Abstract
Purpose
Ureteral injuries following endoscopic interventions often lead to fibrosis and subsequent stricture formation, yet the optimal use and duration of ureteral stents in preventing these outcomes remain unclear. This study aimed to determine whether ureteral stents have an inhibitory effect on fibrosis development and provide evidence to optimize stent use and duration.
Methods
This study was conducted between March and October 2023. Rabbit models with varying degrees of ureteral injury (G1-G4) were established according to the Post-Ureteroscopy Lesion Scale (PULS), dividing into Control (no ureteral stent placement), 2-week (stent placed for 2 weeks), and 4-week (stent placed for 4 weeks) groups. Ureteral tissues from G1-G4 models were collected at 2- and 4-weeks post-operation for HE staining, Masson staining, RT-PCR, and Western Blot to measure the levels of TGF-β1, α-SMA, and Collagen I expressions.
Results
Stent placement in ureteral injury models significantly reduced inflammatory cell infiltration and collagen deposition, thereby mitigating fibrosis, with the most pronounced effects observed in more severe injuries (G3 and G4). At both 2- and 4-weeks post-operation, stented groups showed less inflammation and fibrosis compared to stentless groups, demonstrating the protective effect of stents. The expression of fibrosis-related proteins (TGF-β1, Collagen I, and α-SMA) in ureteral tissues increased with the severity of injury (G1-G4) at both 2- and 4-weeks post-operation.
Conclusions
Placement of a ureteral stent can inhibit fibrosis in G2-G4 level ureteral injuries, preventing ureteral stricture and occlusion. Ureteral stents are suggested to place for more than 4-weeks for injuries beyond the submucosal layer.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12894-025-01892-7.
Keywords: Ureteral stents, Ureteral injuries, Fibrosis, Post-Ureteroscopy Lesion Scale (PULS), Animal models, Tissue engineering, Transforming growth factor beta1 (TGF-β1), Collagen type I, alpha-Smooth Muscle Actin (α-SMA)
Introduction
Urolithiasis is a common disease of the urinary system. Upon onset, patients often exhibit severe pain accompanied by cold sweats, rapid breathing, and other symptoms, significantly impacting their daily lives [1]. With improvements in living standards and increased stress, the incidence of urinary stones has been increasing annually [2]. Ureteral stones, in particular, often lead to ureteral obstruction, pain, infection, and hydronephrosis. The most commonly used treatment is transurethral ureteroscopy with lithotripsy [3].
Post-ureteroscopy, ureteral stents are frequently placed to reduce mucosal edema, prevent ureteral stricture and obstruction, and promote the expulsion of residual stones. However, stent placement can lead to complications, such as frequent urination, urgency, dysuria, hematuria, urinary tract infections, and encrustation [4, 5]. Furthermore, the removal of ureteral stents requires a supplementary intervention, thus increasing the number of procedures patients must undergo [6]. Therefore, urologists have been striving to reduce stent duration and even achieve tubeless post-operative outcomes [7]. However, there is still a lack of basic experimental data to support decisions on whether to place ureteral stents and the optimal duration of placement for different degrees of injury. Given the potential role of ureteral stents in mitigating fibrosis following ureteral injury, we hypothesize that stent placement can inhibit fibrosis development and prevent stricture formation.
This study aims to construct animal models with varying degrees of ureteral injury, group them according to the presence and duration of stent placement, and observe the expression levels of various fibrosis markers in the injured ureteral tissues of each group. By comparing the extent of fibrosis, we seek to determine whether ureteral stents have an inhibitory effect on fibrosis development and provide evidence to optimize stent use and duration.
Materials and methods
Experimental animals and equipment
The experimental procedures were carried out between March and October 2023. A total of 72 healthy male New Zealand white rabbits, aged 2.5-3.0 months and weighing approximately 2.0 ~ 3.0 kg, were provided by the Animal Experiment Center of Zunyi Medical University. The microbial control level was ordinary. The animal experiments were approved and conducted following the guidelines of the Experimental Animal Ethics Committee of Zunyi Medical University (ZMU21-2204-002). Equipment and materials included: operating table, shadowless lamp, surgical instrument pack (provided by the Surgical Laboratory of Zunyi Medical University), 3/0 absorbable sutures (Huatuo brand HY3901 20PCS), disposable syringes (20mL), urinary zebra guidewire (SACHER SH-0519 C), epidural anesthesia catheter (Tuoren Medical Instruments). Real-time fluorescent quantitative PCR instrument (Roche LightCycler 480 II), electrophoresis apparatus (Tian Neng EPS-300).
