CRISPR/dCas9-TET1–mediated epigenetic editing reactivates miR-200c in breast cancer cells

Abstract

Cancer progression is often accompanied by epigenetic silencing of tumor-suppressor microRNAs such asmiR-200c, a key regulator of epithelial-to-mesenchymal transition (EMT) and metastasis. Given the reversible nature of DNA methylation, we employed a CRISPR/dCas9-TET1 system to target the miR-200c promoter and restore its expression in MCF-7 and MDA-MB-231 breast cancer cell lines. Two gRNAs were designed to flank CpG-rich regions of the miR-200c promoter, and their individual or combined delivery enabled site-specific demethylation. Co-transfection with both gRNAs resulted in a synergistic increase in miR-200c expression, likely due to expanded coverage of dCas9-TET1 recruitment. This upregulation led to the downregulation of key EMT-related transcription factors ZEB1, ZEB2, and the oncogene KRAS, as well as increased E-cadherin expression in MDA-MB-231 cells. However, E-cadherin changes in MCF-7 cells were minimal, highlighting the complex and context-dependent nature of epigenetic regulation. Functional assays further confirmed the anti-tumorigenic effects of miR-200c restoration, with reduced cell viability and increased apoptosis, effects more pronounced in MDA-MB-231 cells, which initially exhibited higher miR-200c promoter methylation. Collectively, our findings demonstrate that CRISPR/dCas9-TET1-mediated epigenetic editing effectively reactivates miR-200c, reverses EMT-associated gene expression, and impairs tumor cell aggressiveness, supporting its potential as a targeted therapeutic strategy in breast cancer.

Introduction

Cancer is basically a disease of dysregulation, characterized by the breakdown of cellular mechanisms that normally preserve identity, proliferation control, and tissue homeostasis^1,2. This disruption is particularly well-characterized in breast cancer, a malignancy influenced by both genetic mutations and epigenetic alterations and remains the most commonly diagnosed cancer in women worldwide³. Although significant progress has been made in early detection and targeted therapies, a substantial number of patients still face challenges such as therapy resistance, recurrence, and metastasis. These limitations underscore the need for more refined, mechanism-driven therapeutic approaches aimed at correcting the underlying molecular dysregulation driving tumor progression.

MicroRNAs (miRs) regulate gene expression post-transcriptionally and are now recognized as key players in cancer biology, with their dysregulation contributing to various hallmarks of cancer^4,5. Among them, the miR-200 family particularly miR-200c, has been extensively studied for its central role in inhibiting epithelial-to-mesenchymal transition (EMT), a key step in cancer metastasis⁶.

EMT is a reversible program in which epithelial cells gain mesenchymal traits, enhancing migration and invasiveness⁷. In breast cancer, this transition enables tumor cells to disseminate and colonize distant sites⁸. A major driver of EMT is the repression of epithelial markers such as E-cadherin by transcription factors like ZEB1 and ZEB2. miR-200c suppresses EMT by directly targeting ZEB1/ZEB2, forming a double-negative feedback loop that maintains epithelial identity⁹.

Loss of miR-200c, often via promoter hypermethylation, has been linked to enhanced invasiveness and poor prognosis in several cancers, including breast, ovarian, lung, and colorectal cancers^10,11. Interestingly, while downregulation of miR-200c facilitates initial invasion, its re-expression appears necessary for metastatic colonization, highlighting a paradox in cancer progression. These findings underscore the therapeutic potential of restoring miR-200c expression to suppress malignant plasticity and metastatic behavior.

Although DNA methyltransferase inhibitors (DNMTis) have been explored for reversing epigenetic silencing, their non-specific action often leads to unintended gene activation and limited clinical success¹². This limitation underscores the need for targeted demethylation strategies capable of restoring specific tumor suppressors while minimizing off-target effects. Reversing epigenetic silencing through locus-specific demethylation presents a compelling strategy for cancer therapy¹³. The CRISPR/dCas9-TET1 system is a powerful and precise tool to achieve this goal. By fusing a catalytically inactive Cas9 (dCas9) with the TET1 demethylase, this system enables targeted DNA demethylation without altering the underlying genetic code^14,15.

In this study, we employed the CRISPR/dCas9-TET1 system to selectively demethylate the miR-200c promoter in breast cancer cells, with the goal of restoring its expression. We evaluated the effects of targeted demethylation on gene expression and tumor-related phenotypes, including proliferation and apoptosis. This approach offers a promising avenue for epigenetic therapy by reactivating tumor-suppressive microRNAs in aggressive breast cancer.

