apoptosis in HK-2 cells in a time-dependent manner, and the apoptosis rate was 41.07% after 24 h of continuous treatment, which was significantly higher than that of the CON group (7.4%) (CI 24h VS. CON, ***p < 0.001). Therefore, the stimulation duration of 24 h was selected to establish an in vitro model for contrast-induced RTEC injury in subsequent experiments.
Figure 1.
Iohexol injured cell viability and induced apoptosis in renal tubular epithelial cells (RTECs). (a) Cell viability was determined by CCK-8 assay (n ≥ 3); (b, c) Flow cytometry analysis of the cell apoptotic rate and quantitation analysis (n ≥ 3); Representative images. Data were expressed as the means ± SD. ***p < 0.001.
3.2. Iohexol induced mtDNA methylation and promoted partly mtDNA transcription in RTECs
To understand the effect of CM on mtDNA methylation, the average methylation degree of eight mtDNA-coding genes in the CON and CI group was compared by BSAS. Compared with the CON group, the methylation levels of mtCOX I (3.09%, p = 0.0186), mtCOX II (4.51%, p = 0.007), mtCOX III (3.50%, p = 0.004) and mtCYTB (4.66%, p = 0.015) in the CI group were significantly increased, but the remaining four genes did not exhibit statistically significant differences (p > 0.05) (Figure 2a). Subsequently, the transcription levels of the aforementioned four mtDNA-encoded genes with methylation modification were quantified by qPCR. The Figure 2b demonstrated a significant up-regulation of mRNA levels for two genes in iohexol-treated HK-2 cells: cytochrome c oxidase subunit I (COX I) (CI VS. CON, p = 0.035) and cytochrome c oxidase subunit III (COX III) (CI VS. CON, p = 0.021). Additionally, cytochrome B (CYTB) exhibited a similar upward trend (CI VS. CON), although the difference was not statistically significant (p > 0.05).
Figure 2.
Iohexol induced mtDNA methylation and promoted partly mtDNA transcription in renal tubular (RTECs). (a) The mtDNA methylation level was analyzed by BSAS (n ≥ 5); (b) The mRNA expression levels of mtCOX I-III and mtCYTB were measured by qPCR (n ≥ 3). Data were expressed as the means ± SD. *p < 0.05; **p < 0.01.
3.3. Iohexol induced accumulation of ROS, mitochondrial damage, and morphological abnormalities in RTECs
After exposing HK-2 cells to iohexol for 24 h, the fluorescence detection results revealed a significant increase in green fluorescence intensity (CI VS. CON, **p < 0.01), indicating an excessive release of intracellular ROS levels (Figure 3a and b), which was consistent with the increasing trend of mitochondrial-derived ROS level shown in Figure 3c and d (CI VS. CON, *** p < 0.001). Additionally, the MMP of HK-2 cells in the CI group was significantly decreased compared to the CON group, as demonstrated in Figure 3e and f (*p < 0.05). The ultrastructural changes of mitochondria were subsequently examined using TEM. The mitochondria in the CI group displayed pronounced swelling, along with structural damage or even complete loss of cristae, as well as extensive dissolution of the matrix (Figure 3g). These findings suggested that iohexol-induced accumulation of ROS, mitochondrial damage and dysfunction, and mitochondrial morphological abnormalities in RTECs.
Figure 3.
Iohexol induced accumulation of ROS, mitochondrial damage, and morphological abnormalities in renal tubular epithelial cells (RTECs). (a, b) The intracellular reactive oxygen species (ROS) level in cells was detected by DCFH-DA fluorescence (n ≥ 3). Representative images. Scale bars:100µm. Magnification: ×100; (c, d) The mitochondrial ROS level in cells was detected by MitoSOX Red (n ≥ 3). Representative images. Scale bars: 50 µm; (e, f) The mitochondrial membrane potential of cells was observed via JC-1 staining (n ≥ 3). Representative images. Red: aggregated JC-1; Green: monomeric JC-1; Scale bars:100 μm. Magnification: ×200; (g) The mitochondrial morphology of cells was assessed by transmission electron microscopy (TEM) (n ≥ 3). Representative images. Blue arrows: normal mitochondria, red arrows: damaged mitochondria. Scale bars: 500 nm. Original magnification: ×2.5 × 104. Data were expressed as the means ± SD. *p < 0.05; **p < 0.01; ***p < 0.001. 5-Aza-dC: 5-Aza-2’-deoxycytidine.