Experimental reagents and drugs
In this study, several reagents and drugs were used for histological analysis, molecular assessments, and drug administration. These include: ①Hematoxylin Staining Solution (Servicebio G1005-1): Used for routine histological staining to visualize tissue morphology by coloring cell nuclei. ②Eosin Staining Solution (Servicebio G1005-2): Complementary to hematoxylin, eosin stains cytoplasm and extracellular matrix components, helping in the differentiation of tissue structures. ③Masson Trichrome Staining Solution (Servicebio-G1006-100ML): This staining method is used to assess collagen deposition and fibrosis in tissue samples by distinguishing collagen fibers (blue), muscle fibers (red), and cell nuclei (dark purple). ④TGF-β1 Antibody (Proteintech 21898-1-AP): A monoclonal antibody used in Western Blot and immunohistochemistry to detect TGF-β1, a key cytokine involved in fibrosis and tissue remodeling. ⑤Collagen-I Antibody (Proteintech 14695-1-AP): This antibody targets Collagen-I, a major component of the extracellular matrix, commonly used to evaluate fibrotic tissue formation. ⑥α-SMA Antibody (Proteintech 14395-1-AP): This antibody is used to detect α-Smooth Muscle Actin (α-SMA), a marker for activated myofibroblasts involved in fibrosis. ⑦HiScript II Q RT SuperMix for qPCR (Vazyme R222): A reagent kit used for reverse transcription of RNA to complementary DNA (cDNA), facilitating subsequent quantitative PCR analysis. ⑧Injectable Penicillin Potassium (Xinjiheng Pharmaceuticals, 1.0 g): A broad-spectrum antibiotic used for prophylactic infection control during surgery, administered to the animals to prevent postoperative infection.
Construction and grouping of animal models
The rabbits were acclimated to the environment under standard conditions with free access to food and water for 7 days before the experiment. A total of 72 rabbits were randomly divided into three main groups: the Control group (no ureteral stent placement), the 2-week stent group (ureteral stent placed for 2 weeks), and the 4-week stent group (ureteral stent placed for 4 weeks). Each of these three groups was further subdivided into four injury groups (G1-G4), with six rabbits in each subgroup, according to the PULS: G1: mucosal layer injury; G2: submucosal layer injury; G3: full-thickness injury (less than half the transverse diameter, < TD/2); G4: full-thickness injury (more than half the transverse diameter, >TD/2). The experimental design included a total of 12 subgroups, with six rabbits in each subgroup (e.g., Control-G1, Control-G2, 2-week-G1, 2-week-G2, etc.).
Ureteral tissues from the Control, 2-week, and 4-week groups were collected at 2- and 4-weeks post-operation for HE staining, Masson staining, RT-qPCR, and Western Blot analysis to measure the expression of TGF-β1, α-SMA, and Collagen I. Specific modeling steps are detailed in Supplement Fig. 1.
Construction of rabbit ureteral injury model
The rabbits were anesthetized using a respiratory anesthesia machine and preoperatively injected with penicillin intramuscularly to prevent infection. The surgical area was disinfected with iodine and 75% ethanol. A 3–4 cm midline incision was made from the pubic symphysis to open the abdominal cavity, and the ureter was identified at the bifurcation of the iliac vessels. A 2 cm segment of the ureter was isolated, and a small incision was made in the ureter near the bladder. The rigid end of a zebra guidewire was inserted and manipulated back and forth to induce mechanical injury. To ensure that the injury was classified into the correct PULS grades (G1-G4), we used the following criteria: G1: superficial mucosal injury; G2: submucosal injury with slight muscle layer involvement; G3: full-thickness injury involving less than half the ureteral diameter (< TD/2); G4: full-thickness injury involving more than half the ureteral diameter (> TD/2). The severity of the injury was assessed based on the depth and extent of the tissue damage observed during surgery and confirmed during histopathological examination. To minimize bias in injury grading, the assessment was performed without prior knowledge of the group assignments (blind method), and confirmation was done by an independent pathologist who was unaware of the surgical procedures. To more accurately simulate ureteral injury in the clinical setting, we opted not to use the ureteroscope (URS) and laser method, as the injuries in our study were created via mechanical manipulation using the zebra guidewire. This approach allowed for the creation of controlled mucosal and submucosal injuries, mimicking the type of damage that might occur during ureteroscopy without the use of laser techniques. To ensure the creation of only mucosal and superficial submucosal injuries, the guidewire was carefully manipulated along the outer layer of the ureter, avoiding deeper penetration into the ureteral lumen. After the injury, the incision was either sutured or a catheter for epidural anesthesia was inserted as a ureteral stent before suturing. To ensure that the epidural catheter remained in place for the required duration of 4 weeks, we sutured the surrounding tissue to anchor the catheter in the ureter. Additionally, the catheter’s position was periodically monitored to prevent displacement during the experiment. Following the suturing of the ureter, we monitored for any urine leakage at the injury site. If urine leakage was observed, additional suturing was performed to ensure a secure closure. After confirming no further leakage, the ureter was repositioned, and the abdominal cavity was closed [8]. Photographs of the stent placement process and intraoperative procedures can be found in the Supplementary Materials.
