Effects of pectic oligosaccharide on growth performance, organ indexes and intestinal health in broilers exposed to aflatoxin B₁

Abstract

This study aimed at investigating the influences of pectic oligosaccharide (POS) on growth performance, organ indexes and intestinal health in broilers exposed to aflatoxin B₁ (AFB₁). In vitro experiment was conducted to assess reactive oxygen species (ROS)-scavenging ability of POS. In vivo experiment was then implemented by allocating 320 one-day-old yellow-feathered broilers to 4 groups (8 replicates/group), according to a 2 × 2 factorial arrangement with POS addition (0 or 400 mg/kg) and AFB₁ exposure (with or without) as the two factors. All parameters were determined on d 21. The results revealed an in vitro ability of POS to scavenge ROS. AFB₁ exposure tended to decrease (P < 0.10) average daily gain (ADG) and average daily feed intake (ADFI), as well as caused abnormities in liver, thymus and bursal indexes. It also elevated (P < 0.05) intestinal ROS and malondialdehyde contents but reduced (P < 0.05) intestinal catalase and glutathione peroxidase activities, as well as caused intestinal injuries including the decreasing trends (P < 0.10) of ileal villus height:crypt depth ratio and the relative mRNA expression of claudin-1 together with the increasing trend (P < 0.10) of serum diamine oxidase (DAO) activity. POS addition tended to elevate (P < 0.10) ADG and ADFI, as well as mitigated AFB₁-induced elevation (P < 0.10) in spleen index and reduction (P < 0.05) of bursal index. Moreover, POS addition tended to enhance (P < 0.10) ileal total antioxidant capacity in AFB₁-exposed broilers. Besides, POS addition lowered (P < 0.05) ROS level and increased (P < 0.05) glutathione content in ileum, as well as showed a tendency (P < 0.10) to elevate ileal claudin-1 expression and decrease serum DAO activity of broilers regardless of AFB₁ exposure. Collectively, supplemental POS benefited growth performance and organ indexes of broilers exposed to AFB₁, which could attribute to its ability to ameliorate intestinal redox state and integrity. These findings underscore a potential of POS to attenuate the detriments of AFB₁ contamination in diets.

Introduction

Aflatoxins are the secondary metabolites of Aspergillus flavus and composed of several kinds of toxins with similar structures, among which aflatoxin B₁ (AFB₁) is the most toxic especially for poultry. AFB₁ is prevalent in feed grains (such as corn) especially those produced in the regions with high temperature and humidity. A previous investigation disclosed high contamination rate (more than 83%) of AFB₁ in feeds from different provinces of China (Ma et al., 2018). Thus, AFB₁ contamination represents one of the major safety problems in feed formulation and poultry production. Increasing studies have evidenced that chickens exposed to AFB₁ can display a variety of structural and functional abnormities of multiple organs, including swelling and cell apoptosis of the liver together with disruptions of intestinal morphology and barrier functions (Sarker et al., 2023; Putra et al., 2024), thus endangering the growth and health in chickens (Choi et al., 2025). In view of the toxicity of AFB₁, many countries and regions have enacted strict limit standards about AFB₁ content in feeds. According to the Hygienical Standard for Feeds (GB 13078-2017) in China, the limit standard of AFB₁ in chicken diets is far lower than that of any other mycotoxins, which underscores the seriou hazards of AFB₁ contamination to chicken production.

One of the critical mechanisms for AFB₁ toxicity is the induction of oxidative stress (Jobe et al., 2023), as characterized by the overproduction of reactive oxygen species (ROS) together with reduced generation of antioxidants within the body (Nabi et al., 2024). It has been established that AFB₁-induced oxidative stress facilitates peroxidation and onslaught of several biomacromolecules such as lipids, proteins and nucleic acids (Xue et al., 2025), which may impair animal growth and health (Nabi et al., 2022; Putra et al., 2024). Accordingly, inhibiting the resulting oxidative stress represents an underlying approach to attenuate the toxic effects of AFB₁ in chickens. Since the intestine is a targeted organ early contacting with external compounds, intestinal epithelia are vulnerable to be exposed to dietary mycotoxins (Sarker et al., 2023; Choi et al., 2025). Considering the role of intestine as a key organ undertaking digestion, absorption, immune and barrier functions that can profoundly impact growth and systemic health of animals (Choi et al., 2025), it is important to explore the strategies of diminishing the enterotoxicity of AFB₁ that may be realized through mitigating intestinal oxidative stress (Zhang et al., 2023; Zhang et al., 2024).

There is an increasing interest to characterize specific functional oligosaccharides as potential inhibitors of intestinal oxidative stress to restrain the toxic effects of certain mycotoxins (e.g. T-2 toxin and fumonisin B1) in animals (Hafner et al., 2019; Li et al., 2022). Pectic oligosaccharide (POS) represents an acidic functional oligosaccharide commonly produced from the enzymatic hydrolysis of pectin, which serves as a component spreading broadly in the cell walls of multifarious plants. POS is generally comprised of D-galacturonic acid units connected via α-(1,4) glycosidic bonds that can not be degraded by digestive enzymes secreted by the intestine. In vitro experiments have evidenced that POS has remarkable bioactivities including the ability to eliminate certain free radicals (Sabater et al., 2021; Yeung et al., 2021), which seems to be ascribed to the existence of specific reactive groups such as aldehyde and hydroxyl groups (Yeung et al., 2021). In animal production-related studies, POS addition was reported to ameliorate growth performance and intestinal morphology in broiler chickens (Wang et al., 2019), as well as fortify intestinal antioxidant property and barrier functions in broiler breeders especially those with low egg production (Mao et al., 2021). Besides, POS addition was demonstrated to enhance antioxidant capacity of genital tract and thus improve the reproductive performance of broiler breeders (Wang et al., 2021). Based on the above researches, we supposed that POS could protect chickens from AFB₁ exposure through its antioxidant property. Consequently, this study aimed to probe the potential efficacy of POS addition in alleviating AFB₁-induced intestinal oxidative stress that might bring about improvement of growth performance in broiler chickens, thus offering a novel strategy in limiting the hazards of AFB₁ contamination in chicken diets.