3.4. Inhibiting iohexol induced-mtDNA methylation alleviated cell injury and apoptosis in RTECs
5-Aza-dC is a drug that effectively inhibits the activity of DNMTs [24,25]. According to Figure 4a, referring to previous studies [26–28], pretreatment with 1 µM of 5-Aza-dC for 1 h in HK-2 cells effectively inhibits CM-induced mtDNA methylation. The average methylation rates of mtCOX I (p = 0.022), mtCOX II (p = 0.028), mtCOX III (p = 0.014), and mtCYTB (***p < 0.001) in the 5-Aza-dC-CI group presented a significant decrease compared to those in the DMSO-CI group, which is fundamentally consistent with the findings observed in the DMSO group and the 5-Aza-dC group. After inhibiting mtDNA methylation, the study observed that compared to the DMSO-CI group, the 5-Aza-dC-CI group exhibited significantly reversed cell viability (***p < 0.001, Figure 4b), and demonstrated a significant protective effect against cell apoptosis (***p < 0.001, Figure 4c and d).
Figure 4.
Inhibiting iohexol induced-mtDNA methylation alleviated cell damage and apoptosis in renal tubular epithelial cells (RTECs). (a) The mtDNA methylation level of mtCOX I-III and CYTB was analyzed by BSAS (n ≥ 5); (b) Cell viability was determined by CCK-8 assay (n ≥ 3). (c, d) Flow cytometry analysis of the cell apoptotic rate and quantitation analysis (n ≥ 3); Representative images. Data were expressed as the means ± SD. *p < 0.05; **p < 0.01; ***p < 0.001. 5-Aza-dC:5-Aza-2’-deoxycytidine.
3.5. Inhibiting iohexol-induced mtDNA methylation reversed excessive transcription of certain mtDNA, reduced ROS accumulation, repaired mitochondrial damage, and morphological abnormalities
According to the qPCR quantitative results (Figure 5a), compared with DMSO-CI group, intervention of mtDNA methylation through 5-Aza-dC significantly reduced and restored the transcription levels of mtCOX I (p = 0.001) and mtCOX III (p = 0.002) in the 5-Aza-dC-CI group to levels comparable to those in the DMSO group. Although mtCYTB also showed a similar trend, the difference was not statistically significant (5-Aza-dC-CI VS. DMSO-CI, p = 0.054). As expected, the 5-Aza-dC-CI group showed a significant enhancement in MMP, accompanied by a substantial reduction in mtROS and intracellular ROS accumulation (VS. DMSO-CI, Figure 5b to g). Moreover, there was fair amelioration observed in mitochondrial structural impairment within the 5-Aza-dC-CI group. From Figure 5h, there was less swelling of mitochondria, fewer cristae fractures, and partial relief of matrix dissolution; however, it did not completely restore normal mitochondrial morphology. These findings indicated that inhibiting mtDNA methylation can effectively reverse excessive transcription of certain portions of mtDNA and alleviate excessive ROS production, thereby reducing mitochondrial damage, while improving both functional and morphological abnormalities.
Figure 5.
Inhibiting iohexol-induced mtDNA methylation reversed excessive transcription of certain mtDNA, reduced ROS accumulation, repaired mitochondrial damage, and morphological abnormalities. (a) The mRNA expression levels of mtCOX I-III and mtCYTB were detected by qPCR (n ≥ 3). (b, c) The mitochondrial membrane potential of cells was observed via JC-1 staining (n ≥ 3). Representative images. Red: aggregated JC-1; Green: monomeric JC-1; Scale bars:100 μm. Magnification: ×200; (d, e) The intracellular reactive oxygen species (ROS) level in cells was detected by DCFH-DA fluorescence (n ≥ 3). Representative images. Scale bars:100μm. Magnification: ×100; (f, g) The mitochondrial ROS level in cells was detected by MitoSOX Red (n ≥ 3). Representative images. Scale bars:50µm. (h) The mitochondrial morphology of cells was assessed by transmission electron microscopy (TEM) (n ≥ 3). Representative images. Blue arrows: normal mitochondria, red arrows: damaged mitochondria. Scale bars: 500 nm. Original magnification: ×2.5 × 104. Data were expressed as the means ± SD. *p < 0.05; **p < 0.01; ***p < 0.001. 5-Aza-dC:5-Aza-2’-deoxycytidine.
4. Discussion
Convincing evidence exists that CI-AKI is currently the third leading cause of iatrogenic renal dysfunction [29], and its occurrence may cause serious adverse clinical outcomes, including increased risk of renal replacement therapy and mortality [6,7,30]. Mitochondria are the main sites that regulate energy metabolism, calcium homeostasis, redox reactions, and mediating apoptosis [31,32]. Therefore, it is speculated that mitochondrial dysfunction and oxidative stress damage may serve as pivotal factors in the pathogenesis of contrast-induced injury and apoptosis of RTECs [33–35]. Exposure to CM triggers mitochondrial impairment, resulting in the excessive accumulation of ROS, leading to enhanced oxidative stress and alterations in mitochondrial membrane permeability, followed by the release of pro-apoptotic proteins (such as cytochrome c) that induce apoptosis in RTECs by activating the intrinsic pathway. This intricate process potentially represents a crucial mechanism underlying CI-AKI.
