Skip to main content
NCBI home page
Journal of Extracellular Vesicles logoLink to Journal of Extracellular Vesicles
. 2025 Aug 18;14(8):e70152. doi: 10.1002/jev2.70152

Extracellular Vesicles Containing MDP Derived from Lactobacillus rhamnosus GG Inhibit HSV‐2 Infection by Activating the NOD2‐IFN‐I Signalling Pathway

Jingyu Wang 1,2, Haoming Chen 3,4, Mei Huang 3, Yuqi Du 1, Ruyi Zhang 1,2, Yiyi Huang 1, Yuling Lin 3, Ruoru Pan 1, Yubing Wang 3, Wanqin Cui 3, Qian Wang 3,4,✉, Lei Zheng 1,2,5,✉, Xiumei Hu 1,2,✉
PMCID: PMC12360853  PMID: 40825575

ABSTRACT

The immune evasion strategies and lifelong latency of herpes simplex virus type 2 (HSV‐2) present significant challenges for effective treatment. Recent studies have demonstrated that the commensal microbiota plays an important role in regulating immunity against viral infections. We previously reported that Lactobacillus rhamnosus GG (LGG) activates the expression of type I interferons (IFN‐I) to inhibit HSV‐2 infection. However, the specific molecular mechanisms remain unclear. Bacterial extracellular vesicles (EVs) are small lipid bilayer‐bound particles secreted by bacteria, which can serve as intercellular communication vehicles between the host and pathogens, functioning as immunomodulatory vectors defending against viral infections. In this study, we confirmed that LGG‐EVs activate the nucleotide‐binding oligomerisation domain‐containing protein 2 (NOD2)‐IFN‐I signalling pathway, inducing the expression of interferon‐stimulated genes (ISGs) to combat HSV‐2 infection both in vivo and in vitro. Furthermore, we explored the specific components within LGG‐EVs and identified the presence of muramyl dipeptide (MDP). We demonstrated that MDP‐enriched LGG‐EVs effectively inhibit HSV‐2 infection via activation of the NOD2‐IFN‐I pathway. These findings suggest that LGG‐EVs could serve as a novel therapeutic strategy for HSV‐2 and provide a mechanistic foundation for future antiviral research.

Keywords: extracellular vesicles, herpes simplex virus type 2, Lactobacillus rhamnosus GG, NOD2, type I interferons

Extracellular vesicles derived from Lactobacillus rhamnosus GG containing muramyl dipeptide (LGG‐EVsMDP) protect against herpes simplex virus type 2 (HSV‐2) infection by activating the NOD2‐IFN‐I signalling pathways.

graphic file with name JEV2-14-e70152-g002.jpg

Abbreviations

ABX

broad‐spectrum antibiotics

DAPI

4’,6‐Diamidino‐2’‐phenylindole

DMSO

dimethyl sulfoxide

FITC

fluorescein isothiocyanate isomer I

HEK293T

human embryonic kidney 293 with SV40 T‐antigen

HIV

human immunodeficiency virus

HSV‐2

herpes simplex virus type 2

i.g.

intragastric gavage

IFIT1

interferon Induced protein with tetratricopeptide repeats 1

IFN‐I

interferon type I

IFNAR

IFN‐I receptor

Ifnαr1−/−

IFNAR1‐knockout

IFN‐β

interferon type β

IRF3

interferon regulatory factor 3

IRF7

interferon regulatory factor 7

ISG15

interferon‐stimulated gene 15

ISGs

IFN‐stimulated genes

LGG

Lactobacillus rhamnosus GG

LGG‐EVs

Lactobacillus rhamnosus GG extracellular vesicles

MDP

muramyl dipeptide

mLN

mesenteric lymphoid node

MX1

myxovirus (Influenza virus) resistance 1

OASL2

oligoadenylate synthetase‐like 2

PFU

plaque‐forming units

PRRs

pattern recognition receptors

qRT‐PCR

quantitative reverse transcriptase‐polymerase chain reaction

RAW264.7

mouse mononuclear macrophages cell

RIPK2

receptor interacting protein kinase 2

SEM

standard error of measurement

siNOD2

SiRNA targeting NOD2

siRNAs

small interfering RNAs

VK2/E6E7

human vaginal epithelial cells

WT

wild type

1. Introduction

Herpes simplex virus type 2 (HSV‐2) is the most prevalent sexually transmitted disease worldwide, causing genital herpes lesions in humans, accompanied by pain, itching, tingling and ulceration (Gupta et al. 2007; Tuddenham et al. 2022). Following primary genital infection, the virus often establishes latency within the nerve ganglia and can reactivate under certain conditions, resulting in recurrent infections (James et al. 2020; Connolly et al. 2021). HSV‐2 infection also increases the risk of acquiring human immunodeficiency virus (HIV) and acts as a key driver of HIV infection and transmission (Looker et al. 2017, 2020). Additionally, HSV‐2 infection may increase the risk of human papillomavirus infection, thereby contributing to the incidence of cervical cancer (Golais and Mrázová 2020; Bahena‐Román et al. 2020). Currently, there are no licensed preventive or therapeutic vaccines for HSV‐2 (Wijesinghe et al. 2021; Dai et al. 2018). The primary approach to managing HSV‐2 is through antiviral medications, including nucleoside‐based medications such as aciclovir, valaciclovir or famciclovir, which are commonly prescribed for genital herpes. Although these agents inhibit viral DNA replication, they cannot completely eliminate latent infection or prevent recurrence (Johnston et al. 2024). Given the high prevalence of HSV‐2 and the lack of effective treatment, it is crucial to explore novel strategies for the treatment and prevention of HSV‐2 infection.

Interferons (IFNs) represent the primary defence mechanism within the innate immune response and are essential for the host's antiviral immunity. Among them, type I interferons (IFN‐I), comprising IFN‐α and IFN‐β, bind to the IFN‐I receptor (IFNAR1/2), initiating a cascade of intracellular signalling events that transmit signals to the cell nucleus (Huber and David Farrar 2011). This process induces the expression of numerous interferon‐stimulated genes (ISGs), which actively participate in inhibiting viral replication. Recent research indicates that the activation of IFN‐I signalling primarily relies on pattern recognition receptors (PRRs) (McNab et al. 2015; Zhu et al. 2019). When a pathogen infects a cell, PRRs are activated, initiating the IFN‐I signalling cascade, activating intracellular antiviral gene expression (Ivashkiv and Donlin 2014; Crow and Stetson 2022). Recent studies have highlighted the role of nucleotide‐binding oligomerisation domain‐containing protein 2 (NOD2) as a classical PRR involved in antiviral innate immune responses (Zheng 2021). NOD2 is a cytosolic receptor that recognises bacterial peptidoglycan fragments, particularly muramyl dipeptide (MDP) (Caruso et al. 2014). Viral ssRNA genomes recognised by NOD2 receptor interact with mitochondrial antiviral signalling protein (MAVS), leading to the activation of interferon regulatory factor 3 (IRF3) and production of IFN‐β (Sabbah et al. 2009). Further research has shown that bacteria‐derived MDP can modulate human cytomegalovirus replication via the IFN‐I pathway (Kapoor et al. 2016). During HSV‐2 infection, the antiviral effects of IFN‐I are often limited. This limitation is primarily attributed to the virus's ability to establish latency in the neural ganglia and develop immune evasion mechanisms, resulting in recurrent infections throughout the host's lifetime (Tognarelli et al. 2019; Kadeppagari et al. 2012). Therefore, it is crucial to investigate the mechanisms by which the host activates IFN‐I to inhibit HSV‐2 infection during latent and steady‐state conditions.

Over the past several decades, an expanding body of literature has highlighted the role of the commensal microbiota in priming IFN‐I responses (Steed et al. 2017; Erttmann et al. 2022; Niu et al. 2023). Commensal bacteria passively reside within the host and exert antiviral effects by promoting the development of the immune system, regulating immune cell maturation and stimulating the secretion of immune factors (Bradley et al. 2019; Stefan et al. 2020; Spencer et al. 2019; Zhong et al. 2023; Winkler et al. 2020). Our previous study demonstrated that Lactobacillus rhamnosus GG (LGG) suppresses HSV‐2 infection by inducing IFN‐I expression (J. Wang et al. 2024), suggesting that commensal microbiota‐induced production of IFN‐I may represent a potential therapeutic approach for combating viral infections. However, the specific innate immune receptors responsible for sensing microbiota and priming IFN‐I responses in the host remain incompletely understood. Additionally, the mechanisms by which locally colonised LGG interacts with immune cells located at distant sites across the intestinal barrier to regulate systemic immune responses remain unclear.