Materials and methods

Preparation of POS

POS was prepared referring to a previous study (Wang et al., 2022a) with some modifications. In brief, citrus-derived polygalacturonic acid (Aladdin, Shanghai, China) dissolved in 50 mM acetic acid-sodium acetate buffer (pH 5.5) was heated at 55°C and then hydrolyzed with 60 U/mL pecticase (Sigma-Aldrich, St. Louis, USA). After thorough blending and enzymolysis for 30 min, the reaction system was inactivated at 100°C, followed by centrifugation at 4,000 × g for 10 min. The collected supernatant was vacuumized by 0.22-μm filter membrane. The filtrate was concentrated by rotary evaporation, followed by slow supplementation of 35% ethanol with simultaneous agitation. After being placed at 4°C for 2 h and centrifuged at 4,000 × g for 10 min, the resulting supernatant was incubated with 75% ethanol at 4°C for 2 h and subsequently centrifuged at 4,000 × g for 10 min. The obtained supernatant was concentrated by rotary evaporation and freeze-dried in vacuum. The resultant solid was ground and crushed through a 40-mesh screen to generate POS powder, whose weight-average degree of polymerization was calculated as 7.0 (92% purity).

In vitro evaluation of free radicals-scavenging ability of POS

Evaluation of 1,1-diphenyl-2-picrylhydrazyl (DPPH)-scavenging ability of POS

POS solution with different concentrations (0.1, 0.2, 0.4, 0.8, 1.6, 3.2 and 6.4 mg/mL) was added to 96-well plate (100 μL/well) and then supplemented with 0.02 mmol/L aqueous ethanol solution of DPPH (100 μL/well). The above solutions were thoroughly mixed and incubated at room temperature (in dark) for 30 min, followed by determination of absorbance at 517 nm. Distilled water and anhydrous ethanol serve as the blank control and solvent control, respectively, while vitamin C solution (0.1, 0.2, 0.4, 0.8, 1.6, 3.2 and 6.4 mg/mL) acts as the positive control. Finally, the clearance rate of DPPH was calculated according to the following formula: clearance rate (%) = [1-(A₁-A₂)/A₀] × 100%, A₀ represents the absorbance of blank control, A₁ represents the absorbance of measuring objects (POS or vitamin C), while A₂ represents the absorbance of solvent control.

Evaluation of hydroxyl radical (·OH)-scavenging ability of POS

POS solution with different concentrations was added to 96-well plate (50 μL/well) and then supplemented with 9 mmol/L aqueous ethanol solution of salicylic acid (50 μL/well) combined with 9 mmol/L FeSO₄ (50 μL/well) and 8.8 mmol/L H₂O₂ (50 μL/well), in order to initiate Fenton reaction to produce ·OH. The above solutions were thoroughly mixed and subjected to water bath at 37°C for 30 min, followed by determination of absorbance at 510 nm. Finally, the clearance rate of ·OH was calculated according to the formula described above.

Evaluation of superoxide anion (O₂·⁻)-scavenging ability of POS

The clearance rate of O₂·⁻ by POS (vitamin C acts as the positive control) was determined using a commercial O₂·⁻-Scavenging Ability Detection Kit (Solarbio, Beijing, China) following the manufacturer′s protocols.

Design of animal experiment

The experimental animal protocols of this study were approved by the Animal Care and Use Committee of the South China Agricultural University (Guangzhou, China). A total of 320 1-d-old Tu-San yellow-feathered female broilers were randomly assigned to 4 groups with 8 replicates per group and 10 broilers per replicate (broilers in each replicate had similar initial body weight), according to a 2 × 2 factorial arrangement with POS addition (with or without) and AFB₁ contamination (with or without) as the two factors. Broilers received the basal diet supplemented with 0 or 400 mg/kg POS (the addition level of POS was determined based on our preliminary experiment) from 1-21 d of age. Meanwhile, the basal diet was free of or contaminated with extra AFB₁ (99% purity; Pribolab, Qingdao, China) during d 1-21 according to the following procedures. AFB₁ powder was first dissolved in anhydrous ethanol and thoroughly blended in distilled water, which were then evenly sprayed on a small amount of feed, followed by drying in the oven with constant temperature (37°C). The resulting dried feed was then mixed step by step into basal diet. Through using a liquid chromatography/mass spectrometry instrument (Waters TQ-XS, Milford, USA), AFB₁ content in basal diet was detected to be less than 2 μg/kg, which was far lower than the maximum allowable level in chick diets as stipulated in the China National Standard (2017) (GB13078-2017), while the content of AFB₁ in AFB₁-contaminated diet was determined to be 186 μg/kg. The nutritional composition of basal diet is described in Table 1. All broilers were housed in battery cages in an environmentally controlled room in which the temperature was maintained at 34°C for the first three days and then decreased by 3°C per week until it reached 24°C. Broilers had free access to the diets and drinking water as well as received incandescent light for 23 h per day throughout the trial.