Currently, mtDNA methylation has been observed to play a pathological role in various disease models such as insulin resistance [36], occlusive arterial disease [37], and bone metastatic cancer [16]. These disorders consistently exhibited distinct mtDNA methylation patterns correlated with altered expression levels of mtDNA-encoded genes. However, the exact molecular mechanisms remain unclear. While direct evidence is not yet available, mtDNA methylation may regulate the expression of genes associated with mitochondrial OXPHOS system, potentially mediating oxidative stress or mitochondrial dysfunction. This study aims to investigate whether mtDNA methylation is involved in contrast-induced RTEC injury and apoptosis and further explore the role and mechanism of inhibiting mtDNA methylation to provide new therapeutic targets for CI-AKI.
In the present study, we successfully established an in vitro model in HK-2 cells based on assessments of cell viability and apoptosis. Additionally, by summarizing previous studies [16,19,36–40], we selected eight mtDNA-encoded genes of interest, which encode catalytic core subunits or functional/assembly core subunits of the OXPHOS system [41], for BSAS analysis: NADH dehydrogenase 1, NADH dehydrogenase 6, CYTB, cytochrome c oxidase subunit I-III (COX I-III), ATP synthase membrane subunit 6, and ATP synthase membrane subunit 8. We first observed that in HK-2 cells exposed to the CM iohexol, four out of eight genes showed a significant increase in mtDNA methylation levels (Figure 2a). And the mtDNA hypermethylation was simultaneously accompanied by the decrease in MMP, mitochondria structural damage, and excessive release of ROS from both cells and mitochondria. Therefore, we speculated that mtDNA methylation was involved in contrast-induced RTEC injury. MtDNA methylation may represent an upstream event of mitochondrial dysfunction, contributing to elevated oxidative stress and ultimately leading to RTECs injury and apoptosis. Subsequently, pharmacological intervention experiments were conducted using 5-Aza-dC, which effectively inhibited mtDNA methylation, thereby alleviating mitochondrial damage and oxidative stress, restoring cell viability, and reducing cell apoptosis. The combination of the two experimental results supports our hypothesis: sustained CM stimulation may trigger mtDNA methylation in RTECs, subsequently inducing mitochondrial dysfunction and exacerbating oxidative stress. Some previous reports [16,19,36,37] have demonstrated that demethylation methods, such as the application of 5-Aza-dC or intervention with exogenous normal mitochondria, can reduce cell apoptosis and/or dysfunction in cells and mitochondrial. These findings are consistent with the present study. Separately, 5-Aza-dC (decitabine) is an FDA-approved drug for treating hematologic malignancies. The plasma level of 5-Aza-dC exceeding 200 ng/mL (>1 μM) have demonstrated potent antineoplastic effects in mice with leukemia or solid tumors [42]. Clinical data [43] from myelodysplastic syndromes patients receiving the classic 5-day treatment regimen revealed plasma levels ranging from 84.7 to 311 ng/mL (0.37–1.36 μM). The working concentration of 1 μM that we used was essentially consistent with this. However, 5-Aza-dC has not yet been clinically applied for CI-AKI at present. Notably, although the protective effect of 5-Aza-dC on contrast-induced RTEC injury in this study occurred at clinically relevant concentrations, substantial clinical research is still needed to confirm its applicability in CI-AKI.
In this work, we focused particularly on the transcription levels of these four genes. As the level of mtDNA methylation increased, the transcription of mtCOX I and III, were significantly upregulated. CYTB exhibited a similar upward trend, although the difference did not reach statistical significance. COX I-III, encoded by mtDNA, serve as the three catalytic core subunits of respiratory complex IV and contain four redox centers. Complex IV (cytochrome c oxidase) is the terminal enzyme of mitochondrial electron transport chain [44], and transferring electrons from reduced cytochrome c (Cyt c) during the catalytic cycle, ultimately reducing molecular oxygen to water [44–46]. CYTB is the only mtDNA-encoded subunit in respiratory complex III (cytochrome bc1 complex) [47], which is responsible for the transfer of electrons from Coenzyme Q (CoQ) to cytochrome c [48]. ROS is a by-product of the mitochondrial electron transport chain, and alterations in intracellular ROS levels are associated with changes in mitochondrial number, mtDNA copy number, and expression of respiratory genes [49]. Complex III and complex I are widely recognized as the primary sites of ROS generation within mitochondria [50]. However, there is still controversy regarding whether complex IV produces ROS. Some literature [50–53] suggested that complex IV hardly or does not generate ROS, but one study [54] proposing that under ischemic and hypoxic experimental conditions, there is a significant increase in ROS production by complex IV, which is associated with the modification of subunits I and II of complex IV. Based on the present study results, we propose that exposing cells to a CM environment can increase mtDNA methylation levels in RTECs, leading to abnormal upregulation of mtCOX I and mtCOX III transcription. Probably, this pathologically excessive release of ROS from complex IV damages mitochondria, ultimately leading to injury in RTECs. But the exact mechanisms remain to be investigated. In addition, methyl-CpG-binding domain (MBD) proteins, one of the families of methyl group reader proteins, can recognize and binding to the methylated cytosines on CpG islands. There is recent work [55] revealing that MBD2c translocated into the mitochondrial matrix, where it interacted with the non-coding region of mtDNA (the binding is more pronounced), mtCYTB, and mtCOX I. It activated TFAM (mitochondrial transcription factor A) through SIRT3 deacetylation and enhanced TFAM’s binding ability in the non-coding region of mtDNA, thereby promoting mitochondrial transcription and enhancing cell function and energy metabolism. This mechanism may also serve as a plausible explanation for the upregulation of COX I/III methylation and transcript levels. Certainly, the possibility that the upregulation of the mtCOX I and mtCOX III gene expression represents a compensatory feedback response by mitochondria to oxidative stress cannot be disregarded. The upregulation mtDNMT1 appears to be responsible for mtDNA methylation. Under oxidative stress, mtDNMT1 was overexpressed in response to hypoxia through PGC1α and NRF-1 (encoded by nuclear DNA), leading to the upregulation of mtND1 while repressing mtND6 transcription [13]. This suggested a role for mtDNMT1 in the regulation of mitochondrial transcription during oxidative stress.
