Skip to main content
iScience logoLink to iScience
. 2025 Aug 5;28(9):113298. doi: 10.1016/j.isci.2025.113298

Control of stress-activated Cdc42 dynamics by the MAP kinase Sty1—NDR kinase Orb6 regulatory axis

Laura P Doyle 1, Jun-Song Chen 2, Kathleen L Gould 2, Dannel McCollum 3, Fulvia Verde 1,4,
PMCID: PMC12397940  PMID: 40894867

Summary

Cdc42 is a Rho-family GTPase that controls cell polarization from yeast to human cells. In fission yeast, under normal growth conditions, Cdc42-GTP oscillates between cell tips to promote polarized growth. However, when exposed to environmental stressors, Cdc42 adopts an “exploratory” pattern of Cdc42 activation along the cell membrane. This pattern also occurs when the NDR kinase Orb6 is downregulated. Here, we describe the molecular mechanism behind the emergence of exploratory Cdc42 dynamics and identify a substrate of Orb6 kinase, the Cdc42 GAP Rga3. Additionally, we show that MAP kinase Sty1, known for linking stress signals to the Cdc42 polarity module, negatively regulates Orb6 kinase. During nutritional stress, activation of Sty1 and inactivation of Orb6 are associated with chronological lifespan extension. Our findings reveal a mechanism controlling cell morphology during stress, with important implications for cell survival.

Subject areas: Biochemistry, Cell biology

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • Cdc42 GAP Rga3 is a substrate of NDR kinase Orb6

  • Rga3 phosphorylation at Ser-683 by Orb6 promotes binding to 14-3-3 protein Rad24

  • Rga3 with Gef1 promote exploratory Cdc42 dynamics during nitrogen starvation

  • MAP kinase Sty1 inhibits Orb6 during stress to induce exploratory Cdc42 dynamics


Biochemistry; Cell biology

Introduction

Cell polarization is an important process involved in cell development, differentiation, migration, and the onset of disease.1,2,3,4,5,6 Normal cell polarization is crucial for proper cell movement, asymmetric cell division, and regulation of immune responses.5,6,7,8,9,10,11 Cdc42 GTPase is an essential regulator of polarized cell growth and is evolutionarily conserved in eukaryotes.12,13 In the yeasts, Schizosaccharomyces pombe and Schizosaccharomyces cerevisiae, Cdc42 plays a key role in establishing polarized cell growth.14,15,16,17,18,19,20 In higher eukaryotes such as Drosophila melanogaster and mammalian cells, Cdc42 also plays a central role in cell polarity.21,22,23,24,25,26 Cdc42 activity is promoted by guanine-nucleotide exchange factors (GEFs) which facilitate the binding of GTP to Cdc42.27 Conversely, GTPase activating proteins (GAPs) serve as negative regulators of Cdc42 as they promote the GTPase activity of Cdc42 leading to the hydrolysis of GTP into GDP.27 We previously showed that in the fission yeast S. pombe, active Cdc42 oscillates between the tips over time.16,17 This striking dynamic emerges from positive and negative feedbacks and competition for Cdc42 regulators and is conserved.16,28,29,30 Fission yeast provide an excellent model to study conserved signaling pathways in the control of cell morphogenesis due to its well-defined rod-shaped morphology which allows for straightforward measurement of cell growth and changes in polarization.

Nuclear Dbf2-related (NDR) kinases are a subclass of the AGC (protein A, G, and C) group of serine/threonine protein kinases.31,32 They are important for various cellular processes involving cell morphogenesis, mitosis, proliferation, and apoptosis and are highly conserved from yeast to humans.31,32 In higher eukaryotes, NDR kinases have a role in cancer biology, innate immunity, and neuron development.33,34,35,36,37,38 In S. pombe, the conserved NDR kinase is known as Orb6 and it plays a role in controlling cell polarized growth and cell morphogenesis,16,17,32,39,40,41,42,43,44 and it regulates the localization and activity of the key morphological regulator Cdc42 GTPase.16,17,44

During interphase and in the presence of nutrients, Orb6 promotes Cdc42 function at the cell tips by increasing the activity of the upstream regulator, Ras1.41 More specifically, Orb6 phosphorylates the conserved mRNA binding protein Sts5.41,42 Sts5 phosphorylation increases the protein levels of Efc25, an exchange factor and activator of Ras1 GTPase.41,42 Ras1 activation recruits the Cdc42 exchange factor Scd1 at the membrane to promote Cdc42 activation and cell polarization during vegetative growth.45,46 In addition to Sts5, Orb6 kinase also phosphorylates Gef1, the second exchange factor for Cdc42 GTPase, keeping it sequestered in the cytoplasm and inactive.40 This pattern of Cdc42 activation during vegetative growth when Orb6 is active leads to a “canonical” pattern of active Cdc42 distribution, with anticorrelated Cdc42 oscillations at the cell tips. Conversely, when Orb6 kinase activity is inhibited, Cdc42 dynamics changes fundamentally, with the emergence of “exploratory” Cdc42 patches along the lateral cell membrane.

