Reagents and tools table
| Reagent/resource | Reference or source | Identifier or catalog number |
|---|---|---|
| Experimental models | ||
| MCF10A-YAP5SA | Björns von Eyss | |
| MCF10A-YAP5SA-PIP-FUCCI | This study | |
| MCF10A-YAP5SA- DHB-mVenus-p2a-mCherry-CDK4KTR | This study | |
| MCF10A-YAP5SA-S94A | This study | |
| MCF10A-CCNE1 | This study | |
| Recombinant DNA | ||
| GST-RHdelta-MNase | Addgene | 136292 |
| pCMV-FlagYAP5SA/S94A | Addgene | 33103 |
| pCMV-VSV-G | Addgene | 8454 |
| pInducer20 Cyclin E1 | Addgene | 109348 |
| pInducer20 YAP5SA/S94A | This study | |
| pLenti-DHB-mVenus-p2a-mCherry-CDK4KTR | Addgene | 126679 |
| pLenti-PGK-Neo-PIP-FUCCI | Addgene | 118616 |
| psPAX2 | Addgene | 12260 |
| Antibodies | ||
| Beta-Actin (C4) | Santa Cruz | sc-47778 |
| BrdU (B44) | BD Biosciences | 347580 |
| BrdU Proliferation Marker | Abcam | ab6326 |
| Cyclin B (H-433) | Santa Cruz | sc-752 |
| MCM7 | Santa Cruz | sc-56324 |
| PCNA | Santa Cruz | sc-56 |
| pH2A.X (Ser139) | Santa Cruz | Sc-517348 |
| pH3 (Ser10) | Millipore | 06-570 |
| pKAP1 (Ser824) | Abcam | ab70369 |
| pLAMIN A/C (Ser22) | Cell Signaling | 13448 |
| pRB (Ser807/811) (D20B12) | Cell Signaling | 8516S |
| pRPA32 (Ser33) | Bethyl (Biomol) | A300-246A |
| RB (G3-245) | BD Pharmingen | 554136 |
| RNA Pol II phospho Ser2 | Abcam | ab5095 |
| S9.6 | Millipore | # MABE1095 |
| YAP (63.7) | Santa Cruz | sc-101199 |
| Anti-mouse IgG (H + L) HRP | Thermo Fischer Scientific | G-21040 |
| Anti-ProteinA HRP | BD Biosciences | 610438 |
| Anti-mouse IgG (H + L) Alexa Fluor 568 | Thermo Fischer Scientific | A-11031 |
| Anti-mouse IgG (H + L) Alexa Fluor 488 | Thermo Fischer Scientific | A-11029 |
| Anti-mouse IgG (H + L) Alexa Fluor 594 | Thermo Fischer Scientific | A11032 |
| Anti-rabbit IgG (H + L) Alexa Fluor 568 | Thermo Fischer Scientific | A-11036 |
| Anti-rabbit IgG (H + L) Alexa Fluor 647 | Thermo Fischer Scientific | A-21245 |
| Anti-rabbit IgG (H + L) Alexa Fluor 488 | Thermo Fischer Scientific | A-11034 |
| Duolink In Situ anti-rabbit PLA Sonde PLUS | SIGMA ALDRICH | UO92002 |
| Duolink In Situ anti-mouse PLA Sonde MINUS | SIGMA ALDRICH | DUO92004 |
| Oligonucleotides and other sequence-based reagents | ||
| qPCR primers | This study | Table EV1 |
| Cloning primer | ||
| TGTGTCGACCGTCAGAATTGATCTACCATGGAC | SalI_FLAG_Y5SA | |
| ACATCTAGACTGAGGGCTCTATAACCATGTAAG | S94A_XbaI | |
| siRNAs | Table EV1 | |
| Chemicals, enzymes, and other reagents | ||
| 5-Chloro-2’-deoxyuridine (CIdU) | Hycultec GmbH | HY-112669 |
| 5-Ethynyl-2’-deoxyuridine (EdU) | Jena Bioscience | CLK-N001 |
| 5-Ethynyl-uridine (EU) | Jena Bioscience | CLK-N002 |