Results

Plasmid constructs validation

The sgRNAs targeting the miR-200c promoter were successfully designed with no off-target effects, as predicted by the CHOPCHOP tool. The U6 fragment was effectively ligated into the pUC19 vector, as verified by colony PCR and visualized in Fig. 1A.

Fig. 1.

(A) PCR amplification and electrophoresis of the U6 promoter fragment (484 bp). (B) Colony PCR validation of sgRNA1 (280 bp). (C) Colony PCR validation of sgRNA2 (280 bp) insertion into the plasmid.

Insertion of the gRNA was confirmed through colony PCR (Fig. 1B, C) and validated by Sanger sequencing Fig. 2, which verified the integrity of the final plasmid construct.

Fig. 2.

Sanger sequencing results confirming successful insertion of sgRNA1 (A) and sgRNA2 (B) into the plasmid.

Validation of expression vector and transfection efficiency

Human breast cancer cell lines, MDA-MB-231 and MCF-7, were cultured under standard conditions. Transfection efficiency was confirmed using a GFP-containing vector, as demonstrated by fluorescence microscopy (Fig. 3). RNA and DNA were extracted 24–48 h post-transfection for downstream analysis.

Fig. 3.

Assessment of transfection efficiency via GFP fluorescence under a fluorescence microscope. (A) Control cells (scale bar = 40×). (B) Non-transfected cells showing no GFP signal, aside from minimal background fluorescence artifacts (scale bar = 40×). (C) Cells treated with dCas9-TET1 construct (scale bar = 100×). (D) Successfully transfected cells exhibiting strong GFP fluorescence, indicating efficient transfection (scale bar = 100×).

Upregulation of miR-200c via promoter demethylation in breast cancer cell lines using dCas9-TET1 and SgRNAs

The dCas9-TET1 system successfully demethylated miR-200c promoter in both breast cancer cell lines (Fig. 4A-B). In control groups, promoter methylation levels were comparable to the fully methylated DNA standard, indicating a highly methylated state in the absence of treatment. Transfection with the dCas9-TET1 vector and the pUC19-U6-gRNA construct reduced methylation level, confirming effective demethylation. In MCF-7 cells, although baseline methylation was lower than in MDA-MB-231, treatment still led to a marked decrease in methylation, demonstrating the system’s functionality regardless of initial methylation status. To evaluate functional outcomes, miR-200c expression was measured 48 h post-transfection. In MCF-7 cells, both gRNA1 and gRNA2 individually increased miR-200c expression significantly (Fig. 4D). Co-transfection with both gRNAs further enhanced expression, suggesting a synergistic effect.

Fig. 4.

Epigenetic editing and expression analysis of miR-200c in breast cancer cell lines following dCas9-TET1-mediated demethylation. (A) High-Resolution Melting (HRM) analysis showing changes in miR-200c promoter methylation levels in MCF-7 and MDA-MB-231 cells after transfection. (B) Schematic representation of the miR-200c promoter region, including gene position and CpG islands. (C) qPCR analysis of miR-200c expression in MDA-MB-231 cells 48 h after transfection with dCas9-TET1 and either gRNA1, gRNA2. (D) qPCR analysis of miR-200c expression in MCF-7 cells under the same transfection conditions.

In contrast, in MDA-MB-231 cells, only gRNA1 significantly elevated miR-200c levels, while gRNA2 had minimal effect (Fig. 4C). Consequently, gRNA1 was used in all subsequent experiments involving this cell line.

miR-200c re-Activation inhibits oncogenic signaling pathways

Following the increased expression of miR-200c, we evaluated its impact on key target genes involved in relevant signaling pathways. Alongside the significant downregulation of ZEB1 and ZEB2, established targets of miR-200c, the expression levels of KRAS were also affected. In both MCF-7 (Fig. 5A) and MDA-MB-231 (Fig. 5B) cell lines, the suppression of ZEB1 and ZEB2 was particularly pronounced, emphasizing the regulatory influence of miR-200c on epithelial-to-mesenchymal transition (EMT) pathways. Additionally, the observed alterations in KRAS and E-cadherin suggest broader effects on signaling networks.

Fig. 5.