Cell polarization is modulated dynamically in response to environmental stresses. Several groups have found that Cdc42 localization changes following activation of the mitogen-activating protein (MAP) kinase, Sty1,41,47,48,49 in response to a variety of environmental stressors including osmotic changes, oxidative stress, nutritional starvation, and heat shock.50,51,52,53,54,55 Specifically, activation of Sty1 promotes the formation of exploratory patches of active Cdc42 along the lateral cell membrane rather than exclusively at cell tips.47,48,56 The mechanisms underlying this switch is Cdc42 dynamics are not fully elucidated.

We have previously shown that Orb6 kinase activity decreases upon nutritional stress suggesting that Orb6 downregulation plays a role in cell morphogenesis and cell growth during nutritional deprivation.41 Consistent with these findings, Orb6 kinase downregulation before stress exposure leads to chronological lifespan extension during nutritional starvation.41 However, it is currently not known what leads to Orb6 inactivation during nutritional stress or how inactivating Orb6 under these conditions leads to the modulation of active Cdc42 distribution.

In this study, we find that the Cdc42 GTPase-activating protein (GAP) Rga3 is a substrate of the Orb6 kinase. We show that Orb6 activity negatively regulates Rga3 and limits Rga3 localization to the membrane. Rga3 and the Cdc42 GEF Gef1 cooperate to promote the emergence of exploratory Cdc42 dynamics during nitrogen starvation. Further, we discover that MAP kinase Sty1 activity negatively regulates Orb6 kinase and promotes Gef1 dephosphorylation on the Orb6 site S112. Together, these findings suggest that the switch from “canonical” Scd1-dependent Cdc42 activation in nutrient-rich conditions to “exploratory” Cdc42 dynamics is generated by Rga3 and Gef1 when Orb6 is inhibited by Sty1 during nutrient stress. Due to the role of Orb6 and Sty1 activity on cell survival, exploratory Cdc42 dynamics during nutrient starvation may have implications in promoting cell resilience during stress.

Results

Cdc42 GAP Rga3 membrane localization is regulated by Orb6 kinase activity

We previously showed that Gef1 and Sts5 phosphorylation by Orb6 promotes their binding to 14-3-3 protein Rad24.40,41,42 We have found that mutations of these two substrates at their respective Orb6 phosphorylation sites alter cell morphology.40,41 Mutations of the Orb6 phosphorylation sites in these proteins only partially recapitulate the effects of Orb6 kinase inhibition, however, suggesting that there are other substrates that contribute to the observed changes in Cdc42 dynamics. We reasoned therefore that Orb6 substrates might be identified by their association with the 14-3-3 protein, Rad24, in an Orb6-dependent manner. Thus, we used a mass spectrometry screen that was previously employed to successfully identify substrates of the related kinase, Sid2.57 Orb6 and Sid2 belong to the NDR/LATS family of protein kinases that preferentially phosphorylate the consensus sequence [HX(R/K/H)XX(S/T)].58,59,60,61,62,63 When the serine or threonine in this sequence becomes phosphorylated, it forms the consensus binding site for 14-3-3 proteins.40,41,42,64,65

Rad24-TAP complexes were purified from wildtype and temperature-sensitive orb6-25 cells, both shifted to 36°C for 3 h. Protein samples were digested and analyzed by two-dimensional liquid chromatography-tandem mass spectrometry (LC-MS/MS) to identify Rad24 binding partners. The abundance (spectral counts) of each Rad24 interactor was normalized to Rad24 abundance. The ratio of individual protein abundance in wildtype and orb6-25 was compared, revealing several proteins whose abundance declined in the absence of Orb6 function. These were considered putative Orb6 substrates (Table S1; PRIDE: PXD066553). In total, we identified 29 candidate substrates of Orb6, 18 of which contain putative Orb6 phosphorylation consensus sequences (Table S2). Validating the approach and supporting our previous findings, Gef1 and Sts5 were identified, which we previously showed are direct substrates of Orb6 kinase and bind to Rad24 in an Orb6-dependent manner.40,41,42 The factors identified by mass spectrometry have roles in biological processes involved in cell polarization and morphogenesis including kinase signaling, cytokinesis, metabolic processes, and cell polarity, and many contain consensus sites for Orb6 kinase phosphorylation ([HX(R/K/H)XX(S/T)]61,66 (Tables S1 and S2). In this study, we focused on Rga3, a Cdc42 GAP. Previously we have shown that active Cdc42 oscillates between cell tips when Orb6 is active16 (Figure 1A, Video S1). However, when Orb6 function is inhibited, Cdc42 dynamics change fundamentally. Loss of Orb6 activity leads to dampening of active Cdc42 at the tips and the appearance of ectopic active Cdc42 patches along the lateral cell membrane44 (Figure 1B, Video S2). Rga3 has an established role in promoting exploratory Cdc42 dynamics during mating,67 but so far was thought to be expendable during vegetative polarized cell growth. To test if Cdc42 dynamics are affected by loss of Rga3 upon Orb6 kinase inhibition, we used analogue-sensitive mutant orb6-as2 and visualized active Cdc42 (CRIB-GFP) by fluorescent microscopy (Figure 1C). We found that the loss of rga3 significantly reduces the formation of active Cdc42 lateral patches upon inhibition of orb6-as2 mutants with 1-NA-PP1 (Figure 1D). Furthermore, the amount of active Cdc42 present at the cell tips increases in rga3Δ deletion mutants (Figure 1E). These results demonstrate that the presence of Rga3 is important in promoting exploratory Cdc42 dynamics and reducing Cdc42 at the cell tips upon Orb6 inhibition.