Bacterial extracellular vesicles (EVs) serve as carriers for intercellular signal communication and play a role in various biological functions by delivering effector molecules that regulate host signalling pathways and cellular processes (van Niel et al. 2018; Mathieu et al. 2019; Pegtel and Gould 2019; Wen et al. 2023; Zhou et al. 2025). EVs play important roles in the pathogenesis of influenza virus and HIV infections, acting both as regulators of host defence and mediators of immune evasion (Jiang et al. 2020; Ñahui Palomino et al. 2019). In addition, they can serve as antigens for innate immune receptors, thereby stimulating host immunity (Barile and Vassalli 2017; Buzas 2022; Yamamoto et al. 2023). Notably, EV‐based therapies have gained attention as novel and safe strategies for treating cancer, cardiovascular disorders and infectious diseases (Herrmann et al. 2021; Cheng and Hill 2022; Kalluri and McAndrews 2023; H. Liu et al. 2025). Based on this evidence, we hypothesised that EVs derived from LGG (LGG‐EVs) can stimulate the production of IFN‐I, thereby enhancing host antiviral immunity. In this study, we demonstrated that the commensal microbiota are critical for innate resistance to viral infections. Additionally, we identified a specific molecular mechanism by which a commensal microbe induces IFN‐I production. Our findings demonstrated that LGG‐EVs induce systemic IFN‐I expression. Subsequent experiments revealed that LGG‐EVs contain MDP, which regulates the IFN‐I signalling pathway through NOD2, ultimately leading to the inhibition of HSV‐2 infection.

2. Materials and Methods

2.1. Bacterial Culture

LGG (ATCC 53103), a distinct strain within the Lactobacillus genus, is classified as a Gram‐positive, facultative anaerobe. LGG was cultured for 24 h at 37°C, 160 rpm/min under anaerobic conditions in MRS Liquid medium.

2.2. LGG‐EVs Isolation

To isolate LGG‐EVs, the bacterial culture was harvested by sequential centrifugation at 3000 × g, 15 min and 10,000 × g, 25 min, respectively. The supernatant was subsequently filtered through a 0.45 µm pore‐sized, sterile filter (Millipore, SLHV033RB, USA). The filtered supernatant was ultracentrifuged at 135,000 × g and 4°C for 70 min using an Optima XPN‐100 centrifuge (Beckman Coulter, USA), and washed with PBS to obtain the crude EVs. The purified EVs were filtered (0.45 µm) again before ultracentrifugation at 150,000 × g at 4°C for 2 h utilising a sucrose density gradient. The pelleted EVs were resuspended in phosphate‐buffered saline (PBS), and the total protein content was quantified employing a bicinchoninic acid (BCA) protein assay kit (Fdbio Science, FD2001, China). The LGG‐EVs were subsequently stored at −80°C for future applications.

2.3. Characterisation of LGG‐EVs Using Nanoparticle Tracking Analysis (NTA) and Transmission Electron Microscopy (TEM)

To analyse the size distribution of LGG‐EVs, the vesicle pellet was resuspended in 1 mL PBS to ensure uniform dispersion. Particle size distribution was assessed using an NTA (Malvern Panalytical), which provided a detailed characterisation of the sample.

According to the standard procedure, isolated LGG‐EVs were fixed in 4% paraformaldehyde. Fixed EVs were then applied onto carbon‐coated copper grids and allowed to adsorb for 10 min to allow for specimen attachment. The grids were subsequently stained with 2% uranyl acetate for 1 min to improve visual contrast. Finally, the prepared specimens were imaged using a TEM system (Hitachi H‐7650, Japan) to assess vesicle morphology.

2.4. Inhibition of LGG‐EVs Secretion

LGG was cultured under anaerobic conditions. GW4869 (20 µM) (J. Liu et al. 2021; Hong et al. 2023) or vehicle control (dimethyl sulfoxide, 0.1% DMSO) was added to the medium. After 24 h, the cultures were centrifuged at 3000 × g for 15 min, followed by 10,000 × g for 25 min. The supernatant was filtered through a 0.45 µm sterile filter.

2.5. Cell Culture Experiments

HEK293T cells (catalogue number SCSP‐502, Shanghai Institute of Biochemistry and Cell Biology, China), RAW264.7 cells (catalogue number SCSP‐5036, Shanghai Institute of Biochemistry and Cell Biology, China) and Vaginal epithelial cells (VK2/E6E7) (Procell Life Science&Technology, CM‐1024, China) were cultured in Dulbecco's Modified Eagle's Medium (DMEM; catalogue number 12800017, Gibco, USA), supplemented with 10% foetal bovine serum (FBS; catalogue number 10099, Gibco, USA). The cell cultures were maintained at 37°C in a humidified atmosphere containing 5% carbon dioxide in a cell culture incubator (model MCO‐170ACL‐PC, PHCbi, Japan).

As previously described, to explore the potential of LGG‐EVs in protecting against HSV‐2 infection, we investigated their ability to stimulate NOD2‐IFN‐I signalling pathways in vitro. HEK293T cells were first transfected with small interfering RNA (siRNA) targeting NOD2 (siNOD2, 50 nM) (RiboBio, China) for 12 h to achieve siRNA‐mediated knockdown. Subsequently, LGG‐EVs (20 µg/mL) were added to the cells and incubated for an additional 2 h to assess stimulation of the cellular response. Cells were then harvested for RNA extraction (ER701‐01, TransGen Biotech, China), and ISG expression was analysed using quantitative reverse transcription polymerase chain reaction (qRT‐PCR).

To explore whether MDP‐containing LGG‐EVs inhibit HSV‐2 infection by inducing the NOD2‐IFN‐I signalling pathway, HEK293T cells were transfected with siNOD2 (50 nM) for 12 h, followed by treatment with MDP (50 µg/mL; 53678‐77‐6, InvivoGen, France), the NOD2 ligand Mifamurtide (60 µM; HY‐13682, MedChemExpress, USA) for 5 h. RNA was extracted and ISGs expression was analysed using qRT‐PCR. In a subsequent experiment, we incubated HEK293T cells with MDP (50 µg/mL), Mifamurtide (60 µM) for 5 h before infection with HSV‐2 (MOI = 1). The viral DNA copy number in the supernatant of HSV‐2‐infected HEK293T cells was quantified using qRT‐PCR to evaluate the effect of MDP on viral replication.

2.6. Broad Spectrum Antibiotic (ABX) Treatment in Specific Pathogen‐Free (SPF) Mice

To establish a microbiota‐depleted SPF mouse model, ABX was administered after 1‐week acclimatisation. The ABX cocktail consists of four antibiotics: neomycin (1 g/L), ampicillin (1 g/L), metronidazole (1 g/L) and vancomycin (0.5 g/L), dissolved in sterilised water. Mice were orally administered a daily dose of 200 µL ABX solution for 10 consecutive days. Throughout the treatment period, regular and careful monitoring of the mice was conducted to detect any changes in body weight and overall health status. Following the cessation of the ABX treatment, antibiotics were replaced with sterilised water to facilitate re‐colonisation of the target microbiota.

2.7. Mouse Model of HSV‐2 Infection

Female C57BL/6 mice were procured from the Animal Experimental Centre of Southern Medical University. IFNAR1‐knockout (Ifnαr1−/−) mice, on a C57BL/6 background, were used alongside wild‐type (WT) controls. All mice were tested in adulthood (6–8 weeks of age), and only female mice were used in this study. All animals were housed under SPF conditions with a strict 12 h light/12 h dark shift and access to sterilised water and food ad libitum. All animal experimental protocols were approved by the ethics committee of Southern Medical University (Approval No. SMUL2021045). Animal care and all procedures were conducted in strict accordance with Southern Medical University animal care guidelines.

To establish a model of HSV‐2 infection, C57BL/6 female mice were administered a subcutaneous injection of medroxyprogesterone acetate (2 mg in sterile PBS; XianJu Pharmaceutical Co., Ltd., Taizhou, China) into the thigh 7 days prior to infection. On the seventh day post‐injection, mice were anaesthetised via intraperitoneal injection of 2% pentobarbital sodium. The mice then received a vaginal instillation of HSV‐2 at a concentration of 1.92 × 107 plaque‐forming units (PFU)/mL, administered as two separate 10 µL doses per mouse. Body weight, clinical signs and symptoms, and survival were monitored daily. Disease severity was scored using previously established criteria: 0 (healthy), 1 (genital erythema), 2 (moderate genital inflammation), 3 (genital lesions), 4 (hind limb paralysis) and 5 (death) (Shestakov et al. 2012). Vaginal swabs were taken on Days 5 and 10 post‐infection, and HSV‐2 DNA was extracted and analysed using qRT‐PCR. All clinical assessments were performed in a blinded fashion, and the disease severity scores were statistically analysed using two‐way analysis of variance (ANOVA).

2.8. RNA Extraction and qRT‐PCR Analysis

Following 10 days of ABX treatment, mice in each group were treated with PBS (200 µL, per mouse) or LGG‐EVs (100 µg, 200 µL per mouse) every other day for 14 days. Mice were then sacrificed, and the spleen, mesenteric lymph nodes (mLNs), and colon were collected for analysis. Total RNA was extracted using the EasyPure RNA purification kit (ER701‐01, TransGen Biotech, China). Complementary DNA was synthesised using Evo M‐MLV RT Master Mix (AG11706, Accurate Biology, China), and qRT‐PCR was performed using the LightCycler 480 II system (Roche, Switzerland) with SYBR Green Pro Taq HS qPCR Kit III (AG11739, Accurate Biology, China). Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was used as the internal control. Fold‐changes in gene expression levels were quantified using the 2−(ΔΔCt) method, with normalisation to GAPDH. All gene‐specific primers used in this experiment are listed in Table 1.