Relative expression levels of ZEB1, ZEB2, KRAS, and E-cadherin genes in two different breast cancer cell lines, MCF-7 (A) and MDA-MB-231 (B), after transfection with dCas9-TET1. qRT-PCR was performed in triplicate (technical replicates). Data are presented as mean ± SD.

MTT and apoptosis

To evaluate the functional impact of miR-200c upregulation following promoter demethylation, an MTT assay was performed. Reduced cell viability was observed in treated cells compared to controls. In MCF-7 and MDA-MB-231 cell lines, transfection with dCas9-TET1 and sgRNAs significantly reduced cell viability compared to control groups. In MCF-7 cells, the combination of sgRNA1 and sgRNA2 led to the most substantial decrease in viability (Fig. 6A), while in MDA-MB-231 cells (Fig. 6B), sgRNA1 alone had a similar effect (P < 0.5). Control groups, including dCas9-TET1 without sgRNA and the mutant TET1 construct, exhibited no significant impact on cell proliferation. These findings suggest that targeted epigenetic modification of the miR-200c promoter may impair cancer cell viability.

Fig. 6.

MTT assay results showing the effect of miR-200c promoter demethylation on cell viability in breast cancer cell lines. (A) MCF-7 cells. (B) MDA-MB-231 cells. Data are presented as mean ± SD of three independent biological replicates (n = 4). Statistical analysis was performed using one-way ANOVA. Significant differences were observed in both cell lines: MCF-7: F = 121.5, p < 0.0001; MDA-MB-231: F = 58.97, p < 0.0001.

Apoptosis levels were assessed in MDA-MB-231 and MCF-7 cells following targeted demethylation using sgRNAs, measured by Annexin V/PI staining and flow cytometry. Control groups included transfected with dCas9Mut-TET1. In both cell lines, transfection with sgRNAs led to an increase in apoptotic cells compared to controls (Fig. 7A). In MDA-MB-231 cells, the percentage of apoptotic cells increased from 1.5% in the control to 35.07% (Fig, 7B, C). In MCF-7 cells, the apoptosis rate rose from 1.98% in the control to 10.5% in cells transfected with the sgRNA mixture (Fig. 7D, E), indicating a less pronounced effect compared to MDA-MB-231.

Fig. 7.

Evaluation of apoptosis following targeted demethylation of the miR-200c promoter in breast cancer cell lines. (A) Dendrogram representing apoptosis assay results from two biological replicates across all groups. (B) MDA-MB-231 control group: cells transfected with dCas9-MutTET and U6-gRNA1 (non-functional control). (C) MDA-MB-231 treated group: cells transfected with dCas9-TET and PUC19-U6-gRNA1. (D) MCF-7 control group: cells transfected with dCas9-MutTET and U6-gRNA1&2. (E) MCF-7 treated group: cells transfected with dCas9-TET and PUC19-U6-gRNA1&2.

Discussion

Aberrant DNA hypermethylation at regulatory regions of specific genes is associated with various pathological conditions. Experimental and therapeutic strategies for targeted DNA demethylation hold significant promise for elucidating the mechanistic roles of these epigenetic alterations and establishing their causal links to disease¹⁶. In this context, gene-specific epigenetic editing emerges as a promising strategy for reactivating silenced genes and restoring their normal function¹⁷.

Several studies have demonstrated the effectiveness of CRISPR/dCas9-based TET1 targeting for selective DNA demethylation and gene reactivation. For instance, Choudhury, et al.¹⁸ successfully employed the dCas9-TET1 system to demethylate the BRCA1 promoter, leading to its re-expression. Similarly, Cui, et al.¹⁹ combined CRISPR interference and activation strategies to restore FOXP3 expression in breast cancer cells. Kang, et al.²⁰ utilized dCas9- also achieved targeted demethylation of the Oct4 promoter using a dCas9-based system, resulting in significant transcriptional upregulation. Considering these findings, we employed the CRISPR/dCas9-TET1 system to investigate its potential in reactivating epigenetically silenced miR-200c in breast cancer cells.

The CRISPR/dCas9-TET1 system reduced miR-200c promoter methylation in both MCF-7 and MDA-MB-231 breast cancer cell lines. While the response in MDA-MB-231 cells aligned with expectations, given their heavily methylated miR-200c promoter, the pronounced effect observed in MCF-7 cells was unexpected, considering their promoter is only partially methylated. The importance of the CpG island spanning − 343 to − 115 bp upstream of the miR-200c/141 cluster was highlighted by Neves, et al.²¹who provided evidence that methylation within this region results in silencing of miR-200c/141 expression.

