TABLE 1.
16S rRNA-targeted oligonucleotide probes used in this study
| Probe | Specificity | Sequence of probe (5′-3′) | Target sitea | FAb concn (%) | NaClc concn (mM) | Reference |
|---|---|---|---|---|---|---|
| EUB338 | Domain Bacteria | GCTGCCTCCCGTAGGAGT | 338-355 | 20 | 0.166 | 3 |
| NON338 | None (negative control) | ACTCCTACGGGAGGCAGC | 338-355 | 0 | 0.900 | 25 |
| SRB385 | SRB of the δ subdivision of the proteobacteria plus several gram-positive bacteria (e.g., Clostridium spp.) | CGGCGTCGCTGCGTCAGG | 385-402 | 30 | 0.071 | 4 |
| SRB687 | Desulfovibrio spp. plus members of the genera Geobacter, Desulfomonas, Desulfuromonas, Desulfomicrobium, Bilophila, and Pelobacter | TACGGATTTCACTCCT | 687-702 | 10 | 0.386 | 12 |
| 660 | Desulfobulbus spp. | GAATTCCACTTTCCCCTCTG | 660-679 | 30 | 0.071 | 12 |
| 221 | Desulfobacterium spp. | TGCGCGGACTCATCTTCAAA | 221-240 | 10 | 0.386 | 12 |
| 129 | Desulfobacter spp. | CAGGCTTGAAGGCAGATT | 129-146 | 20 | 0.166 | 12 |
| 804 | Desulfobacterium spp., Desulfobacter, Desulfococcus, Desulfosarcina, and Desulfobotulus spp. | CAACGTTTACTGCGTGGA | 804-821 | 10 | 0.386 | 12 |
a
16S rRNA position according to E. coli numbering.
b
Formamide concentration in the hybridization buffer.
c
sodium chloride concentration in the washing buffer.