TABLE 1.

Gene primer set for qRT‐PCR.

Gene Forward/reverse Mouse sequence (5' to 3') Human sequence (5' to 3')
GAPDH Forward GACCATAGGGGTCTTGACCAA CACCCACTCCTCCACCTTT
Reverse AGACTTGCTCTTTCTGAAAAGCC CTTCCTCTTGTGCTCTTGC
NOD2 Forward ACGATGTCTTCCAGTTCCTTCTTGA CACCGTCTGGAATAAGGGTACT
Reverse GCAGGCATTCTTCAGCAGGTTC TTCATACTGGCTGACGAAACC
IFN‐β Forward CAGCTCCAAGAAAGGACGAAC GCTTGGATTCCTACAAAGAAGCA
Reverse GGCAGTGTAACTCTTCTGCAT ATAGATGGTCAATGCGGCGTC
MX1 Forward GACCATAGGGGTCTTGACCAA GGTGGTCCCCAGTAATGTGG
Reverse AGACTTGCTCTTTCTGAAAAGCC CGTCAAGATTCCGATGGTCCT
IFIT1 Forward CTGAGATGTCACTTCACATGGAA AGAAGCAGGCAATCACAGAAAA
Reverse GTGCATCCCCAATGGGTTCT CTGAAACCGACCATAGTGGAAAT
IRF7 Forward GAGACTGGCTATTGGGGGAG GCTGGACGTGACCATCATGTA
Reverse GACCGAAATGCTTCCAGGG GGGCCGTATAGGAACGTGC
OASL2 Forward TTGTGCGGAGGATCAGGTACT CCATTGTGCCTGCCTACAGAG
Reverse TGATGGTGTCGCAGTCTTTGA CTTCAGCTTAGTTGGCCGATG
IRF3 Forward CACGCTACACTCTGTGGTTCTG ——
Reverse GGAGATAGGCTGGCTGTTGGA ——
RIPK2 Forward CTCCTCGTGTTCCTTGGCTGTA ——
Reverse CATCTGGCTCACAATGGCTTCC ——
HSV‐2 gG Forward CCCACACCCCAACACATC
Reverse CCAAGGCGACCAGACAAAC
Open in a new tab

2.9. Confocal Microscopy

HEK293T cells were treated with LGG‐EVs (20 µg/mL), IFN‐β (125 ng/mL) or PBS for 12 h before HSV‐2 infection. Cells were then washed and fixed with 4% paraformaldehyde in confocal culture dishes, permeabilised using 0.3% Triton X‐100, and blocked with 5% bovine serum albumin prior to staining overnight at 4°C using mouse monoclonal antibody targeting glycoprotein B (gB) of HSV1/HSV2 (ab6506, Abcam, UK). Cells were then incubated with goat anti‐mouse fluorescein isothiocyanate‐conjugated secondary antibody (FITC; SSA020, Sino Biological, China) for 1 h, followed by staining with 4′,6‐diamidino‐2‐phenylindole (DAPI; C1005, Beyotime, China) for 15 min.

2.10. Western Blotting

Cells were lysed using radioimmunoprecipitation assay (RIPA) buffer (FD008, Beyotime, China) supplemented with a cocktail of protease and phosphatase inhibitors (HLSP1025, Beyotime, China). Lysates were centrifuged at 14,000 × g for 20 min to remove cellular debris. The protein concentration of the resulting supernatant was quantified using a BCA protein assay kit (FD2001, FDBio Science, China). After 10% sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS‐PAGE), protein samples were transferred onto polyvinylidene fluoride (PVDF) membranes (EMD Millipore, Billerica, Massachusetts, USA). Membranes were blocked and then incubated with a mouse monoclonal antibody against gB of HSV1/HSV2 (ab6506, Abcam, UK) at 4°C for 16 h. Subsequently, membranes were incubated with a secondary antibody (Goat Anti‐Rabbit IgG (H+L) HRP (Affinity, S0001, China)) at room temperature for 60 min. Detection of immunoreactive bands was performed using a Bio‐Rad detection system. Densitometric analysis of grey values of images was performed using ImageJ software (V1.8.0.112, USA).

2.11. Enzyme‐Linked Immunosorbent Assay (ELISA)

To analyse MDP levels of EVs, pelleted EVs were resuspended in 1 mL of PBS and further diluted to a concentration of 10 µg/µL. The concentration of MDP in LGG‐EVs was measured using an ELISA kit (RE8952, Elabscience, China).

2.12. Statistical Analysis

For statistical analysis, GraphPad Prism software (GraphPad Prism 9.0, USA) was utilised. The student's t‐test was used for comparing two groups, while one‐way ANOVA and two‐way ANOVA were utilised to discern differences among multiple groups. A p value of less than 0.05 was considered to indicate statistical significance. Error bars, ± Standard error of measurement (SEM).

3. Results

3.1. Mice with Depleted Commensal Microbiota Are More Susceptible to HSV‐2 Infection

The body is colonised by a diverse population of commensal microbiota, and the intricate interplay between the microbial inhabitants and the host immune system is essential for maintaining general health and modulating immune responses. To investigate the contribution of commensal microbiota in regulating the host immune defence against HSV‐2, we eliminated the gut microbiota in WT mice via oral administration of ABX (The broad‐spectrum antibiotic cocktail consists of four broad spectrum antibiotics: neomycin (1 g/L), ampicillin (1 g/L), metronidazole (1 g/L) and vancomycin (0.5 g/L). Subsequently, the mice were infected with HSV‐2 through vaginal instillation. The findings revealed that mice treated with ABX displayed an elevated susceptibility to disease relative to those treated with PBS. Specifically, the ABX‐treated mice exhibited a significantly higher incidence of disease and elevated daily paralysis scores (Figure 1A,B), as well as decreased survival rates and increased cumulative disease scores (Figure 1C,D). Furthermore, the treatment with ABX resulted in a significant increase in viral titres in the infected mice, with higher HSV‐2 levels observed 10 days post‐infection (Figure 1E). These findings were further validated using hysterovaginal fluorescence imaging (Figure 1F). Histological examination using haematoxylin and eosin (H&E) staining revealed that the uterine and vaginal tissues appeared loose. The cells in the infected areas exhibited deformation, with condensed nuclei, reduced cell numbers, and enlarged intercellular spaces. Some cells may have been shed, and there was a significant infiltration of inflammatory cells.

FIGURE 1.

FIGURE 1

Open in a new tab

Mice with depleted commensal microbiota exhibit increased susceptibility to HSV‐2 infection. WT mice were subjected to a treatment with ABX (neomycin (1 g/L), ampicillin (1 g/L), metronidazole (1 g/L) and vancomycin (0.5 g/L) to deplete their commensal microbiota, followed by infection with HSV‐2. (A–C) The incidence of paralysis, daily paralysis scores and survival rates among the mice are presented as percentages. (D) For each mouse, the aggregate disease score, which is the sum of the daily disease scores from the onset of infection through the 20th day (20 d.p.i.) was determined. (E) The DNA copy number of HSV‐2 in mouse vaginal swabs was extracted and then analysed by qRT‐PCR. (F) WT mice were infected with HSV‐2 after depleting the commensal microbiota via treatment with ABX. Subsequently, the hysterovaginal were collected and stained with FITC and DAPI and photographed using confocal fluorescence microscopy. The microscopic images bar measured at 200 µm. Presented are representative images from three independently conducted. (G) HSV‐2‐associated lesions are depicted in representative H&E‐stained images. Microscopic scale bars, 50 and 200 µm. The images displayed are representative of three individual experimental replicates. The log‐rank test was employed to determine p values for the comparison between ABX and PBS groups (A and C). Linear regression analysis was utilised to calculate p values between ABX and PBS (B). One‐way ANOVA was applied to assess statistical significance (D and E). ns, indicate not significant; ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001. Error bars, ± SEM.

(Figure 1G). Taken together, these data demonstrate that depletion of the commensal microbiota using ABX results in more severe clinical symptoms and increased susceptibility to HSV‐2 infection. These results highlight the pivotal role of commensal microbiota in enhancing innate immunity and conferring resistance to viral infections.