Figure 1.

Figure 1

Cdc42 GAP Rga3 membrane localization is regulated by Orb6 kinase activity

(A) Active Cdc42 (CRIB-GFP) oscillates between cell tips over time (2-min intervals). Scale bar, 2 μm. See also Video S1.

(B) Orb6 inhibition by 1-NA-PP1 leads to the emergence of exploratory active Cdc42 patches along the cell membrane over time (2-min intervals). Scale bar, 2 μm. See also Video S2.

(C) Loss of rga3 reduces the formation of exploratory active Cdc42 (CRIB-GFP) patches along cell membrane upon inhibition of Orb6. Scale bar, 5 μm.

(D) Quantification of percentage of cells that display ectopic CRIB-GFP localization depicted in C based on three independent experiments. Data presented as mean ± SD, p values are determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗. n = number of cells quantified.

(E) Quantification of CRIB-GFP localization at the cell tips depicted in C based on three independent experiments, n = 52 for each group. Whiskers indicating minimum to maximum are shown, box represents 25th to 75th quartiles, and horizontal line represents median, p values determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.05, ∗; p ≤ 0.0001, ∗∗∗∗.

(F) Rga3-GFP localization at the cell tips increases in orb6-as2 mutants when Orb6 is inhibited by 1-NA-PP1 for 30 min. Scale bar, 5 μm.

(G) Quantification of F based on three independent experiments. Data presented as in E, p values determined by two-way ANOVA with Tukey’s multiple comparisons test, p ≤ 0.0001,∗∗∗∗.

(H) Rga3-GFP localization at the cell tips increases in rad24Δ deletion mutants. Images are a sum projection z stack of 6 images separated by a step-size of 0.3 μm. Scale bar, 5 μm.

(I) Quantification of H, whiskers indicating minimum to maximum are shown, box represents 25th to 75th quartiles, and horizontal line represents median. Welch’s t-test, p ≤ 0.0001,∗∗∗∗.

Video S1. Active Cdc42 oscillatory dynamics, related to Figure 1A

Fluorescent microscopy timelapse showing oscillations of active Cdc42 (CRIB-GFP) between cell tips.

Download video file (68.8KB, mp4)
Video S2. Active Cdc42 dynamics during Orb6 inhibition, related to Figure 1B

Fluorescent microscopy timelapse showing exploratory pattern of active Cdc42 (CRIB-GFP) along the cell membrane when analogue-sensitive orb6-as2 mutant is inhibited (+1-NA-PP1).

Download video file (25.8KB, mp4)

To test if Rga3 localization is affected by Orb6 inhibition, we performed fluorescent microscopy on wildtype and orb6-as2 mutant cells in which Rga3 is tagged with green fluorescent protein (GFP) (Figure 1F). We found that Rga3-GFP localization significantly increases at the cell tips upon treatment with 1-NA-PP1 in orb6-as2 cells (Figure 1G). To corroborate the idea that Rga3 localization is affected by 14-3-3 protein Rad24, we also visualized Rga3-GFP in the absence of Rad24 and found an increase of Rga3 localization at the cell membrane (Figures 1H and 1I). These results indicate that Rga3 localization at the tips is negatively regulated by Orb6 and Rad24 during vegetative polarized growth.

Our screen also identified the polarity factors Tea3 and Tea4, both of which play a role in establishing polarized cell growth68,69,70 as candidate targets of Orb6. Since Tea3 has been reported to physically interact with Rga3 by 2-hybrid,71 we tested if Orb6 kinase activity affects Tea3 localization and if loss of Tea3 affects the localization of Rga3. We found that, similarly to Rga3, Tea3 localization at the cell tips increases upon Orb6 inhibition (Figures S1A and S1B). Further, Rga3 localization to the cell tips is in part dependent on Tea3 (Figures S1C and S1D). Another factor, Tea4, forms a complex with another Orb6 target, the Cdc42 GEF Gef1.72 Thus, our findings suggest that Orb6 regulates polarity control complexes by promoting the interaction of individual components with Rad24.

Phosphorylation of serine 683 by Orb6 kinase alters Cdc42 GAP Rga3 localization

There are 4 putative Orb6 phosphorylation sites on Rga3 that share the Orb6 phosphorylation consensus site [HX(R/K/H)XX(S/T)].61,66 According to genome-wide phosphoproteomic screens performed by other groups, serine 683 is modified in different conditions including nitrogen starvation and during the cell cycle.66,73 Thus, to test the role of Orb6 phosphorylation on the S683 site, we converted S683 to alanine using CRISPR/Cas9 to construct a GFP-tagged nonphosphorylatable mutant, rga3-S683A-GFP, under the control of the endogenous promoter (Figure 2A). We found that Rga3-S683A-GFP localization is significantly increased at the tips relative to Rga3-GFP, similar to when Orb6 was inhibited (Figures 1F, 2B, and 2E). Additionally, we found that Rga3-S683A-GFP localization at the tips does not further increase upon Orb6 inhibition and that Rga3 protein levels are not affected by the S683A mutation (Figure S2). This result indicates that loss of S683 phosphorylation is sufficient to explain the Rga3 localization changes observed when Orb6 kinase is inhibited.

Figure 2.