Their methylation analysis revealed that MDA-MB-231 cells harbor dense CpG methylation, while MCF-7 cells contain only a few methylated CpGs. This epigenetic pattern correlates with miR-200c expression levels, approximately 0.68 in MCF-7 and as low as 6.67 × 10⁻⁴ in MDA-MB-231, highlighting significant regulatory differences between the two cell lines.

In another study by Song, et al.²² the expression levels of miR-200c were compared between breast cancer cell lines and the non-tumorigenic control cell line MCF-10 A. They reported that the relative expression of miR-200c in MCF-7 cells was approximately 0.8, whereas in MDA-MB-231 cells it was around 0.2, indicating a significant difference in expression levels between the two cancer cell lines.

Given the well-documented importance of the promoter region in regulating miR-200 expression^10,23we designed our gRNAs to target not only the core binding site but also a broader genomic region surrounding it. By co-transfecting two gRNAs simultaneously, we aimed to enhance the demethylation effect through a potential synergistic interaction. This strategy is supported by previous findings showing that CpG methylation levels are not absolute; rather, relative methylation patterns across the promoter region can significantly influence gene expression²⁴.

In MDA-MB-231 cells, characterized by relatively high baseline promoter methylation¹⁰transfection with gRNA1 led to a marked decrease in methylation (Fig. 4b), and a corresponding increase in miR-200c expression (Fig. 4C). In contrast, gRNA2 did not exhibit a significant effect in this cell line (Fig. 4C).

In MCF-7 cells, which exhibit lower initial promoter methylation levels¹⁰both gRNAs individually reduced methylation and significantly upregulated miR-200c expression. Notably, co-transfection of gRNA1 and gRNA2 in MCF-7 cells resulted in higher expression levels compared to single gRNA treatment, indicating a potential synergistic effect in this context (Fig. 4D and E).

An intriguing and unexpected observation arose from these findings. Despite the relatively low baseline methylation of the miR-200c promoter in MCF-7 cells and previous reports indicating moderate endogenous expression of miR-200c in this line, the dCas9-TET1 system was still able to significantly enhance expression. While the precise mechanism behind this response remains to be fully clarified, one plausible explanation is that methylation of a limited number of critical CpG dinucleotides rather than the global methylation status of the promoter may exert a dominant influence on transcriptional regulation.

Indeed, multiple studies have shown that individual CpG sites within gene promoters can act as regulatory hotspots. For example, methylation of specific CpGs in the XAF1 and MT1 promoters has been shown to drastically reduce gene expression, despite only partial methylation of the promoter overall^25,26. Similarly, selective methylation within the Il6 promoter modulates transcription factor binding and LPS responsiveness in mouse macrophages²⁷. These findings underscore the importance of local methylation architecture, suggesting that even modest demethylation at strategically important CpGs, especially those near transcription factor binding sites can meaningfully restore gene expression.

Thus, in MCF-7 cells, the observed upregulation of miR-200c following dCas9-TET1-mediated demethylation may reflect the targeting and reactivation of such key regulatory CpGs, rather than a requirement for widespread promoter demethylation.

Following the observed reactivation of miR-200c, its upregulation was accompanied by the downregulation of several well-established oncogenic targets, including ZEB1, ZEB2, KRAS in line with findings reported by Kopp, et al.²⁸ and E-cadherin²⁹ (Fig. 5).

The suppression of ZEB1 and ZEB2 is particularly significant, as these transcription factors are key drivers of epithelial–mesenchymal transition (EMT), a fundamental process in cancer progression and metastasis³⁰. miR-200c directly targets the 3′ untranslated regions (UTRs) of ZEB1 and ZEB2 mRNAs, thereby downregulating their expression, preserving epithelial traits, and reducing the invasive behavior of cancer cells^31,32. Previous studies have also demonstrated that miR-200c expression is markedly reduced in aggressive breast cancer phenotypes, further underscoring its critical role in suppressing EMT and maintaining cellular differentiation states³³. While the CRISPR/dCas9-TET1 system effectively enhanced miR-200c expression in both MCF-7 and MDA-MB-231 cells, presumably via demethylation at key CpG sites, its downstream impact on E-cadherin expression varied between the two cell lines. In MDA-MB-231 cells, where the mesenchymal phenotype and repressed E-cadherin expression are well established, miR-200c reactivation led to a marked increase in E-cadherin levels, consistent with an EMT reversal phenotype. However, in MCF-7 cells, despite increased miR-200c expression, E-cadherin levels showed only minimal change.