3.2. LGG Modulates the Host IFN‐I Response via EVs Secretion, Thereby Influencing Viral Infection

In our previous research, we demonstrated that LGG can regulate the expression of IFN‐I in the host, thereby exhibiting antiviral effects. However, the specific molecular mechanism by which LGG induces IFN‐I production remains unclear. Bacterial EVs, are small lipid bilayer‐sheathed sacs secreted by bacteria. We speculated that LGG‐derived EVs may be instrumental in transporting bacterial molecules across cellular barriers and tissues, thereby activating the IFN‐I pathway both locally and systemically. To evaluate this hypothesis, we employed a Transwell system to prevent direct contact between bacterial and host cells to evaluate the effect of LGG on IFN‐I and ISGs in RAW264.7 cells (Figure 2A). The results demonstrated that LGG culture supernatant (LGG‐sup.) still induced an IFN‐I response (Figure 2B). Furthermore, we used EVs inhibitor (GW4869, 20 µM) to suppress the release of EVs. Interestingly, when EVs release was inhibited (Figure S1), no significant alterations were observed in the expression levels of IFN‐I (Figure 2B). This suggests that EVs derived from LGG may be involved in regulating the IFN‐I response. To further elucidate the immunomodulatory potential of LGG‐EVs, we isolated and purified EVs from the LGG‐sup. and characterised them using NTA and TEM. The data indicated that the isolated particles displayed morphologies typical of EVs (Figure 2C,D). Next, we employed qRT‐PCR to analyse the expression of IFN‐I and ISGs in mice treated with ABX and subsequently administered LGG‐EVs (100 µg, 200 µL per mouse). Results demonstrated a significant upregulation in the expression levels of IFN‐β and ISGs (including ISG15, MX1, IFIT1 and IRF7) in the spleen and colon of mice treated with LGG‐EVs compared with mice treated with PBS (Figure 2E,F). Furthermore, in vitro experiments involving co‐incubation of RAW264.7 cells with LGG‐EVs (20 µg/mL) led to a significant upregulation in the expression levels of IFN‐β and ISGs, as determined by qRT‐PCR (Figure 2G). Collectively, Figure 2E–G support that LGG‐EVs can specifically regulate the IFN‐I response both in vivo and in vitro.

FIGURE 2.

FIGURE 2

Open in a new tab

LGG‐EVs induce host IFN‐I expression. (A) Schematic illustration of how EVs in LGG‐sup. regulate IFN‐I and ISG expression in RAW264.7 cells using a Transwell system. (B) RAW264.7 cells were incubated for 2 h with PBS, LGG‐sup., or LGG pretreated with the EVs inhibitor (GW4869, 20 µM) for 24 h. Subsequently, the expression levels of IFN‐β and ISGs were analysed using qRT‐PCR. Relative gene expression levels were determined using the 2−(ΔΔCt) method, normalised to PBS‐treated controls, with GAPDH serving as the endogenous control. (C, D) Characterisation of LGG‐EVs isolated from culture supernatants using NTA and TEM. Scale bars: 100 nm. (E, F) Total RNA was isolated from the spleens and colons of WT mice treated with either PBS (200 µL, per mouse) or LGG‐EVs (100 µg, 200 µL per mouse), starting 14 days post antibiotic ABX treatment. The expression levels of ISGs were measured using qRT‐PCR, and fold changes were calculated using the 2−(ΔΔCt) method, with GAPDH as the reference gene and PBS‐treated group as controls. (G) RAW264.7 cells were treated with PBS, LGG‐EVs (20 µg/mL), or IFN‐β (125 ng/mL). qRT‐PCR was employed to assess the expression of IFN‐β and ISGs. Gene expression was normalised to GAPDH using the 2−(ΔΔCt) method. Multiple t‐tests and one‐way ANOVA were utilised for initial statistical analyses, followed by Tukey's multiple comparisons test to determine p values for panels (B, E–G). The term “ns” indicates not significant; asterisks denote statistical significance as follows: ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001. Error bars represent mean ± SEM.

3.3. LGG‐EVs Effectively Suppress HSV‐2 Infection In Vitro

To determine whether modulation of IFN‐I expression by LGG‐EVs influences HSV‐2 infection, HEK293T and VK2/E6E7 cells were treated with LGG‐EVs prior to viral challenge. Infection levels were assessed using qRT‐PCR, western blotting, and confocal fluorescence microscopy. qRT‐PCR results indicated a significant decrease in HSV‐2 titres following LGG‐EVs treatment (Figure 3A,D). The results of qRT‐PCR were also validated using western blotting analysis (Figure 3B,C,E,F) and confocal fluorescence microscopy (Figure 3G,H). These results illustrate that LGG‐EVs suppress HSV‐2 infection in vitro.

FIGURE 3.

FIGURE 3

Open in a new tab

LGG‐EVs offer protective effects and suppress HSV‐2 infection in vitro. HEK293T and VK2/E6E7 cells were pre‐treated with LGG‐EVs (20 µg/mL) for 2 h before being infected with HSV‐2 (MOI = 1). (A, D) HSV‐2 DNA copy number was analysed by qRT‐PCR. (B, C and E, F). Western blotting analysis of HSV‐2 gB levels in HEK293T and VK2/E6E7 cells treated with LGG‐EVs (20 µg/mL) or IFN‐β (125 ng/mL, as positive control) are shown, and the data were assessed using ImageJ software. (G) HEK293T cells with LGG‐EVs (20 µg/mL), PBS, or IFN‐β (125 ng/mL) for 2 h, and then the cells were infected with HSV‐2 (MOI = 1) for 18 h. Cells were then stained with FITC and DAPI, and their fluorescence was captured by confocal microscopy. Scale bars: 20 µm. Representative images from three independent experiments are shown. (H) Mean fluorescence intensity was assessed using ImageJ software. For statistical analysis, multiple t‐tests and one‐way ANOVA were employed to determine the p values for panels A, C and E. The term “ns” indicates not significant; asterisks denote the levels of significance: ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001. Data are presented as mean ± SEM.

3.4. LGG‐EVs Stimulate IFN‐I Production, Enhancing Resistance to HSV‐2 Infection In Vivo

To further elucidate the ability of LGG‐EVs to enhance host defence mechanisms against HSV‐2 infection via induction of IFN‐I expression, we included both WT and Ifnαr1−/− mice in our study. Mice were treated with LGG‐EVs via intragastric gavage (i.g.) on alternate days for 14 days prior to HSV‐2 challenge (Figure 4A). In WT mice, the administration of LGG‐EVs significantly reduced disease severity compared with PBS controls. This included a lower incidence of disease, reduced daily and cumulative paralysis scores (Figure 4B,C,E), as well as improved survival rates (Figure 4D). qRT‐PCR analysis of vaginal swabs at 5 days and 10 days post‐infection showed significantly reduced HSV‐2 titres in LGG‐EVs‐treated mice (Figure 4F,G). Hysterovaginal fluorescence sections of the vaginal tissue post‐infection also confirmed the protective effects of LGG against HSV‐2 infection in vivo (Figure 4H). In contrast, Ifnαr1−/− mice treated with LGG‐EVs showed increased disease susceptibility compared to LGG‐EVs treated WT mice, with increased incidence of disease, daily and cumulative paralysis scores (Figure 4B,C,E) and reduced survival (Figure 4D), as confirmed by hysterovaginal fluorescence imaging (Figure 4H). By H&E staining, we observed that in WT mice following HSV‐2 infection, the uterine and vaginal tissues appeared loose. The cells in the infected areas exhibited deformation, with condensed nuclei, reduced cell numbers and enlarged intercellular spaces. Some cells may have been shed, and there was a significant infiltration of inflammatory cells. However, Histological analysis with H&E staining revealed that in Ifnαr1−/− mice, tissue lysis and inflammatory cell infiltration were not alleviated by treatment (Figure 4I). These results collectively demonstrate that the antiviral efficacy of LGG‐EVs is mediated via the IFN‐I signalling pathway.

FIGURE 4.

FIGURE 4

Open in a new tab

LGG‐EVs modulate IFN‐I signalling in HSV‐2‐infected mice. WT and Ifnαr1−/− mice were treated with LGG‐EVs (100 µg, 200 µL per mouse) via i.g. on alternate days for 14 days prior to HSV‐2 infection. (A) Schematic illustration of WT and Ifnαr1−/− mice receiving LGG‐EVs or PBS treatments. (B–D) Mice were closely monitored daily to record the percentage of mice exhibiting disease incidence, paralysis scores and survival rates. (E) Cumulative disease score per mouse, calculated as the aggregate of daily disease scores over 20 d.p.i. (F, G) HSV‐2 DNA copy number in mouse vaginal swabs at 5 and 10 d.p.i. analysed by qRT‐PCR. (H) Hysterovaginal tissues were collected and stained with FITC and DAPI for confocal fluorescence microscopy. Scale bar: 200 µm. Images are representative of three separate experiments. (I) H&E‐stained sections reveal HSV‐2‐associated lesions in the uterine and vaginal tissues. Scale bars: 50 and 200 µm. Statistical analyses were conducted as follows: log‐rank test (B, D), linear regression analysis (C) and one‐way ANOVA (G, H). The term “ns” indicates not significant; asterisks denote the levels of significance: ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001. Data are presented as mean ± SEM.