Figure 2

Phosphorylation of serine 683 alters Cdc42 GAP Rga3 localization

(A) Protein domain map of Rga3. The arrow indicates serine 683 as the Orb6 consensus phosphorylation site (HX[R/K/H]XX[S/T]).

(B) Rga3-GFP localization increases in rga3-S683A-GFP mutants. Images are a sum projection z stack of 6 images separated by a step-size of 0.3 μm. Scale bar, 5 μm.

(C) Calcofluor staining of rga3-GFP and rga3-S683A-GFP mutants. Scale bar, 5 μm.

(D) CRIB-GFP fluorescence at the cell tips decreases in rga3-S683A-GFP mutants. Images are a sum projection z stack of 6 images separated by a step-size of 0.3 μm. Scale bar, 5 μm.

(E) Quantification of Rga3-GFP fluorescence depicted in (B) based on three independent experiments. Whiskers indicating minimum to maximum are shown, box represents 25th to 75th quartiles, and horizontal line represents median, p values are determined by Welch’s t-test, p ≤ 0.0001, ∗∗∗∗.

(F) Quantification of the percentage of bipolar cells depicted in (D) based on three independent experiments. Data are presented as mean ± SD, p values are determined by Welch’s t-test, p ≤ 0.05, ∗. n = number of cells quantified.

(G) Quantification of cell width depicted in (D) based on three independent experiments. Data presented as in E, p values are determined by two-tailed Student’s t test, p ≤ 0.0001, ∗∗∗∗.

(H) Quantification of cell length at septation depicted in (D) based on three independent experiments. Data presented as in E, p values are determined by two-tailed Student’s t test, p ≤ 0.0001, ∗∗∗∗.

(I) Quantification of CRIB-GFP fluorescence at cell tips depicted in (H) based on three independent experiments. Data presented as in E, p values are determined by two-tailed Student’s t test, p ≤ 0.05, ∗.

(J) Thiophosphorylation of His-Rga3-S683A decreases compared to His-Rga3 in Mob2-associated Orb6-as2 thiophosphorylation kinase assay.

(K) Thiophosphate ester/His quantification from (J) based on three independent experiments. Data are presented as mean ± SD, p values are determined by two-tailed Student’s t test, p ≤ 0.001, ∗∗∗.

To better understand the role of Rga3-S683 in cell morphology and the control of cell polarization, we imaged cells stained with Calcofluor to visualize the cell wall to measure bipolarity and cellular dimensions (Figure 2C). The relative abundance of Cdc42 regulators, such as Cdc42 guanine exchange factors (GEFs) and GTPase-activating protein (GAPs), at cell tips controls cell dimensions including diameter and the transition from monopolar to bipolar cell growth.16,27,67,74,75,76,77 As Calcofluor preferentially stains growing cell ends,78 we can visualize bipolar growth in S. pombe through fluorescent imaging of Calcofluor stained cells (detailed in methods). In rga3-S683A mutants, we found a decrease in the percentage of bipolar cells (Figure 2F), consistent with a decrease of Cdc42 activity at the cell tips. Further, we found a significant decrease in cell width and a corresponding increase in cell length of rga3-S683A mutant cells (Figures 2G and 2H). Decreased percentage of bipolarity and decreased cell width are consistent with increased levels of Rga3 negatively regulating Cdc42 activity at the cell tips.16 Consistent with this idea, we observed a decrease in the amount of active Cdc42 present at the tips in rga3-S683A cells (Figures 2D and 2I).

To test if Serine 683 in Rga3 is phosphorylated by Orb6 kinase, we performed an in vitro thiophosphorylation kinase assay by immunoprecipitating Mob2-myc bound Orb6-as2 kinase and incubating with bacterially expressed His-Rga3, with and without the S683A mutation. We found that the phosphorylation of Rga3 decreases with the rga3-S683A mutation (Figures 2J and 2K). Thus, these results demonstrate that Rga3 localization is altered by phosphorylation at the Orb6 consensus site S683 and that this phosphorylation controls cell morphology and active Cdc42 localization.

Rga3 and Gef1 promote exploratory Cdc42 dynamics upon attenuation of the vegetative Cdc42 control axis

Orb6 kinase promotes Ras1 activity and the recruitment of the canonical Cdc42 GEF Scd1 to cell tips by phosphorylation of the mRNA binding protein Sts5.41,45,46 Upon nitrogen starvation and reduced Orb6 activity, decreased Sts5 phosphorylation leads to a decline in Ras1 activity by lowering Efc25 protein levels.41 Thus, we investigated how the nonphosphorylatable mutants rga3-S683A and gef1-S112A might cooperate when the activity of the primary regulators of Cdc42 during vegetative growth drop, namely in efc25Δ deletion mutants, by measuring the frequency of cells displaying ectopic active Cdc42 patches. Remarkably, we found that in rga3-S683A gef1-S112A efc25Δ mutants, the frequency of cells displaying ectopic active Cdc42 patches strongly increases, as compared to wildtype, efc25Δ, and efc25Δ mutants containing either rga3-S683A or gef1-S112A alone (compare Figures 3Aa–3Ae and 3B).

Figure 3.

Figure 3

Rga3 and Gef1 promote exploratory Cdc42 dynamics upon attenuation of the vegetative Cdc42 control axis

(A) CRIB-GFP fluorescence (a–e) and calcofluor staining (f–j) of gef1-S112A-HA and rga3-S683A mutants in the background of efc25Δ. The triple mutant (efc25Δ gef1-S112A-HA rga3-S683A) displays exploratory Cdc42 dynamics and a round phenotype. Scale bar, 5 μm.