Our study found that CM stimulation of HK-2 cells induced mtDNA hypermethylation (COX I-III, CYTB) and was accompanied by an increase in aberrant transcription of certain genes. To the best of our knowledge, this is the first report of mtDNA methylation in contrast-induced RTEC injury. And further confirmed that inhibition of mtDNA methylation by pharmacological intervention could reverse the transcriptional enhancement of these genes. These results collectively suggested that a potential role of mtDNA methylation in maintaining transcriptional upregulation in this model. Previous studies have indicated that DNA methylation occurring in the promoter region usually manifests as transcriptional inhibition [56,57]. However, the phenomenon of increased mtDNA methylation alongside transcript upregulation challenges the classical epigenetic theory that nuclear DNA hypermethylation suppresses transcription. This finding provides novel insights into the previously undercharacterized epigenetic regulatory divergence between mtDNA and genomic DNA methylation. MtDNA methylation is a largely unexplored field and exhibits environmental dependence, tissue and cell specificity [11]. In addition, mtDNA contains a unique 1124 base pairs (bp) non-coding region, which encompasses the three promoter regions of mtDNA, collectively known as the displacement loop (D-loop) region playing a crucial role in regulating the replication and transcription of mtDNA [58]. This region of mtDNA, which is distinct from genomic DNA, may increase the complexity of transcriptional regulation by mtDNA methylation. Herein, we conducted a direct analysis of specific mtDNA-encoded genes and did not encompass the D-loop region, which may be one of the reasons for the contradiction with the ‘established principle’. But the exact mechanisms remain to be investigated.
This work still has some limitations. Firstly, mtDNA encodes 13 protein subunits involved in OXPHOS function, but this study only examined the methylation levels of 8 of these genes and did not detect the epigenetic modification level in the D-loop region. Secondly, this study solely focused on changes at the transcriptional level of mtDNA without further validation at the protein level and respiratory function. In addition, while our study implied that mtDNA methylation may be upstream of ROS overproduction, there may be a potential bidirectional interplay between the two. In certain types of tumors [59,60], excessive ROS can induce the upregulation of DNA methylation levels in the promoter region of tumor suppressor genes, thereby facilitating gene silencing and contributing to the development of tumors. To deeply study its internal mechanism still faces huge challenges. Another limitation stems from the potential off-target effects of 5-Aza-dC. The primary mechanism of 5-Aza-dC involves incorporation into DNA during replication, leading to irreversible inhibition and degradation of DNMTs, resulting in global genomic DNA demethylation [61]. 5-Aza-dC is a nonspecific DNA demethylating agent; thus, our study cannot completely exclude potential interference from nuclear DNA methylation. For instance, in a study [62] that constructed a cell senescence model using human mesenchymal stem cells (hMSCs), it was found that the superoxide dismutase 2 (SOD2, an antioxidant gene) was significantly downregulated. This downregulation led to premature senescence in DGCR8 knockout hMSCs by regulating the production of ROS and mitochondrial oxidative stress. Further research indicated that DNMT3A-mediated hypermethylation of the SOD2 promoter was involved in this process. Additionally, treatment with 5-Aza-dC restored the expression of SOD2, and alleviating oxidative stress in hMSCs. Similarly, DNMT3A drove SOD2 promoter hypermethylation and transcriptional silencing, which exacerbated oxidative stress, promoting pulmonary fibrosis [63]. As is well known, oxidative stress has been confirmed a key driver of aging and diverse disease pathogenesis. Thus, SOD2 hypermethylation may similarly contribute to CI-AKI pathogenesis, but remains underexplored. We will further utilize a specific targeting technique for mtDNA methylation to conduct repeated validation, while concurrently assessing potential changes in nuclear DNA methylation. Meanwhile, this project is still in the stage of exploring in vitro models, and animal models and clinical samples will be observed in the future. Although the current sample size constrains our ability to identify minor differences in methylation sites, to the best of our knowledge, this study provides the first evidence linking mtDNA methylation to contrast-induced RTEC injury.
