TABLE 1.

Species-specific direct hybridization probes

Probe	Species or strain identified	Probe sequence	Probe signal range (AFU)		Min ratio of signalsc
			Negativea	Positiveb
Alb7	Candida albicans	TATTTTGCATGCTGCTCTCTC	0-58	299-1,268	5.2
Dub5	C. dubliniensis	TATTTTGCAAGTTACTCTTTC	0-98	676-934	6.9
Fari2	Stephanoascus farinosus	TTGGTTTGTAACGATCAACT	0-161	843	5.2
Glab5	C. glabrata	TTGCCTCTCGTGGGCTTGGGA	0	466-743	NAd
Hellen2	Zygoascus hellenicus	AAGGGATCTAAATCAGACAT	0-100	792	7.9
HemC	C. haemulonii	AACGAGCAGTCGATGTAGTACA	0	921-1,219	NA
HemIIB	C. haemulonii type II	AAAGTGGGAGCTGATGTAGCAAC	0-71	757-1,031	10.7
KrusF	C. krusei	GAGGACTGCGCCGTGTAGG	0-70	2,015-2,463	28.8
Lusit2	Clavispora lusitaniae	CGGGCCAGCGTCAAATAAAC	0	269	NA
Malt5	C. maltosa	TATAGCCACTGTCGATACTG	0-251	1,389	5.5
Nee5	C. neerlandica	AGGAGAATCGCTTGGGAACG	0-201	2,058	10.2
Pcifer3	Pichia ciferrii	AAGATAATAGCAGTTAAATG	0-521e	2,775	5.3
SojC	C. sojae	GCCTTCGTAGATACTGC	0-611f	1,279-1,419	2.1
SP12	Candida sp. strain NRRL Y-17456	GGACAATTGCAAAGAAATGT	0-50	1,301-1,373	26
VisA	C. viswanathiig	GCGGCAGGACAATCGCGTGG	0-100	791-1,271	7.9
UniD	All species tested	GTGAAATTGTTGAAAGGGAA	NA	782-5,571	NA

^aRange of adjusted fluorescence values for all negative strains after subtraction of background from a water blank negative.

^bRange of AFU for all positive strains after subtraction of background.

^cThe min ratio is the lowest recorded positive value divided by the highest recorded negative value.

^dNA, adjusting the fluorescence values of negative strains by subtracting background resulted in no discernable signals above background for all negative strains for these probes, and min ratios therefore could not be calculated.

^eC. silvicultrix gave a signal of 521 AFU. All other strains recorded less than 97 AFU.

^fC. tropicalis and L. elongisporus strains cross-reacted with SojC at about 50% of the signal of C. sojae strains. See text for discussion. All other strains were recorded at less than 330 AFU.

^gC. viswanathii includes C. lodderae.