3.5. LGG‐EVs Inhibit HSV‐2 Infection by Regulating the IFN‐I Signalling Pathway via NOD2

To investigate the molecular mechanisms by which LGG‐EVs modulate IFN‐I responses to inhibit HSV‐2 infection, we conducted transcriptomic analysis of RAW264.7 cells treated with LGG‐EVs. Overall, Gene Ontology (GO) enrichment analysis revealed that LGG‐EVs treatment notably enhanced the expression of genes involved in immune regulatory processes, indicating a significant impact on biological pathways related to immune modulation (Figure 5A). In addition, Kyoto Encyclopaedia of Genes and Genomes (KEGG) enrichment analysis demonstrated that the NOD signalling pathway was upregulated in RAW264.7 cells (Figure 5B). In our study, qRT‐PCR analysis revealed that NOD2 and its downstream classical molecules RIPK2 and IRF3 were upregulated in RAW246.7 cells of treated with LGG‐EVs (Figure 5C–E). Similarly, treatment with LGG‐EVs resulted in the upregulation of NOD2, RIPK2 and IRF3 expression in the Colon, Spleen and mLN of mice (Figure 5F–H). To confirm the functional role of NOD2, we silenced NOD2 expression using siNOD2 (Figure 5I–K). Subsequently, stimulation of HEK293T cells with LGG‐EVs showed significantly reduced expression of IFN‐β and ISGs (including ISG15 and MX1) (Figure 5L–O). Furthermore, knockdown of NOD2 abrogated the antiviral effect of LGG‐EVs, as evidenced by a significant increase in HSV‐2 DNA levels relative to the LGG‐EVs treated group (Figure 5P). Similar results were also confirmed in animal experiments. We treated mice with the NOD2 signalling inhibitor GSK717 to block the NOD2 signalling pathway. The results indicated that blocking the NOD2 signalling pathway by GSK717, the ability of LGG‐EVs to inhibit HSV‐2 infection was similarly abolished (Figure 5Q–U). These results demonstrate that LGG‐EVs inhibit HSV‐2 infection by activating the NOD2‐IFN‐I signalling pathway in vivo and in vitro.

FIGURE 5.

FIGURE 5

Open in a new tab

LGG‐EVs inhibit HSV‐2 infection by regulating the IFN‐I signalling pathway via NOD2. (A, B) RAW264.7 cells were treated with LGG‐EVs or PBS. Transcriptomic analysis was performed to assess gene expression changes. GO enrichment analysis revealed that LGG‐EVs treatment notably upregulated genes involved in immune regulatory processes. KEGG enrichment analysis demonstrated activation of NOD2 signalling pathway. (C–E) RAW264.7 cells were treated with PBS, LGG‐EVs (20 µg/mL), or IFN‐β (125 ng/mL), and NOD2, RIPK2 and IRF3 expression was assessed by qRT‐PCR. Relative gene expression levels were determined employing the 2−(ΔΔCt) method, with GAPDH as the housekeeping gene for normalisation. (F–H) Total RNA were extracted from the Colon, Spleen, and mLN of WT mice treated with either PBS or LGG‐EVs (100 µg, 200 µL per mouse) for 14 days following an antibiotic (ABX) course. The expression of NOD2, RIPK2 and IRF3 was then analysed using qRT‐PCR using the 2−(ΔΔCt) method and normalised to GAPDH. (I–K) The knockdown efficiency of NOD2 was evaluated in HEK293T cells 24 h after siNOD2 transfection, using qRT‐PCR and western blotting analyses, and the data were assessed using ImageJ software. (L–O) After siNOD2 pretreatment, HEK293T cells were incubated with either PBS or LGG‐EVs (20 µg/mL) for 2 h. Expression of IFN‐β and ISGs was quantified by qRT‐PCR. (P) HEK293T cells pretreated with siNOD2 or PBS for 12 h, were incubated with either PBS or LGG‐EVs (20 µg/mL) for 2 h, followed by HSV‐2 infection. Viral DNA copy number within HEK293T cells was assessed by qRT‐PCR. (Q–U) Mice were treated with the NOD2 signalling pathway inhibitor GSK717 (5 mg/Kg body weight). Subsequently, the mice were subjected to i.g. with LGG‐EVs (100 µg, 200 µL per mouse) every other day for a total of 14 days prior to HSV‐2 infection. (Q–S) Mice were closely monitored daily to record the percentage of mice exhibiting disease incidence, survival rates and paralysis scores. (T) Cumulative disease score per mouse, calculated as the aggregate of daily disease scores over 20 d.p.i. (U) HSV‐2 DNA copy number in mouse vaginal swabs at 5 d.p.i. analysed by qRT‐PCR. Multiple t‐tests and one‐way ANOVA were initially employed for statistical analysis, followed by Tukey's multiple comparisons test to calculate p values. The term “ns” indicates not significant; asterisks denote the levels of significance: ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001. Error bars represent the mean ± SEM.

3.6. LGG‐EVs Containing MDP Inhibit HSV‐2 Infection by Activating the NOD2‐IFN‐I Signalling Pathway

Bacterial EVs contribute significantly to the onset and progression of infectious diseases (Jiang et al. 2020; Cheng and Hill 2022; J. Wang et al. 2019). However, the specific components of LGG‐EVs responsible for this immunomodulatory effect remained to be determined. MDP, the minimal bioactive motif of peptididoglycan, binds to NOD2 and activates various downstream pathways, having also been shown to restrict human cytomegalovirus replication (Kapoor et al. 2016). In our study, ELISA analysis confirmed that LGG‐EVs contain MDP (Figure 6A). Next, we analysed the effect of MDP on NOD2‐IFN‐I signalling and viral infection. HEK293T cells were treated with MDP and Mifamurtide (NOD2 ligand as a positive control), and qRT‐PCR was performed to assess IFN‐I expression and viral infection levels. The results confirmed that both MDP and Mifamurtide significantly increased the expression of IFN‐β and downstream ISGs (including ISG15, MX1 and OASL2). However, with the use of siNOD2, these responses were abolished (Figure 6B–E). Next, qRT‐PCR was used to assess the level of viral infection. As depicted in Figure 6F, HSV‐2 DNA content was significantly reduced after treatment with MDP and Mifamurtide. These results suggest that LGG‐EVs inhibit HSV‐2 infection by MDP, which activates the NOD2‐IFN‐I signalling pathway.

FIGURE 6.

FIGURE 6

Open in a new tab

MDP‐containing LGG‐EVs inhibit HSV‐2 infection by activating the NOD2‐IFN‐I signalling pathway. (A) ELISA analysis confirmed that MDP are present within LGG‐EVs. (B–E) HEK293T cells were transfected with siNOD2 (50 nM) for 12 h, followed by treatment with PBS, MDP (50 µg/mL) or Mifamurtide (NOD2 ligand used as a positive control, 60 µM) for 5 h. qRT‐PCR was employed to assess the expression levels of IFN‐β and ISGs. Relative gene expression was calculated employing the 2− (ΔΔCt) method, with GAPDH as the internal control. (F) HSV‐2 DNA copy number in HEK293T cells was determined using qRT‐PCR following treatment with PBS, MDP (50 µg/mL) or Mifamurtide (60 µM) for 5 h before with HSV‐2 (MOI = 1). Multiple t‐tests and one‐way ANOVA were initially conducted for statistical analysis, followed by Tukey's multiple comparisons test to determine the p values for panels. The term “ns” indicates not significant; asterisks denote the levels of significance: ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001. Error bars represent the mean ± SEM.

4. Discussion

Following infection, HSV‐2 infiltrates peripheral sensory nerve endings and establishes latency in the sacral ganglia, thereby eluding immune system detection and hindering effective clearance by the host immune response (Gupta et al. 2007; Connolly et al. 2021; Tognarelli et al. 2019). Currently, there are no approved vaccines available for the prevention or treatment of HSV‐2 infection. Previous investigations have demonstrated the widespread involvement of the commensal microbiota and its derived bioactive molecules in various aspects of immunity and metabolism, as well as its crucial role in maintaining the local intestinal environment, intestinal function and overall health (Steed et al. 2017; Bradley et al. 2019; Stefan et al. 2020). In this study, we showed a significant increase in HSV‐2 infection when ABX were used to deplete the commensal microbiota in WT mice (Figure 1), suggesting that the microbiota actively inhibits HSV‐2 infection in the host. These findings provide new insights into the mechanisms by which the host–microbiota axis may stimulate the immune responses to suppress HSV‐2 under both dormant and homeostatic conditions. However, the exact mechanisms by which commensal bacteria influence HSV‐2 infection remain unclear.