5. Conclusion
In conclusion, CM can induce mtDNA methylation, resulting in the over-transcription of COX I and III. This mechanism may enable respiratory complex IV, which usually does not generate ROS, to contribute to the production of mtROS under pathological conditions, thereby playing a critical role in the pathogenesis of contrast-induced injury to RTECs. Inhibiting mtDNA methylation can restore normal mitochondrial transcription levels, reduce ROS production, repair mitochondrial damage, and provide protection against contrast-induced RTEC injury.
Supplementary Material
Funding Statement
This study was supported by the Natural Science Fund of Tianjin City [grant number 23JCYBJC01330, 23JCQNJC01430], Tianjin Hospital Science and Technology Fund Project [grant number TJYYQ2405, TJYYQ2402] and Tianjin Municipal Second Batch of High-level Talents Selection and Training Program in the Health Industry [Jinmen Medical Talents, grant number TJSJMYXYC-D2-036].
Author contributions
Dingwei Yang and Meiling Lv conceived and designed the study. Meiling Lv and Manyu Zhang reviewed the literature. Meiling Lv, Manyu Zhang, Sha Chen, and Sheng Lu performed the experiments, analyzed and visualized the data, and drafted the manuscript. Dingwei Yang supervised the research, interpreted the results and revised the important intellectual content of the manuscript. Meiling Lv and Manyu Zhang contributed equally to this work and share first authorship. This article has not been published elsewhere. All authors contributed to the article and approved the submitted version.
Disclosure statement
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Data availability statement
The dataset presented in this study has been deposited in the online repository, NCBI Sequence Read Archive (SRA) (www.ncbi.nlm.nih.gov), accession number (PRJNA1206845) and will be released on 1 March 2026.
References
- 1.Hennessey B, Danenberg H, De Vroey F, et al. Dynamic Coronary Roadmap versus standard angiography for percutaneous coronary intervention: the randomised, multicentre DCR4Contrast trial. EuroIntervention. 2024;20(3):e198–e206. doi: 10.4244/EIJ-D-23-00460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Uzendu A, Kennedy K, Chertow G, et al. Contemporary methods for predicting acute kidney injury after coronary intervention. JACC Cardiovasc Interv. 2023;16(18):2294–2305. doi: 10.1016/j.jcin.2023.07.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Shan Y, Lin M, Gu F, et al. Association between fasting stress hyperglycemia ratio and contrast-induced acute kidney injury in coronary angiography patients: a cross-sectional study. Front Endocrinol (Lausanne)). 2023;14:1300373. doi: 10.3389/fendo.2023.1300373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Kooiman J, Pasha SM, Zondag W, et al. Meta-analysis: serum creatinine changes following contrast enhanced CT imaging. Eur J Radiol. 2012;81(10):2554–2561. doi: 10.1016/j.ejrad.2011.11.020. [DOI] [PubMed] [Google Scholar]
- 5.Jones DA, Beirne AM, Kelham M, et al. Inorganic nitrate benefits contrast-induced nephropathy after coronary angiography for acute coronary syndromes: the NITRATE-CIN trial. Eur Heart J. 2024;45(18):1647–1658. doi: 10.1093/eurheartj/ehae100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Rear R, Bell RM, Hausenloy DJ.. Contrast-induced nephropathy following angiography and cardiac interventions. Heart. 2016;102(8):638–648. doi: 10.1136/heartjnl-2014-306962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Zhang F, Lu Z, Wang F.. Advances in the pathogenesis and prevention of contrast-induced nephropathy. Life Sci. 2020;259:118379. doi: 10.1016/j.lfs.2020.118379. [DOI] [PubMed] [Google Scholar]
- 8.Cheng AS, Li X.. The Potential Biotherapeutic Targets of Contrast-Induced Acute Kidney Injury. Int J Mol Sci. 2023;24(9):8254. doi: 10.3390/ijms24098254. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Anderson S, Bankier AT, Barrell BG, et al. Sequence and organization of the human mitochondrial genome. Nature. 1981;290(5806):457–465. doi: 10.1038/290457a0. [DOI] [PubMed] [Google Scholar]