Table 1.

Composition of the basal diet (air-dry basis).

Ingredients	Content (%)
Corn	55.00
Soybean meal	30.00
Extruded soybean	8.00
Soybean oil	1.50
Limestone	1.30
Dicalcium phosphate	1.20
Sodium bicarbonate	0.15
Choline chloride (50%)	0.10
Sodium chloride	0.20
L-Lysine. HCl (98.5%)	0.40
DL-Methionine (99%)	0.30
Premix1	1.00
Total	100.00
Nutrient levels
Metabolizable energy (MJ/kg)	12.30
Crude protein	21.50
Calcium	0.95
Available phosphorus	0.48
Lysine	1.35
Methionine	0.55
Methionine + cysteine	0.95

¹Premix provided per kilogram of diet: VA 5400 IU, VD₃ 2000 IU, VE 31 mg, VK₃ 16 mg, VB₁ 1.7 mg, VB₂ 7.5 mg, VB₆ 3.5 mg, VB₁₂ 0.015 mg, pantothenate 14 mg, nicotinamide 15 mg, biotin 0.05 mg, folic acid 1.5 mg; Cu 9.5 mg, Fe 70 mg, Mn 121 mg, Zn 60 mg, I 1.40 mg, Se 0.45 mg.

Sample collection

One broiler was stochastically chose from each replicate and then weighed. The wing vein blood was aseptically collected from each broiler and centrifuged at 3,000 × g for 10 min, the resultant serum samples were harvested and stored at -30°C until analysis. Subsequently, the above broilers were slaughtered for segregating visceral organs (including the liver, spleen, thymus and bursa of Fabricius) and subjected to gravimetric analysis. Besides, the middle parts of jejunal and ileal tissues were collected and separately dissected into two sections, one of which was soaked in 4% paraformaldehyde solution, and the other one was rapidly froze in liquid nitrogen prior to storage at -80°C. In addition, jejunal and ileal mucosa samples were collected for determining redox state-related parameters. Note: the middle part of ileal tissue rather than jejunal tissue was selected to be analyzed, because POS was eventually found to lower the contents of oxidative products in ileal mucosa rather than jejunal mucosa.

Determinations of growth performance and organ indexes

The body weight and feed consumption of broilers aged 21 d were recorded per replicate. The final body weight (FBW), average daily feed intake (ADFI), average daily gain (ADG) and feed-to-gain ratio (F/G) from d 1-21 were then determined. In addition, the excised liver, spleen, thymus, and bursa of Fabricius were weighed for measuring organ indexes, which were computed as organ weight (g) relative to live body weight (kg).

Serum parameters assay

The activities of alanine aminotransferase (ALT), aspartate aminotransferase (AST) along with the contents of albumin (ALB), total bilirubin (T-BIL) and direct bilirubin (D-BIL) in serum samples were detected by using an automatic Biochemical Analyzer (HITACHI 7180, Tokyo, Japan). Serum diamine oxidase (DAO) activity was determined using a colorimetry-based commercial kit (Grace, Suzhou, China).

Measurement of redox state-related parameters in the intestine

The oxidative products including ROS and malondialdehyde (MDA) in jejunal and ileal mucosa were quantified using the commercial kits purchased from Geruisi Biotechnol. Co. (Suzhou, China) and Beyotime Biotechnol. Co. (Shanghai, China), respectively, which were based on the fluorescent probe method and colorimetric method, respectively. Besides, the activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) together with glutathione (GSH) content and total antioxidant capacity (T-AOC) in jejunal and ileal mucosa samples were measured using the commercial kits (Jiancheng Bioengineering Institute, Nanjing, China) in accordance with the manufacturer′s instructions. The results of above-mentioned parameters were normalized by total protein content, which was determined using the bicinchoninic acid protein quantitation kits (Thermo Fisher Scientific, Waltham, USA).

Intestinal morphological analysis

Ileal tissues soaked in 4% paraformaldehyde solution were embedded in paraffin and subjected to hematoxylin-eosin staining. For each section, the representative villi with intact structure were selected for examing intestinal morphological structure using the Motic BA310 microscope with JD-801 morphological image analysis system. Afterwards, the villus height (VH), crypt depth (CD) and VH-to-CD ratio (VCR) of each section in each sample were calculated on the basis of our previous study (Wang et al., 2023).

Intestinal gene expression assay

Total RNA samples were extracted from the ileum by using the FastPure® RNA isolation kits (Vazyme, Nanjing, China). After detection of the concentration and purity using the ultraviolet spectrophotometer Nano-Drop 2000 (Thermo Fisher Scientific, Waltham, USA) and verification of the integrity via agarose gel eletrophoresis, RNA samples were reverse-transcribed into cDNA samples using the HiScript Ⅱ qRT SuperMix kits (Vazyme, Nanjing, China). The real time PCR was implemented using the 2 × ChamQ SYBR qPCR Master Mix kits (Vazyme, Nanjing, China) in Archimed-X4 Real Time PCR instrument (RocGene, Beijing, China). The primer informations for reference gene (glyceraldehyde-3-phosphate dehydrogenase) and target genes are presented in Table 2. Finally, the 2^-ΔΔCt method was used to calculate the relative mRNA expression of target genes.