Histopathological examination
After euthanizing the rabbits, the injured ureteral tissues were collected, surrounding adipose tissue and capsules were removed, rinsed with saline, and dried with filter paper. The tissues were fixed in 10% formalin for more than 24 h, routinely paraffin-embedded, and sectioned to a thickness of 4 μm. The sections were deparaffinized and rehydrated before HE and Masson staining. Pathological changes, protein deposition, and fibrosis levels of the ureteral tissues were observed under a light microscope.
RT-qPCR analysis of TGF-β1, collagen I, and α-SMA expression in ureteral tissues
Total RNA was extracted and reverse-transcribed immediately or stored at −80 °C for long-term storage. Reverse transcription was performed using the Vazyme HiScript II Q RT SuperMix for qPCR kit, with the following PCR conditions: 25 °C for 5 min, 50 °C for 15 min, 85 °C for 2 min, and storage at 4 °C. The synthesized first-strand cDNA was stored at −40 °C. Primers for reverse transcription PCR were designed using Primer Premier 5.0 software and synthesized by Sangon Biotech (Table 1), with GAPDH as the internal control. The RT-qPCR reactions were performed using the 2×Q3 SYBR qPCR Master mix (Universal) kit.
Table 1.
Primer sequences for various genes
| Gene | Primer Sequence (5’to3’) |
|---|---|
| TGF-β1 | For: AATACAAAGAAAGTCGGCACAGCG |
| TGF-β1 | Rev: GCACAATCCAGGTGACGGTAAATG |
| Col1 | For: AGCGGCGGTGGTTACGACTTT |
| Col1 | Rev: GCAGGTGCGAGCTGGGTTCTT |
| α-SMA | For: CCTGTTCCAGCCCTCCTTCA |
| α-SMA | Rev: CCTTCTGCATACGGTCAGCAAT |
| GAPDH | For: ACCTGCCGCCTGGAGAAAGC |
| GAPDH | Rev: GAGACGACCTGGTCCTCGGTGTAG |
Western blot analysis of TGF-β1, collagen I, and α-SMA expression in ureteral tissues
Ureteral tissue samples stored at −80 °C were minced and homogenized, then lysed on ice for 30 min. The lysates were centrifuged at 12,000 r/min for 10 min, and the supernatant was collected. The protein concentration was determined using the BCA method. A total of 20 µg of protein was subjected to SDS-PAGE electrophoresis and transferred to PVDF membranes. The membranes were blocked with 5% non-fat milk for 1 h, followed by incubation with the following primary antibodies overnight at 4 °C: Rabbit anti-TGF-β1 antibody (1:1000 dilution, Proteintech, #21898-1-AP); Rabbit anti-Collagen I antibody (1:1000 dilution, Proteintech, #14695-1-AP); Rabbit anti-α-SMA antibody (1:500 dilution, Proteintech, #14395-1-AP).
After washing with TBST, the membranes were incubated with HRP-conjugated secondary antibodies (1:5000 dilution) at room temperature for 1 h. The membranes were then washed with TBST three times, each for 5 min. β-Actin was used as an internal control (1:5000 dilution). The protein bands were visualized using the ECL detection system, photographed, and analyzed semi-quantitatively using ImageJ.
Statistical analysis
All data were expressed as mean ± standard deviation (SD). Western blot data were analyzed using one-way ANOVA, followed by Tukey’s post-hoc test for multiple comparisons. A P-value < 0.05 was considered statistically significant. The statistical analysis was performed using GraphPad Prism 8.0 software.
Results
Progressive inflammatory response Attenuation by stent placement in ureteral injury models
Histological analysis revealed that in the stentless groups, two weeks post-operation, G2 to G4 displayed a marked increase in inflammatory cell infiltration compared to G1. Specifically, G3 and G4 exhibited significantly deeper infiltration of inflammatory cells and increased tissue proliferation, with G4 showing the most severe inflammatory response (P < 0.01 compared to G1). In the stented groups, two weeks post-operation, G2 to G4 showed a lesser degree of inflammatory cell infiltration compared to the stentless groups. While inflammation was present, it was significantly reduced in the stented G3 and G4 groups (P < 0.05 compared to the corresponding stentless groups). The ureteral mucosal layer progressively thinned with increasing injury severity, most notably in G4 (P < 0.01 compared to G1). Stent placement partially mitigated the inflammatory response, as evidenced by reduced inflammatory cell infiltration. By four weeks post-operation in the stented groups, inflammatory cell infiltration continued to increase with injury severity from G1 to G4. However, the stent placement significantly delayed the progression of inflammation, particularly in G3 and G4 (P < 0.01). G4 in the stented group showed markedly less inflammation compared to the stentless group at the same time point (P < 0.001), demonstrating the protective effect of stent placement in preventing excessive inflammatory responses (Fig. 1).
Fig. 1.