Previous research has demonstrated the positive effects of LGG in regulating the host immune system in both the gut and reproductive tracts, as well as in preventing infections caused by pathogenic microbes (Capurso 2019; Si et al. 2022; Llewellyn and Foey 2017). Our prior work confirmed that LGG enhances resistance to HSV‐2 infection via the induction of IFN‐I (J. Wang et al. 2024). Therefore, in this study, we investigated the specific components of LGG responsible for this antiviral effect and aimed to elucidate their underlying mechanisms of action. Bacterial EVs serve as carriers of intercellular communication signals and play a role in diverse biological functions by delivering effector molecules that regulate signalling pathways and cellular responses in host cells. Notably, EVs derived from Lactobacillus species can protect human cervico‐vaginal tissues from HIV‐1 infection (Ñahui Palomino et al. 2019). Based on these observations, we hypothesised that LGG may regulate IFN‐I expression through the secretion of EVs into the culture supernatant, thereby modulating HSV‐2 infection. To test this hypothesis, we used a Transwell system and GW4869 (a specific inhibitor of EVs secretion), and demonstrated that EVs derived from LGG specifically regulate the expression of IFN‐I (Figure 2A,B). Furthermore, WT female mice treated with LGG‐EVs showed upregulation of ISGs in various tissues and organs, indicating a systemic antiviral effect. Consistent results were obtained from cellular experiments, supporting that LGG‐EVs modulate the expression of IFN‐I in vivo and in vitro (Figure 2).

Subsequently, we analysed whether the modulation of IFN‐I by LGG‐EVs influences HSV‐2 infection. As shown in Figure 3, in vitro results demonstrated a significant decrease in the viral titre in the HEK293T and VK2/E6E7 cell supernatant following treatment with LGG‐EVs. In vivo experiments (Figure 4) showed that administration of LGG‐EVs to WT mice treated with ABX increased survival and alleviated clinical symptoms in HSV‐2‐infected mice. In contrast, ABX‐treated Ifnar1−/− mice exhibited unaltered levels of HSV‐2 infection, following LGG‐EVs treatment. These results suggest that LGG‐EVs modulate HSV‐2 infection through the IFN‐I signalling pathway.

Next, we investigated the mechanism by which LGG‐EVs regulate IFN‐I signalling to influence viral infection using transcriptomic analysis. Via transcriptomics, we revealed that LGG‐EVs treatment altered the expression of immune‐related genes, including those involved in the NOD signalling pathway in RAW264.7 cells (Figure 5A,B). During viral infection, NOD2 can recruit RIPK2 and subsequently activates IRF3, which in turn induces the IFN‐I signalling pathway, initiating the transcription of ISGs and exerting antiviral effects. In support of this finding, our data from both cellular and animal models confirmed that LGG‐EVs upregulate NOD2 and its downstream classical molecules RIPK2 and IRF3, thereby inducing the NOD2‐IFN‐I signalling pathway (Figure 5C–H). Knocking down NOD2 expression using siRNA significantly reduced the expression of IFN‐β and downstream ISGs (Figure 5L–O), Furthermore, knockdown of NOD2 abrogated the antiviral effect of LGG‐EVs, (Figure 5P). Similar results were also confirmed in animal experiments. We treated mice with the NOD2 signalling inhibitor GSK717 to block the NOD2 signalling pathway. the ability of LGG‐EVs to inhibit HSV‐2 infection was similarly abolished (Figure 5Q–U). These results demonstrate that LGG‐EVs inhibit HSV‐2 infection by activating the NOD2‐IFN‐I signalling pathway in vivo and in vitro.

EVs contain bioactive molecules, including proteins, nucleic acids and lipids, that influence disease development, particularly in the context of infectious diseases(Y. Wang et al. 2025; L. Liu et al. 2025). Here, we confirmed that LGG‐EVs inhibit HSV‐2 infection through activation of the NOD2‐IFN‐I signalling pathway. However, the specific molecular components within LGG‐EVs that trigger this host response remain to be identified and warrant further investigation. Previous studies have confirmed that the cytoplasmic protein NOD2 is required for MDP recognition (Wolf 2023; Chamaillard et al. 2003; Gao et al. 2023). As shown in Figure 6A, LGG‐EVs contain MDP. Furthermore, we demonstrated that treatment of HEK293T with purified MDP led to upregulation of antiviral ISGs and inhibition of HSV‐2 replication (Figure 6B–F). However, when NOD2 was knocked down using siRNA, the expression levels of ISGs were significantly reduced in cells (Figure 6B–E). These results confirm that LGG‐EVs containing MDP regulate the expression of IFN‐I through the NOD2 signalling pathway, thereby inhibiting HSV‐2 infection. This study has certain limitations. Although we confirmed the presence of MDP in LGG‐EVs and its involvement in upregulating the NOD2‐IFN‐I signalling pathway, we did not construct MDP‐deficient LGG strains to generate MDP‐deficient EVs. These limitations will be addressed in future studies.

5. Conclusion

In conclusion, we have demonstrated that LGG‐EVs containing MDP can activate the NOD2‐IFN‐I signalling pathway to suppress HSV‐2 infection. Moreover, LGG‐EVs offer several potential advantages for the treatment of HSV‐2 infection, including low immunogenicity, the capacity to serve as drug carriers, and high biocompatibility. However, the clinical translation of LGG‐EVs faces numerous challenges(Huang et al. 2025; Xie et al. 2023). Firstly, the production efficiency of EVs is relatively low, and the purification process is complex and expensive. Therefore, it is necessary to establish efficient EVs production systems and optimise purification efficiency. Secondly, regarding drug delivery, various administration routes need to be explored, and formulations must be optimised to ensure their stability and bioavailability in vivo. Further clinical trials are essential to evaluate the efficacy and safety of such treatments. As a potential therapeutic strategy against HSV‐2, LGG‐EVs show great promise. With technological innovations and clinical validation, LGG‐EVs could be transformed into an effective treatment for HSV‐2 infection, offering patients improved and safer therapeutic options.

Author Contributions

Lei Zheng, Xiumei Hu and Jingyu Wang conceived the idea. Jingyu Wang, Haoming Chen and Mei Huang contributed to designing and performing the experiments. Yuqi Du, Ruyi Zhang, Yiyi Huang, Yuling Lin, Ruoru Pan, Yubing Wang, Wanqin Cui, contributed analysis with constructive discussions. Jingyu Wang, Haoming Chen, Mei Huang and Xiumei Hu contributed significantly to the analysis results and manuscript preparation. Qian Wang, Lei Zheng and Xiumei Hu contributed to the review and editing of the manuscript. All authors read and approved the final.

Ethics Statement

All the research involving animals was approved by the Medical Ethics Committee of Southern Medical University (approval protocol No. SMUL2021045).

Consent

All authors of this manuscript have agreed to submit the article and declare that the article has not been published elsewhere and is not currently under consideration for publication by any other journal.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Supporting Figures: jev270152‐sup‐0001‐FigureS1‐S2.docx

JEV2-14-e70152-s001.docx (517.5KB, docx)

Supporting Figures: jev270152‐sup‐0001‐FigureS1‐S2.docx

JEV2-14-e70152-s003.tif (4.1MB, tif)

Supporting Figures: jev270152‐sup‐0001‐FigureS1‐S2.docx

JEV2-14-e70152-s002.tif (2.3MB, tif)

Acknowledgements

This study was supported by the National Natural Science Foundation of China (82402690, 82272384, 82230080 and 82402684), Guangdong Basic and Applied Basic Research Foundation (2021A1515110578), the National Science Fund for Distinguished Young Scholars (82025024), Noncommunicable Chronic Diseases‐National Science and Technology Major Project (2024ZD0529005), the Key R&D Plan of Guangzhou Science and Technology Program (2024B03J0704), the Natural Science Foundation of Guangdong Province (2024A1515010070, 2025A1515010067), Clinical Research Project of Nanfang Hospital, Southern Medical University (2023CR015), President Foundation of Nanfang Hospital, Southern Medical University (2021B023) and Guangdong Provincial Clinical Research Center for Laboratory Medicine (2023B110008).

Wang, J. , Chen H., Huang M., et al. 2025. “Extracellular Vesicles Containing MDP Derived from Lactobacillus rhamnosus GG Inhibit HSV‐2 Infection by Activating the NOD2‐IFN‐I Signalling Pathway.” Journal of Extracellular Vesicles 14, no. 8: 14, e70152. 10.1002/jev2.70152

Jingyu Wang, Haoming Chen and Mei Huang contributed equally to this study.

Funding: This study was supported by the National Natural Science Foundation of China (82402690, 82272384, 82230080 and 82402684), Guangdong Basic and Applied Basic Research Foundation (2021A1515110578), the National Science Fund for Distinguished Young Scholars (82025024), Noncommunicable Chronic Diseases‐National Science and Technology Major Project (2024ZD0529005), the Key R&D Plan of Guangzhou Science and Technology Program (2024B03J0704), the Natural Science Foundation of Guangdong Province (2024A1515010070, 2025A1515010067), Clinical Research Project of Nanfang Hospital, Southern Medical University (2023CR015), President Foundation of Nanfang Hospital, Southern Medical University (2021B023) and Guangdong Provincial Clinical Research Center for Laboratory Medicine (2023B110008).

Contributor Information

Qian Wang, Email: wangqian@smu.edu.cn.

Lei Zheng, Email: nfyyzhenglei@smu.edu.cn.

Xiumei Hu, Email: huxiumei@smu.edu.cn.

Data Availability Statement

All data generated or analysed during this study are included in this published article.