(B) Quantification of percentage of cells that display ectopic CRIB-GFP localization depicted in (A,a-e) based on three independent experiments. Data presented as mean ± SD, p values are determined by one-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗. n = number of cells quantified.

(C) Quantification of CRIB-GFP fluorescence at cell tips depicted in (A, a–e) based on three independent experiments. Whiskers indicating minimum to maximum are shown, box represents 25th to 75th quartiles, and horizontal line represents median, p values determined by one-way Brown-Forsythe and Welch ANOVA with Dunnett’s T3 multiple comparisons test p ≤ 0.01, ∗∗; p ≤ 0.0001, ∗∗∗∗.

(D) Quantification of the ratio of cell length to cell width at septation depicted in (A, f–j) based on three independent experiments. Data presented as in (C), p values determined by one-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗. n = number of cells quantified.

(E) Quantification of cell width at septation depicted in (A, f–j) based on three independent experiments. Data presented as in (C), p values determined by one-way ANOVA with Tukey’s HSD test p ≤ 0.05, ∗; p ≤ 0.0001, ∗∗∗∗. n = number of cells quantified.

We then investigated how active Cdc42 dynamics at the cell membrane are affected by nonphosphorylatable mutants gef1-S112A and/or rga3-S683A upon loss of the canonical Cdc42 GEF, Scd1. We found a significant increase in the proportion of cells with three or more patches of active Cdc42 in scd1Δ gef1-S112A rga3-S683A cells (Figures S3A and S3B). Conversely, the majority of wildtype, scd1Δ, and scd1Δ gef1-S112A cells display only 1–2 patches of active Cdc42 at the membrane, while scd1Δ rga3-S683A cells display a significant decrease of active Cdc42 (Figures S3B–S3G). Thus, these results indicate that Rga3 and Gef1 induce exploratory active Cdc42 dynamics when the vegetative Cdc42 control axis is attenuated.

To see how these mutants affect cellular dimensions, we measured the ratio of cell length to width of cells undergoing septation. When both rga3-S683A and gef1-S112A mutations are present in the absence of Efc25, the cells display a rounder phenotype during septation as compared to wildtype (Figures 3Aj, 3D, and 3E). In efc25Δ and upon addition of either nonphosphorylatable gef1-S112A or rga3-S683A mutations, cells undergo septation at a shorter length compared to wildtype (compare Figures 3Af–3Ai and 3D) but are not as round as the triple mutant (Figures 3Aj, 3D, and 3E). These results highlight how preventing Orb6 phosphorylation of Gef1 and Rga3 promotes the formation of active, exploratory Cdc42 patches when the main regulators of Cdc42 (Efc25 or Scd1) are downregulated. Furthermore, these results demonstrate that Rga3 and Gef1 together are crucial modulators of active Cdc42 dynamics in conditions where Orb6 is inactive, such as during nutritional stress.

During nutritional starvation or upon Orb6 kinase inhibition, the Cdc42 GEF Scd1 is reduced at the cell tips in a manner that is mediated by decreased levels of the Ras1 exchange factor Efc25.41 Concomitantly, active Cdc42 forms dynamic patches along the lateral cell membrane.41,44 Loss of gef1 strongly reduces these exploratory Cdc42 patches in orb6-25 temperature-sensitive mutants, indicating that Gef1 is essential for Cdc42 exploratory dynamics.44 We found that loss of rga3 significantly also reduces the formation of active exploratory Cdc42 patches upon Orb6 kinase inhibition while simultaneously increasing active Cdc42 at the cell tips (Figures 1C–1E). Therefore, since Orb6 kinase activity decreases during nitrogen starvation, we exposed rga3Δ, gef1Δ, and rga3Δ gef1Δ deletion mutants to nitrogen starvation to explore a potential cooperative role of Rga3 and Gef1 in controlling Cdc42 dynamics. Here, we found that the double rga3Δ and gef1Δ deletion mutant maintains the Cdc42 dynamics observed in a non-starved cell (compare Figures 4Aa and 4Ah), keeping high levels of Cdc42 activity at the cell tips, and abolishing the formation of lateral Cdc42 patches and Cdc42 exploratory dynamics. The single deletion mutant gef1Δ almost abolishes active Cdc42 from the cell membrane at both the tips and sides, highlighting the critical role of this Cdc42 GEF during nutritional deprivation, and indicating that when Rga3 levels increase at the membrane during nitrogen starvation, Cdc42 activity at the cell tips is repressed (Figures 4Ag, 4B, and 4C). Consistent with this idea, the loss of only rga3Δ maintains an increased level of active Cdc42 at the tips while significantly reducing the frequency of cells with patches (Figures 4Af, 4B, and 4C). These results indicate that both Gef1 and Rga3 cooperate to induce exploratory active Cdc42 dynamics during nutritional deprivation. They also suggest that repression of Cdc42 activity at cell tips is required to promote Cdc42 exploratory dynamics.

Figure 4.

Figure 4

Rga3 cooperates with Gef1 to promote Cdc42 exploratory dynamics during nitrogen starvation

(A) Nitrogen starvation leads to the formation of dynamic patches of active Cdc42 along the cell membrane in wildtype cells (wt, e). Loss of gef1 and rga3 leads to the loss of active Cdc42 patches along the cell membrane and retention of active Cdc42 at the cell tips during nitrogen starvation (h). Scale bar, 5 μm.