HE staining of the ureter after injury degrees G1-G4, with stentless, 2 weeks after stent, and 4 weeks after. The figure presents representative histological images of arterial cross-sections from four experimental groups (G1-G4) at different time points (2 weeks and 4 weeks) post-implantation. Each row represents a distinct group (G1-G4), and each column represents a different condition and time point: stentless at 2 weeks, stent at 2 weeks, and stent at 4 weeks. HE staining was used to visualize the tissue morphology and cellular response. The boxed regions highlight areas of interest within the ureteral wall, such as inflammatory cell infiltration, shown in higher magnification in the adjacent images. The scale bar represents 100–200 μm
Collagen deposition and fibrosis mitigation by stent placement in ureteral injury models
Figure 2A presented Masson staining images of ureteral cross-sections from four injury groups (G1-G4) at different time points (2 weeks and 4 weeks) post-operation. In the stentless groups, collagen deposition progressively increased with injury severity from G2 to G4, as shown by the increasing density of blue-stained collagen fibers. Stented groups, both at 2 weeks and 4 weeks post-operation, exhibited significantly less collagen deposition, particularly in G3 and G4, indicating the stent’s protective role in mitigating fibrosis. Figure 2B-D quantified collagen volume fractions across different groups. In Fig. 2B, the stentless groups showed significantly higher collagen volume fractions, especially in G3 and G4, compared to G1 (P < 0.01 and P < 0.001, respectively). In Fig. 2C, stented groups at 2 weeks post-operation exhibited lower collagen volume fractions compared to stentless groups, with G2-G4 showing significant reductions (P < 0.001 for G2-G4 vs. G1 stent 2 W). In Fig. 2D, at 4 weeks post-operation, collagen volume fractions continued to be significantly lower in the stented groups, especially in G3 and G4 (P < 0.001), indicating that stent placement reduced fibrosis progression over time (Fig. 2).
Fig. 2.
Masson’s Trichrome Staining of Ureteral Cross-Sections and Quantification of Collagen Volume Fraction. A Representative images of arterial cross-sections from four experimental groups (G1-G4) subjected to different conditions and time points: stentless at 2 weeks (Stentless 2 W), stent at 2 weeks (Stent 2 W), and stent at 4 weeks (Stent 4 W). The Masson’s Trichrome staining highlights collagen (blue), muscle fibers (red), and cell nuclei (dark purple). Each row corresponds to a different group (G1-G4), and the columns represent the different conditions and time points. Scale bars represent 200 μm. B Comparison of collagen volume fraction with G1 stentless 2 W groups (*p < 0.05, **p < 0.01, ***p < 0.001 vs. G1 stentless 2 W). C Comparison of collagen volume fraction with G1 stent 2 W groups (#p < 0.05, ##p < 0.01, ###p < 0.001 vs. G1 stent 2 W). D Comparison of collagen volume fraction with G1 stent 4 W groups (&p < 0.05, &&p < 0.01, &&&p < 0.001 vs. G1 stent 4 W)
Stent placement significantly reduces expression of fibrosis markers (TGF-β1, Collagen I, α-SMA) in ureteral injury models
Figure 3 illustrated the impact of stent placement on the expression of fibrosis-related markers (TGF-β1, Collagen I, and α-SMA) in ureteral tissues at 2- and 4-weeks post-operation across different injury severities (G1-G4) (Fig. 3). Figures 3A-C showed that in the stentless groups at 2 weeks, there was a progressive increase in TGF-β1, Collagen I, and α-SMA expression with injury severity, with G3 and G4 displaying significantly higher levels compared to G1 (P < 0.001). This highlights the increased fibrotic response in the absence of stent placement. Figures 3D-F demonstrated that in the stented groups at 2 weeks post-operation, the expression of TGF-β1, Collagen I, and α-SMA was significantly lower in G2-G4 compared to their stentless counterparts (P < 0.001), indicating that stent placement effectively reduced the fibrotic response in more severe injuries. Figures 3G-I show the results at 4 weeks post-operation, where the stented groups continued to exhibit significantly reduced levels of TGF-β1, Collagen I, and α-SMA in G3 and G4 (P < 0.001) compared to the stentless groups. This demonstrated the sustained protective effect of stent placement in inhibiting fibrosis progression in more severe ureteral injuries over time.
Fig. 3.