References

  1. Bahena‐Román, M. , Sánchez‐Alemán M. A., Contreras‐Ochoa C. O., et al. 2020. “Prevalence of Active Infection by Herpes Simplex Virus Type 2 in Patients with High‐Risk human Papillomavirus Infection: A Cross‐Sectional Study.” Journal of Medical Virology 92, no. 8: 1246–1252. 10.1002/jmv.25668. [DOI] [PubMed] [Google Scholar]
  2. Barile, L. , and Vassalli G.. 2017. “Exosomes: Therapy Delivery Tools and Biomarkers of Diseases.” Pharmacology & Therapeutics 174: 63–78. 10.1016/j.pharmthera.2017.02.020. [DOI] [PubMed] [Google Scholar]
  3. Bradley, K. C. , Finsterbusch K., Schnepf D. , et al. 2019. “Microbiota‐Driven Tonic Interferon Signals in Lung Stromal Cells Protect from Influenza Virus Infection.” Cell Reports 28, no. 1: 245–256.e4. 10.1016/j.celrep.2019.05.105. [DOI] [PubMed] [Google Scholar]
  4. Buzas, E. I. 2022. “The Roles of Extracellular Vesicles in the Immune System.” Nature Reviews Immunology 23, no. 4: 236–250. 10.1038/s41577-022-00763-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Capurso, L. 2019. “Thirty Years of Lactobacillus rhamnosus GG: A Review.” Journal of Clinical Gastroenterology 53: S1. 10.1097/MCG.0000000000001170. [DOI] [PubMed] [Google Scholar]
  6. Caruso, R. , Warner N., Inohara N., and Núñez G.. 2014. “NOD1 and NOD2: Signaling, Host Defense, and Inflammatory Disease.” Immunity 41, no. 6: 898–908. 10.1016/j.immuni.2014.12.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chamaillard, M. , Girardin S. E., Viala J., and Philpott D. J.. 2003. “Nods, Nalps and Naip: Intracellular Regulators of Bacterial‐Induced Inflammation.” Cellular Microbiology 5, no. 9: 581–592. 10.1046/j.1462-5822.2003.00304.x. [DOI] [PubMed] [Google Scholar]
  8. Cheng, L. , and Hill A. F.. 2022. “Therapeutically Harnessing Extracellular Vesicles.” Nature Reviews Drug Discovery 21, no. 5: 379–399. 10.1038/s41573-022-00410-w. [DOI] [PubMed] [Google Scholar]
  9. Connolly, S. A. , Jardetzky T. S., and Longnecker R.. 2021. “The Structural Basis of Herpesvirus Entry.” Nature Reviews Microbiology 19, no. 2: 110–121. 10.1038/s41579-020-00448-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Crow, Y. J. , and Stetson D. B.. 2022. “The Type I Interferonopathies: 10 Years On.” Nature Reviews Immunology 22, no. 8: 471–483. 10.1038/s41577-021-00633-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dai, W. , Wu Y., Bi J. , et al. 2018. “Antiviral Effect of Retro‐2.1 Against Herpes Simplex Virus Type 2 In Vitro.” Journal of Microbiology and Biotechnology 28, no. 6: 849–859. 10.4014/jmb.1712.12052. [DOI] [PubMed] [Google Scholar]
  12. Erttmann, S. F. , Swacha P., Aung K. M. , et al. 2022. “The Gut Microbiota Prime Systemic Antiviral Immunity via the cGAS‐STING‐IFN‐I Axis.” Immunity 55, no. 5: 847–861.e10. 10.1016/j.immuni.2022.04.006. [DOI] [PubMed] [Google Scholar]
  13. Gao, J. , Wang L., Jiang J. , et al. 2023. “A Probiotic Bi‐Functional Peptidoglycan Hydrolase Sheds NOD2 Ligands to Regulate Gut Homeostasis in Female Mice.” Nature Communications 14: 3338. 10.1038/s41467-023-38950-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Golais, F. , and Mrázová V.. 2020. “Human Alpha and Beta Herpesviruses and Cancer: Passengers or Foes?” Folia Microbiologica 65, no. 3: 439–449. 10.1007/s12223-020-00780-x. [DOI] [PubMed] [Google Scholar]
  15. Gupta, R. , Warren T., and Wald A.. 2007. “Genital Herpes.” Lancet 370, no. 9605: 2127–2137. 10.1016/S0140-6736(07)61908-4. [DOI] [PubMed] [Google Scholar]
  16. Herrmann, I. K. , Wood M. J. A., and Fuhrmann G.. 2021. “Extracellular Vesicles as a Next‐Generation Drug Delivery Platform.” Nature Nanotechnology 16, no. 7: 748–759. 10.1038/s41565-021-00931-2. [DOI] [PubMed] [Google Scholar]
  17. Hong, M. , Li Z., Liu H. , et al. 2023. “ Fusobacterium nucleatum Aggravates Rheumatoid Arthritis Through FadA‐Containing Outer Membrane Vesicles.” Cell Host & Microbe 31, no. 5: 798–810.e7. 10.1016/j.chom.2023.03.018. [DOI] [PubMed] [Google Scholar]
  18. Huang, J. , Chen H., Li N., Liu P., Yang J., and Zhao Y.. 2025. “Emerging Technologies Towards Extracellular Vesicles Large‐Scale Production.” Bioactive Materials 52: 338–365. 10.1016/j.bioactmat.2025.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Huber, J. P. , and David Farrar J.. 2011. “Regulation of Effector and Memory T‐Cell Functions by Type I Interferon.” Immunology 132, no. 4: 466–474. 10.1111/j.1365-2567.2011.03412.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ivashkiv, L. B. , and Donlin L. T.. 2014. “Regulation of Type I Interferon Responses.” Nature Reviews. Immunology 14, no. 1: 36–49. 10.1038/nri3581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. James, C. , Harfouche M., Welton N. J. , et al. 2020. “Herpes Simplex Virus: Global Infection Prevalence and Incidence Estimates, 2016.” Bulletin of the World Health Organization 98, no. 5: 315–329. 10.2471/BLT.19.237149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jiang, Y. , Cai X., Yao J. , et al. 2020. “Role of Extracellular Vesicles in Influenza Virus Infection.” Frontiers in Cellular and Infection Microbiology 10: 366. 10.3389/fcimb.2020.00366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Johnston, C. , Scheele S., Bachmann L. , et al. 2024. “Vaccine Value Profile for herpes Simplex Virus.” Vaccine 42, no. 19: S82–S100. 10.1016/j.vaccine.2024.01.044. [DOI] [PubMed] [Google Scholar]
  24. Kadeppagari, R.‐K. , Sanchez R. L., and Foster T. P.. 2012. “HSV‐2 Inhibits Type I Interferon Signaling via Multiple Complementary and Compensatory STAT2‐Associated Mechanisms.” Virus Research 167, no. 2: 273–284. 10.1016/j.virusres.2012.05.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kalluri, R. , and McAndrews K. M.. 2023. “The Role of Extracellular Vesicles in Cancer.” Cell 186, no. 8: 1610–1626. 10.1016/j.cell.2023.03.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kapoor, A. , Fan Y.‐H., and Arav‐Boger R.. 2016. “Bacterial Muramyl Dipeptide (MDP) Restricts Human Cytomegalovirus Replication via an IFN‐β‐Dependent Pathway.” Scientific Reports 6, no. 1: 20295. 10.1038/srep20295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Liu, H. , Li R., Yang H. , et al. 2025. “Extracellular Vesicles in Gut‐Bone Axis: Novel Insights and Therapeutic Opportunities for Osteoporosis.” Small Science 5, no. 4: 2400474. 10.1002/smsc.202400474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Liu, J. , Chen C., Liu Z. , et al. 2021. “Extracellular Vesicles from Child Gut Microbiota Enter Into Bone to Preserve Bone Mass and Strength.” Advanced Science 8, no. 9: 2004831. 10.1002/advs.202004831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Liu, L. , Guo Y., Wang B. , et al. 2025. “Yogurt‐Inspired Hybrid Membrane Vesicles for the Prevention and Treatment of Helicobacter pylori Infection.” Cell Biomaterials 1, no. 4: 100072. 10.1016/j.celbio.2025.100072. [DOI] [Google Scholar]
  30. Llewellyn, A. , and Foey A.. 2017. “Probiotic Modulation of Innate Cell Pathogen Sensing and Signaling Events.” Nutrients 9, no. 10: 1156. 10.3390/nu9101156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Looker, K. J. , Elmes J. A. R., Gottlieb S. L. , et al. 2017. “Effect of HSV‐2 Infection on Subsequent HIV Acquisition: An Updated Systematic Review and Meta‐Analysis.” Lancet Infectious Diseases 17, no. 12: 1303–1316. 10.1016/S1473-3099(17)30405-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Looker, K. J. , Welton N. J., Sabin K. M. , et al. 2020. “Global and Regional Estimates of the Contribution of Herpes Simplex Virus Type 2 Infection to HIV Incidence: A Population Attributable Fraction Analysis Using Published Epidemiological Data.” Lancet. Infectious Diseases 20, no. 2: 240–249. 10.1016/S1473-3099(19)30470-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Mathieu, M. , Martin‐Jaular L., Lavieu G., and Théry C.. 2019. “Specificities of Secretion and Uptake of Exosomes and Other Extracellular Vesicles for Cell‐to‐Cell Communication.” Nature Cell Biology 21, no. 1: 9–17. 10.1038/s41556-018-0250-9. [DOI] [PubMed] [Google Scholar]