(B) Quantification of percentage of cells that display ectopic CRIB-GFP localization depicted in (A) based on three independent experiments. Data presented as mean ± SD, p values determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗. n = number of cells quantified.

(C) Quantification of CRIB-GFP localization at the cell tips depicted in (A) based on three independent experiments. N represents nitrogen. Whiskers indicating minimum to maximum are shown, box represents 25th to 75th quartiles, and horizontal line represents median, p values determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.01, ∗∗; p ≤ 0.0001, ∗∗∗∗.

(D) Rad24-Rga3 binding decreases during nitrogen starvation for 30 min and in the rga3-S683A-GFP mutant.

(E) Rga3-GFP pull-down/Input quantification from (D) based on three independent experiments. Data are presented as mean ± SD, p values are determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.05, ∗; p ≤ 0.01, ∗∗.

Finally, to determine if Rga3 binds to 14-3-3 protein Rad24 and if this binding is affected by nitrogen starvation or Rga3-S683A mutation, we performed a GST-Rad24 pull-down and probed for GFP-tagged Rga3. As expected, Rga3 binds to Rad24. We found that Rad24-Rga3 binding decreases during nitrogen starvation and in the rga3-S683A mutant (Figures 4D and 4E). These results indicate that Orb6 phosphorylation of Rga3 increases binding to Rad24 but when Orb6 is downregulated (nitrogen starvation) or the Rga3-S683 phosphorylation site is mutated to alanine (S683A), Rga3 is released from Rad24.

Stress-activated MAP kinase Sty1 negatively regulates Orb6 to promote the emergence of active Cdc42 exploratory dynamics

Although recent research has demonstrated that Sty1 is essential in the emergence of exploratory Cdc42 dynamics during oxidative stress47 or actin depolymerization,48 the mechanism whereby Sty1 controls Cdc42 is still not completely understood. Recently, the Cdc42 GEF Gef1 and two Cdc42 GAPs, Rga3 and Rga6, have been identified as direct targets of Sty1.47 It was found that loss of Gef1, or Rga3 and Rga6, prevents Cdc42 exploratory dynamics during oxidative stress.47 Another group found that during nitrogen starvation induced quiescence, active Cdc42 displays exploratory dynamics, and that upon the inhibition of Sty1 activity, active Cdc42 repolarizes to the cell tips.48 Prompted by these observations, we explored the effects of Sty1 kinase on Cdc42 dynamics, and the localization of Gef1 and Rga3, during acute nitrogen starvation. We found that in the absence of sty1 during nitrogen starvation, active Cdc42 remains at the cell tips rather than forming patches along the membrane (Figures 5A and 5D); we also observed that active Cdc42 does not decrease at the cell tips (Figure 5E). Importantly, while normally Gef1 localizes to the membrane upon nitrogen starvation,41 we found that in the absence of sty1, Gef1 does not localize to the membrane (Figures 5B and 5F). Additionally, we found that there is a significant increase in Rga3-GFP localization at the cell tips upon nitrogen starvation and that this increase is also dependent on the presence of sty1 (Figures 5C and 5G). Thus, these observations show that Sty1 controls both Gef1 and Rga3 localization to regulate active Cdc42 dynamics during nitrogen stress.

Figure 5.

Figure 5

Sty1 activation negatively regulates Orb6 activity

(A) Upon nitrogen starvation, active Cdc42 forms patches and decreases at the cell tips in sty1+ cells but remains at the cell tips at the same level in sty1Δ deletion. Scale bar, 5 μm.

(B) During nitrogen starvation, Gef1-3YFP localizes to the cell membrane but remains sequestered in the cytoplasm when sty1Δ is deleted. Scale bar, 5 μm.

(C) Rga3-GFP is increased at the cell tips upon nitrogen starvation, but Rga3-GFP localization at the tips remains constant in sty1Δ deletion cells during nitrogen starvation. Scale bar, 5 μm.

(D) Quantification of percentage of cells that display ectopic CRIB-GFP localization depicted in (A) based on three independent experiments. Data are presented as mean ± SD, p values are determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗. n = number of cells quantified.

(E) Quantification of CRIB-GFP localization at the cell tips depicted in (A) based on three independent experiments. Whiskers indicating minimum to maximum are shown, box represents 25th to 75th quartiles, and horizontal line represents median, p values determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.001, ∗∗∗; p ≤ 0.0001, ∗∗∗∗.

(F) Quantification of percentage of cells that display ectopic Gef1-3YFP localization depicted in (C) based on three independent experiments. Data presented as in (D), p values are determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗. n = number of cells quantified.

(G) Quantification of Rga3-GFP localization at the cell tips depicted in (E) based on three independent experiments. Data presented as in (E), p values are determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗.

(H) Orb6-GFP localization at the cell tips decreases during nitrogen starvation. Loss of sty1 leads to an increase in Orb6-GFP at the cell tips which is further exacerbated by nitrogen starvation. Scale bar, 5 μm.

(I) Gef1-S112 phosphorylation by Orb6 remains constant during nitrogen starvation in sty1Δ deletion cells. N represents nitrogen. β-Actin was used as a loading control.