qPCR Results of Fibrosis Markers at 2- and 4-Weeks Post-Operation. A-C Show the relative mRNA levels of TGF-β1, Collagen I, and α-SMA in the G1-G4 groups at 2 weeks post-injury without stent implantation. D-F Present the relative mRNA levels of TGF-β1, Collagen I, and α-SMA in the G1-G4 groups at 2 weeks post-injury with stent implantation. G-I Display the relative mRNA levels of TGF-β1, Collagen I, and α-SMA in the G1-G4 groups at 4 weeks post-injury with stent implantation. Each bar represents the mean ± SD of the relative expression levels. Significant differences are indicated as ***p < 0.001 vs. G1 stentless 2 W, ###p < 0.001 vs. G1 stent 2 W, &&&p < 0.001 vs. G1 stent 4 W
Stentless ureteral injury models showed increased protein expression of TGF-β1, Collagen I, and α-SMA at 2 weeks post-operation
Figure 4 illustrated the Western blot results, showing the protein expression levels of TGF-β1, Collagen I, and α-SMA in stentless ureteral injury models across different injury severities (G1-G4) at 2 weeks post-operation (Fig. 4). Figure 4A displayed the Western blot bands for TGF-β1, Collagen I, α-SMA, and β-actin (used as a loading control). The intensity of the bands for TGF-β1, Collagen I, and α-SMA progressively increased with injury severity from G1 to G4. Figures 4B-D quantified the relative protein levels of TGF-β1, Collagen I, and α-SMA. In Fig. 4B, the protein expression of TGF-β1 was significantly higher in G2, G3, and G4 compared to G1 (P < 0.001 for G3 and G4, P < 0.05 for G2). Figure 4C showed that the relative expression of Collagen I increased progressively, with G3 and G4 exhibiting significantly higher levels than G1 (P < 0.001). G2 also showed a moderate increase (P < 0.05). Figure 4D presented the results for α-SMA, where G3 and G4 displayed significantly elevated expression compared to G1 (P < 0.001), and G2 also showed a moderate but significant increase (P < 0.01).
Fig. 4.
Western Blot results for fibrosis markers in the Stentless Group at 2 weeks post-operation. A Shows the Western blot results for TGF-β1, Collagen I, and α-SMA in the G1-G4 groups at 2 W post-injury without stent implantation. B-D Illustrate the relative protein levels of TGF-β1, Collagen I, and α-SMA, respectively, in the G1-G4 groups at 2 weeks post-injury without stent implantation. Each bar represents the mean ± SD of the protein relative expression levels. Significant differences are indicated as ***p < 0.001 vs. G1 Stentless 2 W
Stent placement reduced protein expression of TGF-β1, Collagen I, and α-SMA in ureteral injury models at 2 weeks post-operation
Figure 5 demonstrated the Western blot analysis of fibrosis-related proteins (TGF-β1, Collagen I, and α-SMA) in ureteral tissues from stented groups at 2 weeks post-operation across different injury severities (G1-G4) (Fig. 5). Figure 5A presented Western blot bands showing the protein expression of TGF-β1, Collagen I, and α-SMA. The results indicate a progressive increase in the expression of these fibrosis markers from G1 to G4. β-actin was used as a loading control. Figures 5B-D showed the quantification of protein levels for TGF-β1, Collagen I, and α-SMA, respectively. In Fig. 5B, the expression of TGF-β1 was significantly higher in G3 and G4 compared to G2 (P < 0.001), with moderate increases in G2 (P < 0.01 compared to G1). Figure 5C demonstrated that Collagen I levels were also elevated significantly in G3 and G4 compared to G2 (P < 0.001), and a moderate increase was observed in G2 (P < 0.05 compared to G1). Figure 5D showed the expression of α-SMA, which followed a similar trend with significantly higher levels in G3 and G4 (P < 0.001), while G2 showed a moderate increase (P < 0.05).
Fig. 5.
Western Blot results for fibrosis markers in the stented group at 2 weeks post-operation. A Showed the Western blot results for TGF-β1, Collagen I, and α-SMA in the G1-G4 groups at 2 weeks post-injury with stent implantation. B-D Illustrated the relative protein levels of TGF-β1, Collagen I, and α-SMA, respectively, in the G1-G4 groups at 2 weeks post-injury with stent implantation. Each bar represents the mean ± SD of the protein relative expression levels. Significant differences are indicated as ###p < 0.001 vs. G1 stent 2 W
Fibrosis marker expression in stented ureteral injury models at 4 weeks post-operation shows a progressive increase with injury severity
Figure 6 showed the Western blot analysis of fibrosis-related proteins (TGF-β1, Collagen I, and α-SMA) in ureteral tissues from stented groups at 4 weeks post-operation across different injury severities (G1-G4) (Fig. 6). Figure 6A presented the Western blot bands for TGF-β1, Collagen I, and α-SMA, with β-actin used as a loading control. The intensity of the bands for these fibrosis markers increased with injury severity, with G4 showing the highest expression. Figures 6B-D showed the quantification of the relative protein levels for TGF-β1, Collagen I, and α-SMA. In Fig. 6B, TGF-β1 expression was significantly higher in G3 and G4 compared to G1 (P < 0.001), with G2 showing a moderate increase (P < 0.01). Figure 6C showed a similar trend for Collagen I, with G3 and G4 exhibiting significantly higher levels compared to G1 (P < 0.001), and G2 showing a moderate increase (P < 0.01). Figure 6D presented the results for α-SMA, where G3 and G4 displayed significantly elevated expression compared to G1 (P < 0.001), while G2 showed a moderate but significant increase (P < 0.01).
Fig. 6.
