TABLE 2.

Multispecies direct hybridization probes

Species identified	Probe(s)	Probe sequence	Cross-reactivitya	Positive rangeb	Cross-reactive nontarget speciesc
Candida fermentati, C. guilliermondii var. guilliermondii, C. guilliermondii var. carpophila	GG2 GG3	ATCAGACTCGATATTTTGTG GTGACCCGCAGCTTATCGGG	0-441 0-551	667-1544 878-1515	0
C. parapsilosis	LPW Parap2B	TGCGGCTTCGGCCTAGGATG GGTAGGATAAGTGCAAAG	0-2272 0-943	2696-3432 1376-1853	0
C. tropicalis, Lodderomyces elongisporus	LPW Trop/Elong5B	TGCGGCTTCGGCCTAGGATG AGAATTGCGTTGGAATGT	0-2272 0-521	2696-3432 915-1820	0
All species tested	UniD	GTGAAATTGTTGAAAGGGAA	NAd	782-5571	NA

^aRange of fluorescence values for strains cross-reactive with individual probes. See text and Fig. 1.

^bRange of fluorescence values for strains considered positive for the individual probe indicated.

^cNumber of strains considered to be cross-reactive (greater than 40% of the lowest positive signal) with both multispecies probes of the probe sets.

^dNA, not applicable.