(J) CRIB-3xmCitrine forms ectopic patches upon stress-independent activation of Sty1 (-3BrB-PP1).

(K) Gef1-S112 phosphorylation by Orb6 decreases upon stress-independent activation of Sty1 (-3BrB-PP1). β-Actin was used as a loading control. Atf1, target of Sty1, levels increase and migration shift upon removal of 3BrB-PP1. Separate gels represented by the dashed line.

(L) Quantification of Orb6-GFP fluorescence at cell tips depicted in (H) based on three independent experiments. Data presented as in (E), p values are determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.01, ∗∗; p ≤ 0.0001, ∗∗∗∗.

(M) Quantification of pGef1-S112/tGef1 from (I) during nitrogen starvation in control or sty1Δ deletion mutant cells based on three independent experiments. Data presented as in (D), p values are determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.05, ∗; p ≤ 0.01, ∗∗; p ≤ 0.001, ∗∗∗.

(N) Quantification of pGef1-S112/tGef1 from (K) upon Sty1 activation (-3BrB-PP1) based on three independent experiments. Data presented as in (D), p values are determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.01, ∗∗.

(O) Quantification of Atf1/Actin from (K) upon Sty1 activation (-3BrB-PP1) based on three independent experiments. Data presented as in (D), p values are determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.01, ∗∗.

To test if Sty1 kinase affects Orb6 localization, we exposed Orb6-GFP cells to nitrogen starvation in the presence and absence of sty1. Orb6-GFP is normally found at the cell tips.42 We found that upon nitrogen starvation, Orb6-GFP localization decreases at the cell tips and delocalizes along the cell membrane (Figures 5H and 5L). Conversely, in sty1Δ cells Orb6-GFP protein localization appears increased at the cell tips (Figures 5H and 5L). In nitrogen starvation, Orb6-GFP does not delocalize along the membrane and remains at cell tips in sty1Δ cells (Figures 5H and 5L).

To test if Sty1 kinase affects Orb6 kinase activity, we used a previously described antibody that specifically detects Gef1-S112 phosphorylation by Orb6.41 In concordance with our previously published results, we found that Gef1-S112 phosphorylation by Orb6 decreases upon nitrogen starvation41 (Figures 5I and 5M). Upon loss of sty1, however, we found that Gef1-S112 phosphorylation remains constant, and does not decrease during nitrogen starvation (Figures 5I and 5M). This result suggests that Sty1 negatively regulates Orb6 kinase activity during stress.

To test if Sty1 kinase activity promotes exploratory active Cdc42 dynamics during nitrogen stress, we used mutants of wis1, the MAPKK upstream of Sty1.79,80 Using CRISPR/Cas9, we created a nonphosphorylatable mutant, wis1-AA, and a phosphomimetic mutant, wis1-DD, and visualized active Cdc42 upon nitrogen starvation. We found that in the wis1-AA mutant, where Sty1 kinase is not phosphorylated by Wis1 and is therefore inactive, Cdc42-GTP remains localized at the cell tips during nitrogen starvation (Figure S4). These results indicate that Sty1 kinase activity promotes active Cdc42 exploratory dynamics during nitrogen starvation. Additionally, to test if ectopic Sty1 activation inhibits Orb6 kinase in the absence of nitrogen starvation, we measured Gef1-S112 phosphorylation in a strain that allows Sty1 activation without stress stimuli.48 In this mutant, Sty1 is kept inactive by the presence of the ATP-analog inhibitor 3BrB-PP1 and can be acutely activated by removing the inhibitor. As previously reported, we found that exploratory Cdc42 dynamics are in fact induced upon removal of the inhibitor 3BrB-PP1, which leads to acute activation of Sty1 (Figure 5J). We found that stress-independent activation of Sty1 leads to significantly lower Gef1-S112 phosphorylation levels (Figures 5K and 5N). We further confirmed that Sty1 kinase is indeed activated by monitoring the increase of Atf1 levels and the migration shift in Atf148 (Figures 5K and 5O). Thus, our results show that Sty1 activation leads to decreased Orb6 kinase activity and that it is Sty1 kinase function that decreases Orb6 activity rather than the stress itself.

To investigate if downregulation of Orb6 kinase activity rescues the phenotypes associated with the loss of sty1, we inhibited Orb6 in orb6-as2 cells with 1-NA-PP1 and measured Gef1-S112 phosphorylation. We found that Gef1-S112 phosphorylation decreases upon Orb6 inhibition irrespective of the presence or absence of sty1 (Figures 6A and 6B), indicating that direct inhibition of Orb6 bypasses a requirement of Sty1 for Gef1-S112 dephosphorylation. Next, we tested the effects of sty1Δ on the localization of active Cdc42, Gef1, and Rga3 following inhibition of Orb6. We found that in the absence of sty1, inhibition of Orb6 induces exploratory dynamics of active Cdc42 at the lateral membrane and decreases active Cdc42 at the cell tips (Figures 6C–6G). Similar results, indicating that direct inhibition of Orb6 bypasses a requirement for Sty1 in the induction of Cdc42 exploratory dynamics, were also obtained when Orb6 was inhibited after nitrogen starvation for 15 min (Figure S5). Finally, we found that Gef1 localizes to the membrane (Figures 6D and 6H) and Rga3 localization increases at the tips in sty1Δ cells upon Orb6 inhibition (Figures 6E and 6I). These results show that Orb6 kinase inhibition is sufficient to promote Cdc42 exploratory dynamics in the absence of Sty1.