- 10.A FCL . Mitochondrial metabolism and DNA methylation: a review of the interaction between two genomes. Clin Epigenetics. 2020;12(1):182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Stoccoro A, Coppedè F.. Mitochondrial DNA Methylation and Human Diseases. Int J Mol Sci. 2021;22(9):4594. doi: 10.3390/ijms22094594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wong M, Gertz B, Chestnut BA, et al. Mitochondrial DNMT3A and DNA methylation in skeletal muscle and CNS of transgenic mouse models of ALS. Front Cell Neurosci. 2013;7:279. doi: 10.3389/fncel.2013.00279. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Shock LS, Thakkar PV, Peterson EJ, et al. DNA methyltransferase 1, cytosine methylation, and cytosine hydroxymethylation in mammalian mitochondria. Proc Natl Acad Sci USA. 2011;108(9):3630–3635. doi: 10.1073/pnas.1012311108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Menga A, Palmieri EM, Cianciulli A, et al. SLC25A26 overexpression impairs cell function via mtDNA hypermethylation and rewiring of methyl metabolism. Febs J. 2017;284(6):967–984. doi: 10.1111/febs.14028. [DOI] [PubMed] [Google Scholar]
- 15.Feng S, Xiong L, Ji Z, et al. Correlation between increased ND2 expression and demethylated displacement loop of mtDNA in colorectal cancer. Mol Med Rep. 2012;6(1):125–130. doi: 10.3892/mmr.2012.870. [DOI] [PubMed] [Google Scholar]
- 16.Liu Z, Tian J, Peng F, et al. Hypermethylation of mitochondrial DNA facilitates bone metastasis of renal cell carcinoma. J Cancer. 2022;13(1):304–312. doi: 10.7150/jca.62278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Wang W, Zhao F, Ma X, et al. Mitochondria dysfunction in the pathogenesis of Alzheimer’s disease: recent advances. Mol Neurodegener. 2020;15(1):30. doi: 10.1186/s13024-020-00376-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Pirola CJ, Gianotti TF, Burgueño AL, et al. Epigenetic modification of liver mitochondrial DNA is associated with histological severity of nonalcoholic fatty liver disease. Gut. 2013;62(9):1356–1363. doi: 10.1136/gutjnl-2012-302962. [DOI] [PubMed] [Google Scholar]
- 19.Mishra M, Kowluru RA.. Epigenetic modification of mitochondrial DNA in the development of diabetic retinopathy. Invest Ophthalmol Vis Sci. 2015;56(9):5133–5142. doi: 10.1167/iovs.15-16937. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Yang D, Yang X, Chen S, et al. Ox-LDL aggravates contrast-induced injury of renal tubular epithelial cells. J Biochem Mol Toxicol. 2023;37(8):e23379. doi: 10.1002/jbt.23379. [DOI] [PubMed] [Google Scholar]
- 21.Akalin A, Kormaksson M, Li S, et al. methylKit: a comprehensive R package for the analysis of genome-wide DNA methylation profiles. Genome Biol. 2012;13(10):R87. doi: 10.1186/gb-2012-13-10-r87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Krueger F, Andrews SR.. Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications. Bioinformatics. 2011;27(11):1571–1572. doi: 10.1093/bioinformatics/btr167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Wilmot B, Fry R, Smeester L, et al. Methylomic analysis of salivary DNA in childhood ADHD identifies altered DNA methylation in VIPR2. J Child Psychol Psychiatry. 2016;57(2):152–160. doi: 10.1111/jcpp.12457. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Jüttermann R, Li E, Jaenisch R.. Toxicity of 5-aza-2’-deoxycytidine to mammalian cells is mediated primarily by covalent trapping of DNA methyltransferase rather than DNA demethylation. Proc Natl Acad Sci USA. 1994;91(25):11797–11801. doi: 10.1073/pnas.91.25.11797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Taylor SM, Jones PA.. Mechanism of action of eukaryotic DNA methyltransferase. Use of 5-azacytosine-containing DNA. J Mol Biol. 1982;162(3):679–692. doi: 10.1016/0022-2836(82)90395-3. [DOI] [PubMed] [Google Scholar]
- 26.Guo C, Pei L, Xiao X, et al. DNA methylation protects against cisplatin-induced kidney injury by regulating specific genes, including interferon regulatory factor 8. Kidney Int. 2017;92(5):1194–1205. doi: 10.1016/j.kint.2017.03.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Zhao Y, Fan X, Wang Q, et al. ROS promote hyper-methylation of NDRG2 promoters in a DNMTS-dependent manner: contributes to the progression of renal fibrosis. Redox Biol. 2023;62:102674. doi: 10.1016/j.redox.2023.102674. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Sun X, Wang Z, Cong X, et al. Mitochondrial gene COX2 methylation and downregulation is a biomarker of aging in heart mesenchymal stem cells. Int J Mol Med. 2021;47(1):161–170. doi: 10.3892/ijmm.2020.4799. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Liu C, Hu YH, Han Y, et al. MG53 protects against contrast-induced acute kidney injury by reducing cell membrane damage and apoptosis. Acta Pharmacol Sin. 2020;41(11):1457–1464. doi: 10.1038/s41401-020-0420-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Mohebi R, Karimi Galougahi K, Garcia JJ, et al. Long-term clinical impact of contrast-associated acute kidney injury following PCI: an ADAPT-DES substudy. JACC Cardiovasc Interv. 2022;15(7):753–766. doi: 10.1016/j.jcin.2021.11.026. [DOI] [PubMed] [Google Scholar]