Western Blot results for fibrosis markers in the stentless group at 4 weeks post-operation. A Showed the Western blot results for TGF-β1, Collagen I, and α-SMA in the G1-G4 groups at 4 weeks post-injury with stent implantation. B-D Illustrated the relative protein levels of TGF-β1, Collagen I, and α-SMA, respectively, in the G1-G4 groups at 4 weeks post-injury with stent implantation. Each bar represents the mean ± SD of the relative expression levels. Significant differences are indicated as &&&p < 0.001 vs. G1 stent 4 W
Discussion
Ureteral stent placement has been the cornerstone of postoperative management following ureteroscopic lithotripsy since 1978, primarily used to prevent complications such as stricture and hydronephrosis [9]. However, as noted by Yip et al. [10], routine stent placement has been questioned due to the associated complications, including urinary frequency, urgency, and hematuria. Current guidelines from both the European Association of Urology and the American Urological Association advise against routine stent placement in cases with minimal ureteral trauma [11]. Nevertheless, ureteroscopy can cause varying degrees of ureteral injury, and the threshold for stent placement remains unclear.
In our study, we applied the PULS [12] to categorize ureteral injuries and evaluated the efficacy of stent placement in preventing fibrosis. Our results demonstrate that stent placement significantly reduces inflammatory cell infiltration and collagen deposition, thereby mitigating fibrosis, with the most pronounced effects observed in more severe injuries (G3 and G4). The results show that stent placement can mitigate fibrosis in ureteral injuries of intermediate severity (PULS 2–3), corroborating findings from earlier studies that suggested stent placement reduces fibrosis markers such as TGF-β1 and α-SMA [13, 14]. However, in more severe injuries (PULS > 3), while stent placement delayed the onset of fibrosis, it did not fully prevent the fibrotic response. This highlights the persistent challenge of managing full-thickness ureteral injuries, where myofibroblast activation and collagen deposition are driven by the TGF-β1/Smads signaling pathway [15, 16]. Our findings align with previous research, which emphasizes the central role of TGF-β1 in fibrosis, particularly in ureteral stricture development [17, 18].
A key difference between our study and previous research [19–21] is the duration of stent placement. We found that for more severe injuries (PULS > 3), stents must remain in place for at least four weeks to achieve a comparable inhibitory effect on fibrosis. This finding could have important clinical implications, as it suggests that a longer stent duration may be required in patients with more extensive ureteral trauma to prevent stricture formation. These results are particularly relevant in light of the growing body of literature that questions the optimal duration of stent placement [10, 19].
The use of fibrosis markers such as TGF-β1, α-SMA, and Collagen I in our study was based on their well-established roles in fibrotic processes. TGF-β1 is a potent fibrogenic cytokine that promotes epithelial-mesenchymal transition (EMT) and myofibroblast activation [15]. The upregulation of α-SMA and Collagen I in our models confirms the presence of activated myofibroblasts, which are responsible for excessive extracellular matrix deposition and subsequent tissue rigidity and stricture formation [17, 18]. These markers were chosen because they provide a direct assessment of the fibrotic response, offering insights into the underlying mechanisms driving ureteral stricture post-ureteroscopy.
From a clinical perspective, our study underscores the importance of injury severity in guiding stent placement duration. In cases of mild injury (PULS < 2), stent placement may be unnecessary, as fibrosis is minimal without the need for mechanical support. However, we acknowledge that the injuries in our study were induced through mechanical manipulation, which may not fully reflect the conditions of typical clinical endourological procedures. In clinical practice, stent placement may still be necessary even in mild injuries, as ureteral lesions are typically not sutured in vivo. However, for injuries involving deeper layers (PULS > 2), stent placement plays a critical role in preventing severe fibrotic outcomes, though additional measures might be required for full-thickness injuries to fully inhibit fibrosis progression.
While our results provide valuable insights, some limitations must be addressed. Our study did not assess the long-term outcomes of stent removal, and it remains unclear whether the fibrosis inhibition observed with longer stent placement persists after stent removal. Additionally, while we focused on key fibrosis markers, other pathways such as inflammatory cytokines and immune cell infiltration may also contribute to the fibrotic response and warrant further investigation. Future studies should include larger sample sizes and longer follow-up periods to better understand the balance between stent-induced irritation and the prevention of fibrosis.
In conclusion, stent placement may be unnecessary in cases of mild ureteral injury (PULS < 2). Meanwhile, our study demonstrates that ureteral stent placement is an effective strategy for preventing fibrosis in ureteral injuries, particularly in moderate to severe cases. However, the duration of stent placement is critical factor, with longer stent placement recommended for more severe injuries (PULS > 3) to achieve optimal fibrosis inhibition. These findings contribute to the ongoing debate about stent duration and provide a foundation for future clinical guidelines on post-ureteroscopy management.