This discrepancy suggests that E-cadherin expression in MCF-7 cells may already be near its physiological maximum or under the influence of regulatory mechanisms beyond miR-200c-mediated ZEB1/2 suppression. These could include additional transcriptional repressors, chromatin state differences, or alternative epigenetic modifications. Moreover, it underscores the possibility that even limited changes at specific “key” CpG sites, rather than the global methylation level, can have a substantial impact on miR-200c expression, while downstream targets like E-cadherin may require a more coordinated regulatory shift.

Altogether, our findings highlight that while targeted epigenetic editing can effectively modulate gene expression, the phenotypic outcome may be strongly context-dependent. Future studies are warranted to dissect the chromatin landscape of the E-cadherin promoter in different breast cancer cell lines and to identify potential co-regulators that may modulate its responsiveness to upstream signals like miR-200c.

In parallel with the EMT-related effects, the observed downregulation of KRAS following miR-200c reactivation further supports the tumor-suppressive role of this miRNA. KRAS, a well-established proto-oncogene, is known to drive key proliferative and survival pathways, including PI3K/AKT and MAPK/ERK³⁴. The suppression of KRAS expression likely disrupts these oncogenic signaling cascades, thereby contributing to the decreased viability and increased apoptosis seen in the treated cells³⁵. This finding expands the scope of miR-200c’s impact beyond EMT regulation, highlighting its broader influence on oncogenic signaling and cellular fate decisions in breast cancer models.

We further explored its downstream functional consequences in our system. miR-200c is known to enhance apoptosis through direct targeting of anti-apoptotic genes and by modulating the FAS/FASL signaling pathway. It also suppresses EMT progression via several key pathways, including TGF-β, fibronectin 1 (FN1), moesin (MSN), and USP25, all of which are involved in cytoskeletal remodeling and tumor cell invasion²⁹.

In line with these reports, apoptosis assay revealed a marked increase in apoptotic cell populations following miR-200c upregulation, reaching 35% in MDA-MB-231 and 10.5% in MCF-7 cells (Fig. 7). Complementary MTT results showed reduced cell viability in both lines (Fig. 6).

Taken together, these results suggest that epigenetic reactivation of miR-200c through targeted promoter demethylation can effectively reprogram breast cancer cells toward a less aggressive phenotype by simultaneously suppressing EMT-related genes and promoting apoptotic pathways. These effects likely result from the combinatorial regulation of multiple gene targets, rather than a single pathway, further underscoring the therapeutic potential of miR-200c in aggressive breast cancer subtypes.

Conclusion

In this study, CRISPR/dCas9-TET1-mediated epigenetic editing effectively reactivates miR-200c expression by demethylating its promoter region, leading to downstream suppression of EMT-related genes such as ZEB1, ZEB2, and KRAS, along with functional changes in cell behavior. These effects were especially pronounced in MDA-MB-231 cells, which exhibited a highly methylated miR-200c promoter and responded predictably to demethylation, showing increased E-cadherin expression, enhanced apoptosis, and reduced viability. In contrast, MCF-7 cells, despite showing some degree of miR-200c upregulation, exhibited only limited changes in E-cadherin expression and less pronounced functional effects, suggesting additional layers of regulatory complexity.

These observations underscore two key points: first, the TET1-based demethylation system is a powerful tool for reactivating silenced genes in a site-specific manner; and second, the biological outcome of such reactivation is context-dependent and influenced by the epigenetic landscape of the target cell. Notably, the heterogeneous response in MCF-7 cells highlights the need for more detailed analysis of individual CpG site methylation and potential compensatory regulatory mechanisms.

Overall, our findings support the utility of dCas9-TET1 systems for targeted epigenetic therapy and provide a foundation for refining such strategies based on cell-type specific epigenomic profiles. Further investigation into the precise CpG sites and chromatin context will be essential for optimizing efficacy and specificity in future applications.

Materials and methods

gRNAs design and vector construction

To target the miR-200c promoter, the CRISPR deadCas9-TET1 vector (a gift from Dr. Teresa Roldán Arjona) was used (Fig. 8A). Since this vector lacked the U6-gRNA scaffold, a separate construct, pUC19-U6, was generated for co-transfection.

Fig. 8.