Table 2.

Primer informations used in the RT-PCR.

Genes1	Sequences (5′→3′)	Accession number
GAPDH	F: GGGCACGCCATCACTATCTT	NM_204305.2
	R: TCACAAACATGGGGGCATCA
Claudin-1	F: CACTGCCACTCCCTGATGTT	NM_001013611.2
	R: ACCGGTGACAGACTGGTTTC
Occludin	F: TTCGTCATGCTCATCGCCTC	NM_205128.1
	R: TCCACGGTGCAGTAGTGGTA
ZO-1	F: CTTCAGGTGTTTCTCTTCCTCCTC	XM_046925214.1
	R: CTGTGGTTTCATGGCTGGATC

¹GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ZO-1, zonula occluden-1.

Statistical analysis

Data are presented as mean ± pooled standard error of mean (SEM) and subjected to the two-way ANOVA of SPSS 26.0 to examine the main effects of AFB₁ exposure and POS addition. One-way ANOVA would be employed to further analyze the results if interactions were significant. The differences among groups after ANOVA were detected by Duncan's multiple comparisons. P < 0.05 was viewed as significance, while 0.05 ≤ P < 0.10 was regarded as a trend towards significance.

Results

In vitro free radicals-scavenging ability of POS

As presented in Fig. 1, POS was capable of scavenging several free radicals including DPPH, ·OH and O₂·⁻, with higher concentration of POS exhibiting stronger ability to scavenge the above free radicals especially DPPH and ·OH. When the concentration of POS reached 6.4 mg/mL, the clearance rates for DPPH and ·OH by POS treatment reached 90.75% and 71.71%, respectively. These results highlighted a role of POS as a remover of free radicals.

Fig. 1.

In vitro evaluation of the free radicals-scavenging ability of pectic oligosaccharide (POS). DPPH, 1,1-diphenyl-2-picrylhydrazyl; ·OH, hydroxyl radical; O₂·⁻, superoxide anion; VC, vitamin C.

Growth performance and organ indexes

As shown in Table 3, both ADG and ADFI of broilers showed a tendency towards reduction (P < 0.10) in response to AFB₁ exposure, whilst POS addtion tended to elevate (P < 0.10) ADG and ADFI of broilers rgardless of AFB₁ exposure.

Table 3.

Effects of pectic oligosaccharide (POS) on growth performance¹ of aflatoxin B₁ (AFB₁)-exposed broilers² (d 1-21).

Items	AFB1 (-)		AFB1 (+)		SEM3	P-value
	CON	POS	CON	POS		POS	AFB1	Interaction
IBW (g)	33.58	33.60	33.61	33.63	0.011	-	-	-
FBW (g)	324.82	332.95	320.12	325.09	3.287	0.344	0.363	0.817
ADG (g)	13.69	14.51	13.39	13.66	0.165	0.094	0.079	0.377
ADFI (g)	24.11	25.19	23.33	24.10	0.260	0.058	0.056	0.737
F/G	1.74	1.75	1.74	1.73	0.006	0.909	0.387	0.369

¹IBW, initial body weight; FBW, final body weight; ADG, average daily gain; ADFI, average daily feed intake; F/G, feed-to-gain ratio.

²Broilers received a normal diet or AFB₁ (400 μg/kg)-contaminated diet supplemented with 0 or 400 mg/kg POS during d 1-21.

³SEM, standard error of mean.

AFB₁ exposure tended to increase (P < 0.10) liver index but tended to decrease (P < 0.10) bursa of Fabricius index (Table 4), as well as decreased (P < 0.05) thymus index of broilers. POS addition and AFB₁ exposure had interactions (P < 0.05) on bursal and thymus indexes, as well as tended to elicit interactions (P < 0.10) on liver and spleen indexes. Notably, POS addition normalized AFB₁-induced reduction of bursal index, as well as tended to decrease (P < 0.10) spleen index of AFB₁-exposed broilers.

Table 4.

Effects of pectic oligosaccharide (POS) on organ indexes of aflatoxin B₁ (AFB₁)-exposed broilers¹ (d 21).

Items	AFB1 (-)		AFB1 (+)		SEM2	P-value
	CON	POS	CON	POS		POS	AFB1	Interaction
Liver index (g/kg)	26.09	28.27	28.97	28.25	0.433	0.355	0.080	0.076
Spleen index (g/kg)	1.31	1.31	1.67	1.13	0.072	0.052	0.507	0.055
Bursal index (g/kg)	2.51a	2.31ab	2.00b	2.36a,b	0.074	0.559	0.089	0.047
Thymus index (g/kg)	5.14a	4.24b	3.81b	3.96b	0.155	0.113	0.002	0.031

^aValues within a row with different superscript letters differ significantly (P < 0.05).

^bValues within a row with different superscript letters differ significantly (P < 0.05).

¹Broilers received a normal diet or AFB₁ (400 μg/kg)-contaminated diet supplemented with 0 or 400 mg/kg POS during d 1-21.

²SEM, standard error of mean.