This study offers important insights into ureteral fibrosis after injury, but several limitations must be considered. First, the observation period was limited to four weeks, and we did not assess long-term outcomes after stent removal. It remains unclear whether the anti-fibrotic effects observed persist beyond the removal period or whether delayed stricture may occur. Future studies might extend the follow-up duration and incorporate multiple post-removal time points to capture the full course of tissue remodeling and identify optimal stent removal timing. Second, the relatively small sample size may reduce the statistical power of our results. Increasing the number of animal models in future research will provide more robust results.Third, while we focused on fibrosis-related markers such as TGF-β1, α-SMA, and Collagen I, other molecular pathways involved in fibrotic and inflammatory responses, including NF-κB and Wnt/β-catenin, were not examined. Comprehensive molecular profiling in future studies may uncover additional therapeutic targets. Fourth, our use of rabbit models, although widely accepted, may limit the translatability of findings due to species-specific anatomical and physiological differences. Larger animal models such as pigs may better simulate human ureteral anatomy and responses. Fifth, we used epidural catheters as surrogate stents, which differ from standard clinical ureteral stents in terms of material and surface characteristics. This discrepancy may influence mechanical interaction with ureteral tissue and the biological response. Future studies using clinical-grade or biomaterial-optimized stents are warranted. Lastly, the potential of biodegradable or drug-eluting stents remains unexplored in our study. Investigating these innovations may further improve fibrosis prevention and reduce stent-associated complications. Addressing these limitations will refine the application of ureteral stents and improve the management of ureteral injuries in clinical settings.
Supplementary Information
Acknowledgements
Not applicable.
Authors’ contributions
Hao Gu: Conceptualization, Investigation, Methodology, Software, Formal analysis, Funding acquisition, Writing– original draft; Tingting Yang: Investigation, Methodology, Software; Zhimin Qin: Investigation, Methodology; Siyuan Zhang: Investigation, Methodology; Liangyong Wang: Investigation, Methodology; Zeju Zhao: Conceptualization, Project administration, Supervision, Writing– review and editing.
Funding
The present study was supported by the Science and Technology Projects in Zunyi City (No. Zunshikehe-HZ (2021)227) and Guizhou Provincial Health Commission Science and Technology Fund (No. gzwkj2023-377) from Hao Gu.
Data availability
Data are available from the corresponding author upon reasonable request.
Declarations
Ethics approval and consent to participate
The animal experiments were approved and conducted following the guidelines of the Experimental Animal Ethics Committee of Zunyi Medical University (ZMU21-2204-002).
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Dell’Aversana F, Pezzullo M, Scaglione M. Imaging in urolithiasis. Urologic Clin North Am. 2025;52(1):51–9. 10.1016/j.ucl.2024.07.007. [DOI] [PubMed] [Google Scholar]
- 2.Tan S, Yuan D, Su H, Chen W, Zhu S, Yan B, Sun F, Jiang K, Zhu J. Prevalence of urolithiasis in china: a systematic review and meta-analysis. BJU Int. 2024;133(1):34–43. 10.1111/bju.16179. [DOI] [PubMed] [Google Scholar]
- 3.Campobasso D, Panizzi M, Bellini V, Ferretti S, Amparore D, Castellani D, Fiori C, Puliatti S, Pietropaolo A, Somani BK, Micali S, Porpiglia F, Maestroni UV, Bignami EG. Application of AI in urolithiasis risk of infection: a scoping review. Minerva Urol Nephrol. 2024;76(3):295–302. 10.23736/S2724-6051.24.05686-6. [DOI] [PubMed] [Google Scholar]
- 4.Garg M, Joseph P, Johnson H, Lawrence JV, Somani B, Rai BP, Philip J. Obesity and BMI score as risk factors for urolithiasis: a systematic review over 30 years. Curr Opin Urol. 2025;35(4):338–46. 10.1097/MOU.0000000000001298. [DOI] [PubMed] [Google Scholar]
- 5.Moretto S, Saita A, Scoffone CM, Talso M, Somani BK, Traxer O, Angerri O, Knoll T, Liatsikos E, Herrmann TRW, Ulvik Ø, Skolarikos A, Cracco CM, Keller EX, Paciotti M, Piccolini A, Uleri A, Tailly T, Carmignani L, Pietropaolo A, Buffi NM. Ureteral stricture rate after endoscopic treatments for urolithiasis and related risk factors: systematic review and meta-analysis. World J Urol. 2024;42(1):234. 10.1007/s00345-024-04933-2. [DOI] [PubMed] [Google Scholar]