  34. McNab, F. , Mayer‐Barber K., Sher A., Wack A., and O'Garra A.. 2015. “Type I Interferons in Infectious Disease.” Nature Reviews Immunology 15, no. 2: 2. 10.1038/nri3787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Ñahui Palomino, R. A. , Vanpouille C., Laghi L. , et al. 2019. “Extracellular Vesicles from Symbiotic Vaginal Lactobacilli Inhibit HIV‐1 Infection of human Tissues.” Nature Communications 10: 5656. 10.1038/s41467-019-13468-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Niu, J. , Cui M., Yang X. , et al. 2023. “Microbiota‐Derived Acetate Enhances Host Antiviral Response via NLRP3.” Nature Communications 14, no. 1: 642. 10.1038/s41467-023-36323-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Pegtel, D. M. , and Gould S. J.. 2019. “Exosomes.” Annual Review of Biochemistry 88: 487–514. 10.1146/annurev-biochem-013118-111902. [DOI] [PubMed] [Google Scholar]
  38. Sabbah, A. , Chang T. H., Harnack R. , et al. 2009. “Activation of Innate Immune Antiviral Response by NOD2.” Nature Immunology 10, no. 10: 1073–1080. 10.1038/ni.1782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Shestakov, A. , Jenssen H., Nordström I., and Eriksson K.. 2012. “Lactoferricin but Not Lactoferrin Inhibit Herpes Simplex Virus Type 2 Infection in Mice.” Antiviral Research 93, no. 3: 340–345. 10.1016/j.antiviral.2012.01.003. [DOI] [PubMed] [Google Scholar]
  40. Si, W. , Liang H., Bugno J. , et al. 2022. “ Lactobacillus rhamnosus GG Induces cGAS/STING‐Dependent Type I Interferon and Improves Response to Immune Checkpoint Blockade.” Gut 71, no. 3: 521–533. 10.1136/gutjnl-2020-323426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Spencer, S. P. , Fragiadakis G. K., and Sonnenburg J. L.. 2019. “Pursuing Human‐Relevant Gut Microbiota‐Immune Interactions.” Immunity 51, no. 2: 225–239. 10.1016/j.immuni.2019.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Steed, A. L. , Christophi G. P., Kaiko G. E. , et al. 2017. “The Microbial Metabolite Desaminotyrosine Protects from Influenza Through Type I Interferon.” Science (New York, N.Y.) 357, no. 6350: 498–502. 10.1126/science.aam5336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Stefan, K. L. , Kim M. V., Iwasaki A., and Kasper D. L.. 2020. “Commensal Microbiota Modulation of Natural Resistance to Virus Infection.” Cell 183, no. 5: 1312–1324.e10. 10.1016/j.cell.2020.10.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Tognarelli, E. I. , Palomino T. F., Corrales N., Bueno S. M., Kalergis A. M., and González P. A.. 2019. “Herpes Simplex Virus Evasion of Early Host Antiviral Responses.” Frontiers in Cellular and Infection Microbiology 9: 127. 10.3389/fcimb.2019.00127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Tuddenham, S. , Hamill M. M., and Ghanem K. G.. 2022. “Diagnosis and Treatment of Sexually Transmitted Infections: A Review.” Journal of the American Medical Association 327, no. 2: 161–172. 10.1001/jama.2021.23487. [DOI] [PubMed] [Google Scholar]
  46. van Niel, G. , D'Angelo G., and Raposo G.. 2018. “Shedding Light on the Cell Biology of Extracellular Vesicles.” Nature Reviews Molecular Cell Biology 19, no. 4: 213–228. 10.1038/nrm.2017.125. [DOI] [PubMed] [Google Scholar]
  47. Wang, J. , Huang M., Du Y. , et al. 2024. “ Lactobacillus rhamnosus GG Regulates Host IFN‐I Through the RIG‐I Signalling Pathway to Inhibit Herpes Simplex Virus Type 2 Infection.” Probiotics and Antimicrobial Proteins 16, no. 6: 1966–1978. 10.1007/s12602-023-10137-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wang, J. , Wu F., Liu C. , et al. 2019. “Exosomes Released from Rabies Virus‐Infected Cells May be Involved in the Infection Process.” Virologica Sinica 34, no. 1: 59–65. 10.1007/s12250-019-00087-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wang, Y. , Zu M., Li B., Reis R. L., Kundu S. C., and Xiao B.. 2025. “Application of Bacterial Extracellular Vesicles in Gastrointestinal Diseases.” Trends in Biotechnology, ahead of print, June 20. 10.1016/j.tibtech.2025.05.022. [DOI] [PubMed]
  50. Wen, M. , Wang J., Ou Z. , et al. 2023. “Bacterial Extracellular Vesicles: A Position Paper by the Microbial Vesicles Task Force of the Chinese Society for Extracellular Vesicles.” Interdisciplinary Medicine 1, no. 3: e20230017. 10.1002/INMD.20230017. [DOI] [Google Scholar]
  51. Wijesinghe, V. N. , Farouk I. A., Zabidi N. Z., Puniyamurti A., Choo W. S., and Lal S. K.. 2021. “Current Vaccine Approaches and Emerging Strategies Against Herpes Simplex Virus (HSV).” Expert Review of Vaccines 20, no. 9: 1077–1096. 10.1080/14760584.2021.1960162. [DOI] [PubMed] [Google Scholar]
  52. Winkler, E. S. , Shrihari S., Hykes B. L. , et al. 2020. “The Intestinal Microbiome Restricts Alphavirus Infection and Dissemination Through a Bile Acid‐Type I IFN Signaling Axis.” Cell 182, no. 4: 901–918.e18. 10.1016/j.cell.2020.06.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Wolf, A. J. 2023. “Peptidoglycan‐induced Modulation of Metabolic and Inflammatory Responses.” Immunometabolism (Cobham (Surrey, England) 5, no. 2: e00024. 10.1097/IN9.0000000000000024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Xie, J. , Haesebrouck F., Van Hoecke L., and Vandenbroucke R. E.. 2023. “Bacterial Extracellular Vesicles: An Emerging Avenue to Tackle Diseases.” Trends in Microbiology 31, no. 12: 1206–1224. 10.1016/j.tim.2023.05.010. [DOI] [PubMed] [Google Scholar]
  55. Yamamoto, T. , Yamamoto Y., and Ochiya T.. 2023. “Extracellular Vesicle‐Mediated Immunoregulation in Cancer.” International Journal of Hematology 117, no. 5: 640–646. 10.1007/s12185-022-03436-3. [DOI] [PubMed] [Google Scholar]
  56. Zheng, C. 2021. “The Emerging Roles of NOD‐Like Receptors in Antiviral Innate Immune Signaling Pathways.” International Journal of Biological Macromolecules 169: 407–413. 10.1016/j.ijbiomac.2020.12.127. [DOI] [PubMed] [Google Scholar]
  57. Zhong, L. , Zheng J., Lin L., Cong Q., and Qiao L.. 2023. “Perspective on Human Papillomavirus Infection Treatment by Vaginal Microbiota.” Interdisciplinary Medicine 1, no. 2: e20220020. 10.1002/INMD.20220020. [DOI] [Google Scholar]
  58. Zhou, G. , Zhou Q., Li R. , et al. 2025. “Synthetically Engineered Bacterial Extracellular Vesicles and IL‐4‐Encapsulated Hydrogels Sequentially Promote Osteoporotic Fracture Repair.” ACS Nano 19, no. 16: 16064–16083. 10.1021/acsnano.5c03106. [DOI] [PubMed] [Google Scholar]
  59. Zhu, J. , Message S. D., Mallia P. , et al. 2019. “Bronchial Mucosal IFN‐α/β and Pattern Recognition Receptor Expression in Patients with Experimental Rhinovirus‐Induced Asthma Exacerbations.” Journal of Allergy and Clinical Immunology 143, no. 1: 114–125.e4. 10.1016/j.jaci.2018.04.003. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Figures: jev270152‐sup‐0001‐FigureS1‐S2.docx

JEV2-14-e70152-s001.docx (517.5KB, docx)

Supporting Figures: jev270152‐sup‐0001‐FigureS1‐S2.docx

JEV2-14-e70152-s003.tif (4.1MB, tif)

Supporting Figures: jev270152‐sup‐0001‐FigureS1‐S2.docx

JEV2-14-e70152-s002.tif (2.3MB, tif)

Data Availability Statement

All data generated or analysed during this study are included in this published article.

Articles from Journal of Extracellular Vesicles are provided here courtesy of Wiley

RESOURCES