(A) Dcas9-TET plasmid used in this study (B) Cloning strategy for constructing the plasmid containing the sgRNA and U6 promoter.

The U6 fragment comprising the U6 promoter, gRNA scaffold, and poly-A tail amplified from a Cas9 plasmid template. Primers containing XbaI and KpnI restriction enzyme sites at their 5’ ends were used for amplification (Table 1). The PCR conditions included an initial denaturation at 95 °C for 5 min, followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 30 s. A final extension step was performed at 72 °C for 10 min. Both the pUC19 vector (Addgene plasmid #50005) and the PCR-amplified U6 fragment were digested with XbaI and KpnI restriction enzymes. The digested U6 fragment was then ligated into the pUC19 backbone (Fig. 8B).

Table 1.

Sequences of gRNA oligonucleotides and primers used for PCR, real-time PCR, and High-Resolution melting (HRM) analysis.

gRNA	Sequence (5’−3’)
miR-200c gRNA 1 TOP	CACCGGTAAATCGGTGTGTGTCGC
miR-200c gRNA 1 BOTTOM	AAACGCGACACACACCGATTTACC
miR-200c gRNA 2 TOP	CACCGACGGTCGAGGGGCTTCGGA
miR-200c gRNA 2 BOTTOM	AAACTCCGAAGCCCCTCGACCGTC
XbaI forward	TGGATCTAGAGAGGGCCTATTTCCCATGATT
KpnI reverse	CAAGGTACCTCTGCAGAATTGGCGCAC
miR-200c forward	TAATACTGCCGGGTAATGATGGA
miR-200c reverse	AGACTGCACCTGTCCGG
GAPDH forward	AAAGCCTGCCGGTGACTAA
GAPDH reverse	GCGCCCAATACGACCAAATC
ZEB1 forward	TACCAGAGGATGACCTGCCA
ZEB1 reverse	TGCCCTTCCTTTCCTGTGTC
ZEB2 forward	TTCCTGGGCTACGACCATACC
ZEB2 reverse	CAAGCAATTCTCCCTGAAATCC
KRAS forward	ATTGTGAATGTTGGTGT
KRAS reverse	GAAGGTCTCAACTGAAATT
E-cadherin forward	TGCTCACATTTCCCAACTCC
E-cadherin reverse	CCTTGCCTTCTTTGTCTTTGTT
U6 forward	GTGCTCGCTTCGGCAG
U6 reverse	AGACTGCACCTGTCCGG
Stem-loop miR-200c	CAATTAGACTACACCTGTCCGGTCCCTGCGTCCTGTAGTCTAATTGTCCATC
Stem-loop U6	CAATTAGACTACACCTGTCCGGTCCCTGCGTCCTGTAGTCTAATTGAAAAATATGG
miR-200c oligonucleotides for HRM forward	GGGTTGAGTTTGGGATTGTAGAG
miR-200c oligonucleotides for HRM reverse	AACAACTTCAAACCCAAAATCCCTAC

Two single-guide RNAs (sgRNAs) targeting distinct CpG islands within the miR-200c promoter were designed using the CHOPCHOP tool (http://chopchop.cbu.uib.no). Off-target binding sites for each sgRNA were analyzed prior to synthesis. BbsI restriction sites were added to the sgRNA sequences to generate sticky ends upon enzymatic digestion. sgRNAs were annealed in a 10 µL reaction containing 1 µL of 10× T4 ligation buffer, 1 µL of each sgRNA oligo (100 µM), and 7 µL of nuclease-free water. The annealing protocol included incubation at 37 °C for 30 minutes, heating at 95 °C for 5 minutes, and gradual cooling at 0.1°C/s to 25°C. The annealed sgRNAs were ligated into the vector using the BbsI restriction enzyme and transformed into TOP10F’ E. coli cells. Colony PCR using an XbaI forward primer and a gRNA-specific reverse primer confirmed successful insertion, which was further validated by Sanger sequencing.

Cell culture and transfections

Human breast cancer cell lines MDA-MB-231 and MCF-7 were obtained from the National Cell Bank of Iran (Pasteur Institute, Tehran, Iran). Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Gibco) and antibiotics (penicillin 100 U/mL and streptomycin 100 µg/mL). Cultures were maintained in an incubator at 37 °C with 5% CO₂.