- 6.Kurt HA, Demirci E. A rare complication of amplatz sheath: amplatz sheath rupture during percutaneous nephrolithotomy. J Endourol Case Rep. 2020;6:399–401. 10.1089/cren.2020.0053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Lu Y, Li Q, Zou Q, Cui Y. Mirabegron and antimuscarinics for treating ureteral stent-related symptoms: a systematic review and meta-analysis of RCTs. Front Pharmacol. 2023;14:1266636. 10.3389/fphar.2023.1266636. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Ho DR, Su SH, Chang PJ, Lin WY, Huang YC, Lin JH, et al. Biodegradable stent with mTOR inhibitor-eluting reduces progression of ureteral stricture. Int J Mol Sci. 2021;22. 10.3390/ijms22115664. [DOI] [PMC free article] [PubMed]
- 9.Heimberger M, Stocchi L, Brennan E, Spaulding A, DeLeon M, Merchea A, Dozois E, Colibaseanu D. Can preoperative ureteral stent placement help in the intraoperative identification of iatrogenic ureteral injury? J Gastrointest Surgery: Official J Soc Surg Aliment Tract. 2024;28(6):903–9. 10.1016/j.gassur.2024.03.028. [DOI] [PubMed] [Google Scholar]
- 10.Yip KH, Cheng MC, Lee CW. Re: is stenting following ureteroscopy for removal of distal ureteral calculi necessary? J Urol. 1999;162:500. 10.1016/s0022-5347(05)68607-7. [DOI] [PubMed] [Google Scholar]
- 11.Andonian S. Should we routinely place an indwelling ureteral stent post-ureteroscopy? Can Urol Assoc J. 2020;14:69. 10.5489/cuaj.6421. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.May M, Schonthaler M, Gilfrich C, Wolff I, Peter J, Miernik A, et al. [Interrater reliability and clinical impact of the Post-Ureteroscopic lesion scale (PULS) grading system for ureteral lesions after ureteroscopy: results of the German prospective multicenter BUSTER project]. Urologe A. 2018;57:172–80. 10.1007/s00120-017-0565-3. [DOI] [PubMed] [Google Scholar]
- 13.Panach-Navarrete J, Valls-González L, Lloret-Durà MA, Diéguez-Álvarez L, Martínez-Jabaloyas JM. Use of the Allium stent for management of ureteral pathology: a real-world clinical practice study. Urologia. 2025;3915603251341399. 10.1177/03915603251341399. Advance online publication. [DOI] [PubMed]
- 14.Li C, Dong H, Yang R, Ying Z, Zhang S, Chen M, Peng Y, Gao X. The effect of indwelling duration of ureteral stent on the formation and pathological characteristics of ureteral stricture after holmium laser thermal injury. World J Urol. 2025;43(1):340. 10.1007/s00345-025-05676-4. [DOI] [PubMed] [Google Scholar]
- 15.Yamada Y, Inoue Y, Nakamura K, Naruse K, Aoki S, Taki T, Tobiume M, Zennami K, Katsuda R, Hara K, Kato Y, Watanabe M, Hayashida K, Suzuki Y, Kato H, Ajisaka R, Kyoku I, Noguchi H, Honda N. Long-term results and management of ureteral transitional cell carcinoma using the holmium: YAG laser via rigid-ureteroscopy. Oncol Rep. 2009;21(2):345–9. [PubMed] [Google Scholar]
- 16.Meng W, Li N, Lv F, Chen B, Lu S, Zhang J, Zhang T, Tao Q, Zhou Y, Ma L, Guan Y. SiRNA-Targeting TGF-β1 based on Nanoparticle-Coated ureteral stents to inhibit ureteral stricture. ACS Biomaterials Sci Eng. 2025;11(6):3477–87. 10.1021/acsbiomaterials.4c01925. [DOI] [PubMed] [Google Scholar]
- 17.Khalil H, Kanisicak O, Prasad V, Correll RN, Fu X, Schips T, et al. Fibroblast-specific TGF-β-Smad2/3 signaling underlies cardiac fibrosis. J Clin Invest. 2017;127:3770–83. 10.1172/jci94753. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Feng F, Li N, Cheng P, Zhang H, Wang H, Wang Y, et al. Tanshinone IIA attenuates silica-induced pulmonary fibrosis via Inhibition of TGF-β1-Smad signaling pathway. Biomed Pharmacother. 2020;121:109586. 10.1016/j.biopha.2019.109586. [DOI] [PubMed] [Google Scholar]
- 19.Lange D, Bidnur S, Hoag N, Chew BH. Ureteral stent-associated complications–where we are and where we are going. Nat Rev Urol. 2015;12:17–25. 10.1038/nrurol.2014.340. [DOI] [PubMed] [Google Scholar]
- 20.Sonmez G, Demir F, Keske M, Karadag MA, Demirtas A. Comparison of the effects of four treatment techniques commonly used in ureteral stone treatment on patients’ daily physical functioning: an observational Randomized-Controlled study. J Endourol. 2021;35:8–13. 10.1089/end.2020.0659. [DOI] [PubMed] [Google Scholar]
- 21.El Harrech Y, Abakka N, El Anzaoui J, Ghoundale O, Touiti D. Ureteral stenting after uncomplicated ureteroscopy for distal ureteral stones: a randomized, controlled trial. Minim Invasive Surg. 2014;2014:892890. 10.1155/2014/892890. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data are available from the corresponding author upon reasonable request.