- 31.Tang C, Cai J, Yin XM, et al. Mitochondrial quality control in kidney injury and repair. Nat Rev Nephrol. 2021;17(5):299–318. doi: 10.1038/s41581-020-00369-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Chinnery PF, Hudson G.. Mitochondrial genetics. Br Med Bull. 2013;106(1):135–159. doi: 10.1093/bmb/ldt017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Kusirisin P, Chattipakorn SC, Chattipakorn N.. Contrast-induced nephropathy and oxidative stress: mechanistic insights for better interventional approaches. J Transl Med. 2020;18(1):400. doi: 10.1186/s12967-020-02574-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Quintavalle C, Brenca M, De Micco F, et al. In vivo and in vitro assessment of pathways involved in contrast media-induced renal cells apoptosis. Cell Death Dis. 2011;2(5):e155–e155. doi: 10.1038/cddis.2011.38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Heyman SN, Rosen S, Khamaisi M, et al. Reactive oxygen species and the pathogenesis of radiocontrast-induced nephropathy. Invest Radiol. 2010;45(4):188–195. doi: 10.1097/RLI.0b013e3181d2eed8. [DOI] [PubMed] [Google Scholar]
- 36.Cao K, Lv W, Wang X, et al. Hypermethylation of hepatic mitochondrial ND6 provokes systemic insulin resistance. Adv Sci. 2021;8(11):2004507. doi: 10.1002/advs.202004507. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Liu YF, Zhu JJ, Yu Tian X, et al. Hypermethylation of mitochondrial DNA in vascular smooth muscle cells impairs cell contractility. Cell Death Dis. 2020;11(1):35. doi: 10.1038/s41419-020-2240-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Boovarahan SR, AlAsmari AF, Ali N, et al. N, et al. Targeting DNA methylation can reduce cardiac injury associated with ischemia reperfusion: one step closer to clinical translation with blood-borne assessment. Front Cardiovasc Med. 2022;9:1021909. doi: 10.3389/fcvm.2022.1021909. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Xu Y, Cheng L, Sun J, et al. Hypermethylation of mitochondrial cytochrome b and cytochrome c oxidase II genes with decreased mitochondrial DNA copy numbers in the APP/PS1 transgenic mouse model of Alzheimer’s Disease. Neurochem Res. 2021;46(3):564–572. doi: 10.1007/s11064-020-03192-y. [DOI] [PubMed] [Google Scholar]
- 40.Baccarelli AA, Byun HM.. Platelet mitochondrial DNA methylation: a potential new marker of cardiovascular disease. Clin Epigenetics. 2015;7(1):44. doi: 10.1186/s13148-015-0078-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Signes A, Fernandez-Vizarra E.. Assembly of mammalian oxidative phosphorylation complexes I-V and supercomplexes. Essays Biochem. 2018;62(3):255–270. doi: 10.1042/EBC20170098. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Lemaire M, Chabot GG, Raynal NJ, et al. Importance of dose-schedule of 5-aza-2’-deoxycytidine for epigenetic therapy of cancer. BMC Cancer. 2008;8(1):128. doi: 10.1186/1471-2407-8-128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Wu D, Zhang Y, Zhao Y-S, et al. Inhibitory effect of decitabine on proliferation of MDS-L cells and its mechanism. Zhongguo Shi Yan Xue ye Xue za Zhi. 2017;25(5):1471–1476. in Chinese) doi: 10.7534/j.issn.1009-2137.2017.05.033. [DOI] [PubMed] [Google Scholar]
- 44.Brunori M, Antonini G, Malatesta F, et al. Cytochrome-c oxidase. Subunit structure and proton pumping. Eur J Biochem. 1987;169(1):1–8. doi: 10.1111/j.1432-1033.1987.tb13572.x. [DOI] [PubMed] [Google Scholar]