Serum parameters

As presented in Table 5, there were interactions (P < 0.05) between POS addition and AFB₁ exposure on serum ALT level, as exhibited by the mitigating effects (P < 0.05) of POS addition on AFB₁-induced elevation (P < 0.05) in serum ALT level. Serum D-BIL level was elevated (P < 0.05) by AFB₁ exposure but remained unchanged (P > 0.05) in response to POS addition. Besides, AFB₁ exposure showed a trend to elevate (P < 0.10) serum DAO activity, while POS addition tended to lower (P < 0.10) it regardless of AFB₁ exposure.

Table 5.

Effects of pectic oligosaccharide (POS) on serum biochemical parameters¹ of aflatoxin B₁ (AFB₁)-exposed broilers² (d 21).

Items	AFB1 (-)		AFB1 (+)		SEM3	P-value
	CON	POS	CON	POS		POS	AFB1	Interaction
ALT (U/L)	4.00b	3.80b	5.83a	3.20b	0.325	0.012	0.237	0.027
AST (U/L)	273.75	277.80	287.60	255.17	5.792	0.219	0.698	0.120
ALB (g/L)	13.91	14.10	14.62	12.28	0.345	0.118	0.412	0.069
T-BIL (μmol/L)	10.23	9.63	11.43	10.32	0.553	0.226	0.181	0.713
D-BIL (μmol/L)	7.12	7.78	9.31	8.85	0.354	0.883	0.022	0.400
DAO (U/L)	7.45	6.02	7.97	7.41	0.293	0.078	0.089	0.421

^aValues within a row with different superscript letters differ significantly (P < 0.05).

^bValues within a row with different superscript letters differ significantly (P < 0.05).

¹ALT, alanine aminotransferase; AST, aspartate aminotransferase; ALB, albumin; T-BIL, total bilirubin; D-BIL, direct bilirubin; DAO, diamine oxidase.

²Broilers received a normal diet or AFB₁ (400 μg/kg)-contaminated diet supplemented with 0 or 400 mg/kg POS during d 1-21.

³SEM, standard error of mean.

Redox state-related parameters of the intestine

As displayed in Table 6, AFB₁ exposure increased (P < 0.05) jejunal ROS and ileal MDA content, as well as tended to increase (P < 0.10) jejunal MDA content, whilst POS addition decreased (P < 0.05) ileal ROS content. AFB₁ exposure increased (P < 0.05) jejunal and ileal SOD activity (Table 7), but decreased (P < 0.05) jejunal GSH-Px activity and ileal CAT activity. POS addition increased (P < 0.05) jejunal and ileal GSH content regardless of AFB₁ exposure. An interaction (P < 0.05) was recorded between AFB₁ exposure and POS addition on ileal CAT activity, as evidenced by that POS addition reduced (P < 0.05) this parameter under normal condition but other than AFB₁ exposure condition. Besides, there was a tendency towards interaction (P < 0.10) between AFB₁ exposure and POS addition on jejunal CAT activity and ileal T-AOC, as evidenced by that POS addition tended to elevate (P < 0.10) these parameters under AFB₁ exposure condition rather than normal condition.

Table 6.

Effects of pectic oligosaccharide (POS) on intestinal oxidative products¹ contents of aflatoxin B₁ (AFB₁)-exposed broilers² (d 21).

Items	AFB1 (-)		AFB1 (+)		SEM3	P-value
	CON	POS	CON	POS		POS	AFB1	Interaction
Jejunum
ROS	82.77	91.20	142.28	110.16	9.598	0.511	0.041	0.267
MDA	0.43	0.48	0.53	0.49	0.016	0.819	0.055	0.131
Ileum
ROS	176.06	139.17	206.58	115.83	13.296	0.012	0.874	0.246
MDA	0.37	0.34	0.48	0.41	0.018	0.112	0.008	0.485

¹ROS, reactive oxide species (fluorescence intensity/mg prot.); MDA, malondialdehyde (nmoL/mg prot.).

²Broilers received a normal diet or AFB₁ (400 μg/kg)-contaminated diet supplemented with 0 or 400 mg/kg POS during d 1-21.

³SEM, standard error of mean.

Table 7.

Effects of pectic oligosaccharide (POS) on intestinal antioxidation parameters¹ of aflatoxin B₁ (AFB₁)-exposed broilers² (d 21).

Items	AFB1 (-)		AFB1 (+)		SEM3	P-value
	CON	POS	CON	POS		POS	AFB1	Interaction
Jejunum
SOD (U/mg prot.)	46.54	47.01	55.13	52.26	1.079	0.345	<0.001	0.194
CAT (U/mg prot.)	3.93	3.53	3.04	3.69	0.137	0.631	0.168	0.054
GSH-Px (U/mg prot.)	54.68	55.26	23.01	33.13	4.185	0.361	<0.001	0.414
GSH (nmoL/mg prot.)	34.43	49.13	32.70	47.22	1.954	<0.001	0.465	0.970
T-AOC (U/g prot.)	0.15	0.14	0.14	0.14	0.004	0.861	0.437	0.452
Ileum
SOD (U/mg prot.)	37.70	39.14	46.75	42.86	1.097	0.476	0.001	0.129
CAT (U/mg prot.)	3.64a	2.90b	2.46b	2.82b	0.150	0.457	0.024	0.046
GSH-Px (U/mg prot.)	85.20	82.12	89.96	87.26	1.617	0.392	0.153	0.954
GSH (nmoL/mg prot.)	82.96	103.84	94.14	103.45	3.370	0.023	0.379	0.346
T-AOC (U/g prot.)	0.14	0.14	0.13	0.16	0.004	0.067	0.337	0.077

^aValues within a row with different superscript letters differ significantly (P < 0.05).