For transfection, Cells were seeded at a density of 3 × 10⁵ cells per well in 6-well plates and incubated under standard conditions. After 24 h, co-transfection was performed using 0.6 µg of dCas9-TET1 plasmid and 0.6 µg of pUC19-U6-gRNA plasmid with Attractene Transfection Reagent (Qiagen). RNA and DNA were extracted 24–72 hours’ post-transfection for further analysis. Transfection efficiency was assessed using a GFP-containing vector, with fluorescence detection.

Expression analysis using RT-qPCR

Total RNA was isolated using the RNeasy mini Kit (Qiagen), and RNA concentration and quality was measured with a spectrophotometer. Complementary DNA (cDNA) was synthesized using ExcelRT™ Reverse Transcription Kit (SMOBio) and for miR-200c and U6 (as the reference) designed stem-loops were used (Table 1).

The qPCR reactions were prepared in a 20 µL volume containing 10 µL of SYBR Green Master Mix and 10 ng of specific primers (Table 1). The amplification protocol consisted of an initial denaturation at 95 °C for 15 min, followed by 40 cycles of denaturing at 95 °C for 15 s, annealing at 60 °C for 1 min and the melt curve analysis was performed from 60 °C to 95 °C with a ramp rate of 0.3 °C/s. U6 and GAPDH were used as the reference genes. Experiments were performed in duplicates.

Methylation analysis of the miR-200c promoter

Genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer’s instructions. DNA purity and were assessed by electrophoresis on a 1% agarose gel, and concentration was measured by spectrophotometer.

Genomic DNA was subjected to bisulfite conversion using the EZ DNA Methylation-Gold™ Kit, following the manufacturer’s protocol. Bisulfite-modified DNA was amplified using primers specific to methylated regions of the miR-200c promoter (Table 1). Standard controls were methylated DNA and unmethylated bisulfite-modified DNA (EpiTect PCR Control DNA Set). The reaction mixture consisted of 10 µl MeltDoctor™ HRM Master Mix, 30 ng bisulfite-treated DNA, 20 ng of each primer and ddH₂O water. PCR conditions included an initial denaturation at 95 °C for 15 min, followed by 40 cycles of 95 °C for 30 s, 58 °C for 60 s, and 72 °C for 30 s. High-resolution melting (HRM) curve analysis was performed from 60 °C to 95 °C with a ramp rate of 0.1 °C/s.

Apoptosis and MTT assay

For apoptosis analysis, 1 × 10⁵ cells per well were plated in 12-well plates, transfected with dCas9-TET1 and sgRNA (0.8 µg total plasmid), and incubated for 72 h. Cells were stained with annexin V-FITC and propidium iodide and analyzed by flow cytometry using Abnova™ kit (KA0715).

An MTT assay was performed to measure cell viability. Transfected cells were plated at 5,000 cells/well in 96-well plates, treated with 20 µL of 5 mg/mL MTT reagent, and incubated for 4 h at 37 °C. The formazan crystals were dissolved in DMSO, and absorbance at 570 nm (reference: 630 nm) was measured.

Statistical analysis

All experimental assays, including cell viability (MTT), apoptosis and real-time PCR, were performed in independent replicates. Data are presented as mean ± standard error (SE). Statistical comparisons among experimental groups were conducted using GraphPad Prism³⁶. Quantitative PCR data were analyzed using REST 2009 software Version 3³⁷, with expression levels normalized to GAPDH and U6. Fold changes and corresponding p-values were calculated automatically by REST, and a p-value threshold of 0.05 was applied for significance.

The AI-generated suggestions were limited to grammar, style, and structure, and all outputs were carefully reviewed, edited, and approved by the authors to ensure scientific accuracy and integrity.

Author contributions

M.A. Designed the study, contributed to data analysis, wrote and edited the final draft. M.Z. Performed laboratory experiments, analyzed data, and drafted the manuscript. Y.A. Performed laboratory experiments. M.K., F.R.J., V.V. Contributed to data interpretation, manuscript review, and revisions.

Data availability

Sequence data that support the findings of this study have been deposited in the ENSEMBL Gene: MIR200C ENSG00000207713 promoter from https://asia.ensembl.org/Homo_sapiens/Gene/Sequence? g= ENSG00000207713;r=12:6963699-6963766;t=ENST00000384980. The other datasets during the current study are available from the corresponding author upon reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Table 1. Sequences of gRNA oligonucleotides and primers used for PCR, real-time PCR, and High-Resolution Melting (HRM) analysis.