| 5,6-dichloro-1-beta-D-ribofuranosyl-1H-benzimidazole (DRB) | Biomol | Cay10010302-50 |
| Adavosertib (AZD1775) | Hycultec GmbH | HY10993 |
| AF488-Azide | Jena Bioscience | CLK-1275 |
| AF647-Azide | Jena Bioscience | CLK-1299 |
| Ceralasertib (AZD6738) | Hycultec GmbH | HY19323 |
| Cholera toxin | Enzo Life Science GmbH | BML-G117 |
| DMEM/F-12 | Thermo Fisher Scientific | 31331093 |
| DMSO | SIGMA ALDRICH | 472301 |
| dNTPs | Thermo Fisher Scientific | R0186 |
| Doxorubicin-hydrochlorid | SIGMA ALDRICH | D1515 |
| Doxycycline | SIGMA ALDRICH | D9891 |
| Glutathione Sepharose 4B | VWR/GE Healthcare | 17075601 |
| Glutathione, reduced | SIGMA ALDRICH | G4251 |
| Horse serum | Thermo Fisher Scientific | 16050122 |
| Hydrocortisone | SIGMA ALDRICH | H0888 |
| Idoxuridine (IdU) | Hycultec GmbH | HY-B0307 |
| Insulin | SIGMA ALDRICH | I9278 |
| IPTG | SIGMA ALDRICH | I6758 |
| JQ1 | SIGMA ALDRICH | SML1524 |
| Nutlin-3 | SIGMA ALDRICH | 444151 |
| Page Ruler Prestained Protein Ladder | Thermo Fisher Scientific | 26617 |
| Palbociclib isothionate | Hycultec GmbH | HY-A0065 |
| Phusion DNA Polymerase | Thermo Fisher Scientific | F-530L |
| Prexasertib dihydrochloride | Hycultec GmbH | HY-18174A |
| Propidium iodide | SIGMA ALDRICH | 537059 |
| Protease Inhibitor | SIGMA ALDRICH | P8340 |
| Random primer | SIGMA ALDRICH | 11034731001 |
| Recombinant human EGF | SIGMA ALDRICH | E9644 |
| Restriction enzymes | New England Biolabs | |
| RevertAid Reverse Transcriptase | Thermo Fisher Scientific | EP0441 |
| RiboLock RNase Inhibitor | Thermo Fisher Scientific | EO0384 |
| Sodium ascorbate | SIGMA ALDRICH | A7631 |
| T4 DNA Ligase | New England Biolabs | M0202T |
| Thiazolyl blue tetrazolium bromide | SIGMA ALDRICH | M5655 |
| Trizol | Thermo Fisher Scientific | 15596018 |
| Software | ||
| GraphPad Prism v10 | GraphPad | |
| ImageJ 1.53k | http://imagej.net/ij/ | |
| DiffBind 3.12.0 | Ross-Innes et al (2012) | |
| MACS v2.2.9.1 | Zhang et al (2008) | |
| Picard tools 2.18.2.2 | http://broadinstitute.github.io/picard/ | |
| Bowtie v2.4.2 | Langmead et al, 2012 | |
| R 4.4.3 | https://www.r-project.org | |
| RStudio v 2024.12.1 | Posit Software, PBC | |
| Trimmomatic 0.38.1 | Bolger et al (2014) | |
| Harmony High Content Imaging and Analysis Software v4.8 | Perkin Elmer | |
| Other | ||
| Duolink In Situ Detection Reagents Red | SIGMA ALDRICH | DUO82008 |
| QIAquick PCR Purification Kit | Qiagen | 28106 |
| Quant-iT PicoGreen dsDNA Assay Kit | Thermo Fisher Scientific | P11496 |
| Illumina NextSeq 2000 P3 Reagents; 50 cycles | Illumina | 20046810 |
| OperettaTM High-Content Screening System | Perkin Elmer | |
| NextSeq 2000 sequencer | Illumina | |
| qTower3G | Analytic Jena | |