- 45.Timón-Gómez A, Nývltová E, Abriata LA, et al. Mitochondrial cytochrome c oxidase biogenesis: recent developments. Semin Cell Dev Biol. 2018;76:163–178. doi: 10.1016/j.semcdb.2017.08.055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Srinivasan S, Avadhani NG.. Cytochrome c oxidase dysfunction in oxidative stress. Free Radic Biol Med. 2012;53(6):1252–1263. doi: 10.1016/j.freeradbiomed.2012.07.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Rigotto G, Basso E.. Mitochondrial dysfunctions: a thread sewing together Alzheimer’s Disease, diabetes, and obesity. Oxid Med Cell Longev. 2019;2019:7210892–16. doi: 10.1155/2019/7210892. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Banerjee R, Purhonen J, Kallijärvi J.. The mitochondrial coenzyme Q junction and complex III: biochemistry and pathophysiology. Febs J. 2022;289(22):6936–6958. doi: 10.1111/febs.16164. [DOI] [PubMed] [Google Scholar]
- 49.Lee HC, Wei YH.. Mitochondrial biogenesis and mitochondrial DNA maintenance of mammalian cells under oxidative stress. Int J Biochem Cell Biol. 2005;37(4):822–834. doi: 10.1016/j.biocel.2004.09.010. [DOI] [PubMed] [Google Scholar]
- 50.Chen Q, Vazquez EJ, Moghaddas S, et al. Production of reactive oxygen species by mitochondria: central role of complex III. J Biol Chem. 2003;278(38):36027–36031. doi: 10.1074/jbc.M304854200. [DOI] [PubMed] [Google Scholar]
- 51.Ramzan R, Kadenbach B, Vogt S.. Multiple mechanisms regulate eukaryotic cytochrome C Oxidase. Cells. 2021;10(3):514. doi: 10.3390/cells10030514. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Zhao RZ, Jiang S, Zhang L, et al. Mitochondrial electron transport chain, ROS generation and uncoupling (Review). Int J Mol Med. 2019;44(1):3–15. doi: 10.3892/ijmm.2019.4188. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Zorov DB, Juhaszova M, Sollott SJ.. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol Rev. 2014;94(3):909–950. doi: 10.1152/physrev.00026.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Prabu SK, Anandatheerthavarada HK, Raza H, et al. Protein kinase A-mediated phosphorylation modulates cytochrome c oxidase function and augments hypoxia and myocardial ischemia-related injury. J Biol Chem. 2006;281(4):2061–2070. doi: 10.1074/jbc.M507741200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Hao Y, Zhou Z, Liu R, et al. Mitochondria-localized MBD2c facilitates mtDNA transcription and drug resistance. Nat Chem Biol. 2025;21(6):926–938. doi: 10.1038/s41589-024-01776-1. [DOI] [PubMed] [Google Scholar]
- 56.Jones PA, Takai D.. The role of DNA methylation in mammalian epigenetics. Science. 2001;293(5532):1068–1070. doi: 10.1126/science.1063852. [DOI] [PubMed] [Google Scholar]
- 57.Mayorga L, Salassa BN, Marzese DM, et al. Mitochondrial stress triggers a pro-survival response through epigenetic modifications of nuclear DNA. Cell Mol Life Sci. 2019;76(7):1397–1417. doi: 10.1007/s00018-019-03008-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Lemasters JJ, Theruvath TP, Zhong Z, et al. Mitochondrial calcium and the permeability transition in cell death. Biochim Biophys Acta. 2009;1787(11):1395–1401. doi: 10.1016/j.bbabio.2009.06.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Lim SO, Gu JM, Kim MS, et al. Epigenetic changes induced by reactive oxygen species in hepatocellular carcinoma: methylation of the E-cadherin promoter. Gastroenterology. 2008;135(6):2128–2140.e8. 2140 e1-8. doi: 10.1053/j.gastro.2008.07.027. [DOI] [PubMed] [Google Scholar]
- 60.Ziech D, Franco R, Pappa A, et al. Reactive oxygen species (ROS)–induced genetic and epigenetic alterations in human carcinogenesis. Mutat Res. 2011;711(1-2):167–173. doi: 10.1016/j.mrfmmm.2011.02.015. [DOI] [PubMed] [Google Scholar]
- 61.Ribas L, Vanezis K, Imués MA, et al. Treatment with a DNA methyltransferase inhibitor feminizes zebrafish and induces long-term expression changes in the gonads. Epigenetics Chromatin. 2017;10(1):59. doi: 10.1186/s13072-017-0168-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Jung YD, Park SK, Kang D, et al. Epigenetic regulation of miR-29a/miR-30c/DNMT3A axis controls SOD2 and mitochondrial oxidative stress in human mesenchymal stem cells. Redox Biol. 2020;37:101716. doi: 10.1016/j.redox.2020.101716. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Wang XC, Zhang YS, Ling H, et al. Epigenetic silencing of SOD2 exacerbates mitochondrial oxidative stress and promotes pulmonary fibrosis. Free Radic Biol Med. 2025;235:176–189. doi: 10.1016/j.freeradbiomed.2025.04.034. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The dataset presented in this study has been deposited in the online repository, NCBI Sequence Read Archive (SRA) (www.ncbi.nlm.nih.gov), accession number (PRJNA1206845) and will be released on 1 March 2026.