^bValues within a row with different superscript letters differ significantly (P < 0.05).

¹SOD, superoxide dismutase; CAT, catalase; GSH-Px, glutathione peroxidase; GSH, glutathione; T-AOC, total antioxidant capacity.

²Broilers received a normal diet or AFB₁ (400 μg/kg)-contaminated diet supplemented with 0 or 400 mg/kg POS during d 1-21.

³SEM, standard error of mean.

Intestinal morphology

The above results suggested that POS addition could lower the contents of oxidative products in the ileum rather than jejunum, and was more effective in improving antioxidation parameters in the ileum than those in the jejunum. Thereby, we selected the ileum sample for further analysis. As presented in Table 8, AFB₁ exposure elevated (P < 0.05) ileal CD and tended to lower (P < 0.10) ileal VCR of broilers. However, POS addition exerted no impacts (P > 0.05) on ileal morphology of broilers regardless of AFB₁ exposure.

Table 8.

Effects of pectic oligosaccharide (POS) on ileal morphology¹ of aflatoxin B₁ (AFB₁)-exposed broilers² (d 21).

Items	AFB1 (-)		AFB1 (+)		SEM3	P-value
	CON	POS	CON	POS		POS	AFB1	Interaction
VH (μm)	751.86	835.93	856.48	834.08	17.939	0.354	0.134	0.122
CD (μm)	139.97	151.38	190.01	175.50	7.604	0.937	0.011	0.321
VCR	5.30	5.32	4.25	4.97	0.194	0.322	0.071	0.349

^aValues within a row with different superscript letters differ significantly (P < 0.05).

^bValues within a row with different superscript letters differ significantly (P < 0.05).

¹VH, villus height; CD, crypt depth; VCR, the ratio of VH to CD.

²Broilers received a normal diet or AFB₁ (400 μg/kg)-contaminated diet supplemented with 0 or 400 mg/kg POS during d 1-21.

³SEM, standard error of mean.

Relative mRNA expression of intestinal tight junction (TJ) proteins

As exhibited in Fig. 2, AFB₁ exposure reduced (P < 0.05) the relative mRNA expression of ileal Occludin and tended to lower (P < 0.10) the relative mRNA expression of ileal Claudin-1 of broilers. In contrast, POS addition had a trend to elevate (P < 0.05) the relative mRNA expression of ileal Claudin-1 of broilers irrespective of AFB₁ exposure.

Fig. 2.

Effects of pectic oligosaccharide (POS) on the relative mRNA expression of intestinal tight junction proteins of aflatoxin B₁ (AFB₁)-exposed broilers (d 21). CON, control (broilers received a basal diet); POS, broilers received a basal diet added with 400 mg/kg POS during d 1-21; AFB₁, broilers received a basal diet added with 400 μg/kg AFB₁ during d 1-21; AP, broilers received a basal diet added with 400 μg/kg AFB₁ and 400 mg/kg POS during d 1-21.

Discussion

The effect of AFB₁ on animal growth performance depends on its dosage, and the additive level of dietary AFB₁ in broiler-related trials was usually set at hundreds of micrograms per kilogram of diets (Choi et al., 2025). However, it still remains controversial regarding the dose-dependent impacts of dietary AFB₁ contamination on broiler growth performance. For example, it was reported that broilers received a diet containing 25∼400 μg/kg AFB₁ exhibited poor growth performance (Alharthi et al., 2022; Sang et al., 2023; Ma et al., 2024; Choi et al., 2025). Conversely, other research found that dietary inclusion of AFB₁ at a dose higher than 500 μg/kg did not impair broiler growth performance (Paneru et al., 2024). The discrepancies might be related to the disparities in broiler breeds and their physiological status. In this study, dietary AFB₁ contamination at 186 μg/kg impaired broiler growth performance to a degree, as manifested by the decreasing trends of ADFI and ADG. It was possible that the yellow-feathered broilers employed in this study were less sensitive to AFB₁ in comparison with white-feathered broilers, therefore showing relatively less impairment in growth performance in response to AFB₁ exposure. Previous studies have disclosed the ability of POS to ameliorate growth performance of broiler chickens (Wang et al., 2019) and reproduction performance of broiler breeders (Mao et al., 2021; Wang et al., 2021), but there was little information concerning if POS can benefit growth performance of animals exposed to mycotoxins. In this study, POS addition tended to augment ADFI and ADG of broilers regardless of AFB₁ exposure. This finding suggested that POS had a potential to ameliorate broiler growth performance, which could be associated with the observed capacity of POS to enhance intestinal health of broilers.

Organ indexes that can reflect health status in chickens often exhibit abnormities responding to toxins exposure (Wang et al., 2022b). Similar to previous researches (Solis-Cruz et al., 2019; Tolosa and Ruiz, 2021; Putra et al., 2024), we herein observed that AFB₁ exposure tended to augment liver and spleen indexes in the absence of POS. In contrast, thymus and bursal indexes were reduced by AFB₁ exposure, which coincided with the study of Peng et al. (2017). It was probable that dietary AFB₁ was translocated from gut lumen to certain organs via blood circulation (Putra et al., 2024). When AFB₁ translocated to the liver, it would perturb biochemical reactions and facilitate lipid accumulation in the liver, ultimately enlarging the liver of broilers (Tolosa and Ruiz, 2021; Putra et al., 2024). When AFB₁ translocated to the central lymphoid organs (e.g. thymus and bursa of Fabricius), it might induce apoptosis/depletion of lymphocytes in these organs with a compensatory increase in lymphocytes migration to the spleen (Peng et al., 2017; Guo et al., 2021; Nabi et al., 2024). These actions were supposed to account for the observed decreased indexes (namely atrophy) in thymus and bursa of Fabricius accompanied by an increasing trend of spleen index in AFB₁-exposed broilers. To date, the effect of POS on organ indexes of animals remains unknown. In this study, POS addition tended to elevate liver index as well as reduced thymus index of broilers under normal condition, the reason for which deserves further researches. However, POS addition caused no alterations of liver and thymus indexes in broilers under AFB₁ exposure, supporting that POS did not deteriorate AFB₁-induced abnormities of these organs. On the other hand, POS addition alleviated AFB₁-caused increasing trend of spleen index and reduction in bursal index, implying a role of POS in combating AFB₁-induced enlargement of spleen and atrophy of bursa of Fabricius in broilers. This was similar to the study of Guo et al. (2021) who reported that supplementation of an acidic polysaccharide reversed AFB₁-induced atrophy of bursa of Fabricius in broilers.

As the major metabolic organ capable of detoxifying toxins, liver is inevitablly damaged by the high concentration of AFB₁ (Choi et al., 2025), which probably triggers the releases of certain hepatogenic enzymes (e.g. ALT and AST) and metabolites into blood (Putra et al., 2024). These biomarkers in serum are thus viewed as the parameters reflecting liver injuries (Zhan et al., 2025). There was an evidence that AFB₁ exposure caused liver enlargement with an increased activity of serum ALT instead of AST in broilers (Solis-Cruz et al., 2019), which might be due to that AST is less specific to the liver and also abundant in some other organs and muscles, whilst ALT is highly specific to the liver (Lim, 2020). In the current study, AFB₁ exposure increased the activity of serum ALT rather than AST in the absence of POS and simultaneously increased serum D-BIL (an important metabolite of liver) level irrespective of POS addition, confirming a certain degree of liver injury induced by AFB₁ exposure. These findings corresponded with the observed increasing trend of liver index in AFB₁-exposed broilers. Intriguingly, POS addition counteracted AFB₁-induced increase in serum ALT activity although it did not normalize liver index, revealing a potential of POS to protect the liver of broilers against AFB₁ toxicity. The reason might be that POS enhanced antioxidant capacity inside the body (Mao et al., 2021; Wang et al., 2021), which favored to resist AFB₁-induced redox imbalance and membrane damage of hepatocytes but other than hepatic lipid accumulation, thus limiting the release of hepatocellular ALT into blood but without impacting liver index in broilers.

One of the important mechanisms for AFB₁ toxicity is to trigger oxidative stress inside the body (Jobe et al., 2023). As a targeted organ early contacting with dietary toxins, the intestine is one of the main sites where dietary AFB₁ exerts its toxicity through induction of oxidative stress (Sarker et al., 2023; Zhang et al., 2023). This was supported by this study which revealed that AFB₁ exposure increased the contents of jejunal ROS along with jejunal and ileal MDA (a renowed product of lipid peroxidation), as well as reduced certain antioxidase (GSH-Px and CAT) activities in jejunum or ileum. CAT functions as a major remover of H₂O₂, while GSH-Px efficiently eliminates hyperoxides including H₂O₂. Thus, the reduction of intestinal GSH-Px or CAT activity following AFB₁ exposure might promote lipid peroxidation, subsequently leading to the observed elevation of intestinal MDA content. Strikingly, AFB₁ exposure elevated intestinal SOD activity of broilers. The above findings were similar to the study of Rajput et al. (2017) who found that AFB₁ exposure increased MDA content and SOD activity but lowered the activities of other antioxidase (GSH-Px and CAT) in certain tissues of broilers. Likewise, Liu et al. (2020) observed opposite responses of different antioxidant enzymes to AFB₁ exposure in broilers. Surai et al. (2022) also detected increases in MDA content and SOD activity conccurent with declines in GSH-Px and CAT activities inside the body of animals under oxidative stress status. The above findings implied the complicated responses of antioxidant system in broilers to oxidative stress. It was probable that the generation of SOD, a first line of defense against ROS, could be quickly stimulated within the body under AFB₁ exposure, in order to cope with the inductive oxidative stress (He et al., 2017). However, the increased generation of SOD in AFB₁-exposed broilers might convert more O₂^.- into H₂O₂, whose production in excess potentially led to the observed decline of intestinal GSH-Px or CAT activity (Miguel et al., 2009). Previous researches have revealed that POS could eliminate free radicals due to the presence of aldehyde and hydroxyl groups (Sabater et al., 2021; Yeung et al., 2021). Similar results were obtained in in vitro experiment of this study which verified the ability of POS to scavenge free radicals (DPPH, ·OH and O₂·⁻) in a dose-dependent manner. In in vivo studies, POS addition was indicated to increase SOD activity and lower MDA content of intestinal and genital tracts in broiler breeders with low egg production (Mao et al., 2021; Wang et al., 2021). Additionally, the ameliorating effect of POS on serum antioxidant property of rotavirus-infected piglets was also reported (Chen et al., 2017). However, an understanding about the potential protective impact of POS on intestinal antioxidant property of animals exposed to mycotoxins is limited. In the current study, although POS addition did not alter intestinal antioxidases activities, it enhanced ileal T-AOC of AFB₁-exposed broilers as well as increased GSH content in both jejunum and ileum of broilers irrespective of AFB₁ exposure. These could favor to improve intestinal redox state of broilers, since GSH functions as a vital endogenous antioxidant to clear ROS (Chen et al., 2024). The reason for the increase in intestinal GSH content of POS-fed broilers might be that POS eliminated intestinal ·OH and then reduced the oxidation of GSH in the intestine. Intriguingly, POS addition decreased ileal CAT activity and tended to reduce jejunal CAT activity of broilers under normal condition instead of AFB₁-exposed condition. It was possible that the intestine did not require too strong capacity of antioxidation under normal condition. Thus, the increased content of intestinal GSH following POS addition might reduce the demand for CAT that shares a similar ability with GSH to eliminate H₂O₂ (He et al., 2017), subsequently leading to a reduction of intestinal CAT activity of broilers under normal condition.

Dietary AFB₁ contamination has been proved to damage intestinal morphology in chickens via multiple ways (Choi et al., 2025; Mohammadi et al., 2025), which in turn disturbs intestinal absorption and barrier, consequently compromising chicken growth performance (Sarker et al., 2023; Choi et al., 2025). Analogously, we herein detected an increase in ileal CD with a decreasing trend of ileal VCR of AFB₁-exposed broilers, suggesting that AFB₁ exposure caused moderate detriment instead of extreme destruction of intestinal morphology in broilers. This might explain the finding that AFB₁ exposure caused a relatively poor growth performance of broilers rather than extremely declined them. Previously, POS addition was showed to lengthen intestinal villi in broiler chickens (Wang et al., 2019). In contrast, it was also reported to exert no influence on any morphological parameters of the intestine in broiler breeders (Mao et al., 2021). In this study, we noted that POS addition did not improve ileal morphology in broilers regardless of AFB₁ exposure, which did not coincide with the responses of intestinal redox state-related parameters to POS addition. The reason might be that the oxidative stress was not the determining factor to destruct intestinal morphology of chickens (Mao et al., 2021; Choi et al., 2025). In support of this perspective, it was discovered that POS addition fortified antioxidant capacity and lowered oxidative product content in the intestine, but failed to ameliorate intestinal morphology of broiler breeders (Mao et al., 2021).

Intestinal integrity represents another essential contributor to intestinal barrier function and mainly depends on intraepithelial TJ, which are consisted of several unique proteins (such as claudin families, occludin, and ZO families) that influence intestinal paracellular permeability (Saha et al., 2025). It has been confirmed that mycotoxin-induced intestinal redox imbalance could further impede intestinal TJ proteins expression (Rajput et al., 2021), thus compromising intestinal barrier and favoring translocation of foreign substances from gut lumen to blood (Saha et al., 2025). Similar to the study of Mohammadi et al. (2025), we herein found that AFB₁ exposure elevated intestinal permeability, as supported by the reduced expression of ileal TJ proteins (occludin and claudin-1) coupled with increasing trend of the activity of serum DAO, an intracellular enzyme within intestinal epithelia serving as an indicator of intestinal integrity disruption (Dieryck et al., 2022; Wang et al., 2023). The increased intestinal permeability probably boosted the entry of intestinal AFB₁ into blood and then aggravated AFB₁-induced systemic health disorders such as the abnormal organ indexes in broilers (Choi et al., 2025). So far, there is a lack of information concerning whether POS can benefit intestinal TJ of broilers under toxins exposure, although it was reported to elevate intestinal ZO-1 expression of broiler breeders (Mao et al., 2021). In this study, we observed that POS addition tended to augment ileal claudin-1 (a core protein of TJ) expression and tended to lower serum DAO activity. These results suggested that POS addition enhanced intestinal integrity, which probably contributed to reduce the translocation of AFB₁ into blood (Choi et al., 2025), thereby weakening the abnormities in organ indexes of AFB₁-exposed broilers. Based on previous literatures (Sarker et al., 2023; Choi et al., 2025), we inferred that the beneficial effect of POS addition on intestinal integrity was linked with the observed capacity of it to improve intestinal redox state of broilers.

Conclusions

Supplemental POS ameliorated intestinal redox state and tended to fortify intestinal integrity of broilers regardless of AFB₁ exposure, which could contribute to the observed role of POS addition in benefiting growth performance and mitigating AFB₁-induced abnormities in immune organ indexes of broilers. The above findings can expand our knowledge about the application of POS in restraining the hazards of AFB₁ contamination in chicken diets.

Conflict of interest

The authors declare that they have no competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

CRediT authorship contribution statement

Zhengqi Ye: Writing – original draft, Investigation. Yongzhi Qin: Methodology, Investigation. Haijun Zhang: Resources. Meitian Xian: Formal analysis. Hui Ye: Conceptualization. Qingyun Cao: Software. Zemin Dong: Validation. Changming Zhang: Project administration. Jianjun Zuo: Supervision, Funding acquisition. Weiwei Wang: Writing – review & editing, Funding acquisition.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.