Figure 6.

Figure 6

Downregulation of Orb6 kinase activity rescues the phenotypes associated with the loss of sty1

(A) Gef1-S112 phosphorylation by Orb6 decreases upon Orb6 inhibition (+1-NA-PP1) in sty1+ and sty1Δ deletion cells.

(B) pGef1-S112/tGef1 quantification from (A) based on three independent experiments. Data are presented as mean ± SD, p values determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗.

(C) Inhibition of Orb6 leads to CRIB-GFP patch formation along the cell sides, even in sty1Δ deletion cells. Scale bar, 5 μm.

(D) Gef1-3YFP localizes at the cell membrane during Orb6 inhibition in sty1Δ deletion mutants. Scale bar, 5 μm.

(E) Rga3-GFP increases at the cell tips upon Orb6 inhibition in sty1Δ deletion cells. Scale bar, 5 μm.

(F) Percentage of cells with ectopic CRIB-GFP localization from (C) based on three independent experiments. Data are presented as in (B), p values determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗. n = number of cells quantified.

(G) Quantification of CRIB-GFP localization at the cell tips depicted in (C) based on three independent experiments. Whiskers indicating minimum to maximum are shown, box represents 25th to 75th quartiles, and horizontal line represents median, p values determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗.

(H) Quantification of percentage of cells that display ectopic Gef1-3YFP localization depicted in (D) based on three independent experiments. Data are presented as in (B), p values determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗. n = number of cells quantified.

(I) Rga3-GFP fluorescence quantification at cell tips from (E) based on three independent experiments. Data presented as in (G), p values determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗.

(J) Gef1-3YFP localizes to the cell membrane in sty1+ and sty1Δ deletion cells in nonphosphorylatable mutant Gef1-S112A-3YFP. Scale bar, 5 μm.

(K) sty1Δ deletion leads to a decrease in Rga3-S683A-GFP localization compared to sty1+. Scale bar, 5 μm.

(L) Active Cdc42 is decreased at the cell tips and forms exploratory patches in smaller sty1Δ efc25Δ gef1-S112A rga3-S683A cells. Images are a max projection z stack of 5 images separated by a step-size of 0.3 μm. Scale bar, 5 μm.

(M) Gef1-3YFP fluorescence quantification at cell tips from (J) based on three independent experiments. Data presented as in (G), p values determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗.

(N) Rga3-GFP fluorescence quantification at cell tips from (K) based on three independent experiments. Data presented as in (H), p values determined by two-way ANOVA with Tukey’s HSD test p ≤ 0.0001, ∗∗∗∗.

(O) CRIB-GFP fluorescence quantification at cell tips from (L) based on three independent experiments. Data presented as in (G), p values determined by one-way ANOVA with Tukey’s HSD test p ≤ 0.05,∗; p ≤ 0.0001, ∗∗∗∗.

Recently, it has been demonstrated that both Gef1 and Rga3 are direct substrates of Sty1.47 Since Gef1 (as previously shown40) and Rga3 (as shown in this study) are also direct substrates of Orb6, we sought to investigate the role of Sty1 in the control of Gef1 and Rga3 localization by Orb6. To do so, we looked at the localization in the nonphosphorylatable mutant of Gef1 or Rga3, Gef1-S112A-3YFP or Rga3-S683A-GFP, in sty1Δ cells. Consistent with experiments shown in Figures 6C–6I, we found that Gef1-S112A-3YFP (Figures 6J and 6M) and Rga3-S683A-GFP (Figures 6K and 6N) localize to the surface independently of Sty1. However, the localization of Rga3-S683A-GFP to the cell tip decreased by about 20% in cells lacking Sty1 indicating that Sty1 promotes Rga3 localization to the cell tips. Similarly, in the absence of Sty1, Gef1 ectopic localization occurred with less frequency, about a 36% decrease, when Orb6 was inhibited, demonstrating that Sty1 plays a role in Gef1 localization to the membrane independently of Orb6 inhibition (Figures 6D and 6H). It should be noted that mutations rga3-S683A and gef1-S112A, alone or in combination, are not sufficient to induce active Cdc42 exploratory dynamics, either in the presence or absence of sty1 (Figure S6). While the nonphosphorylatable mutants do affect the levels of active Cdc42 present at the cell tips (Figure S6C), the only cases where we see the induction of Cdc42 exploratory dynamics by rga3-S683A and gef1-S112A require the inactivation of the Efc25-Scd1 regulatory axis (Figure 3; FigureS3), which is under the independent control of Orb6 kinase.42 These results demonstrate that loss of Orb6 phosphorylation is the main promoter of Gef1 and Rga3 localization to the membrane. These observations also indicate that Sty1 activity plays a positive role in Gef1 and Rga3 localization. Finally, we tested if the emergence of Cdc42 exploratory dynamics could be observed in sty1 deletion cells in the background of efc25Δ gef1-S112A rga3-S683A mutant. We found that sty1Δ efc25Δ gef1-S112A rga3-S683A cells display lower levels of active Cdc42 at the tips as also observed in efc25Δ gef1-S112A rga3-S683A mutants (Figures 6L and 6O). We observed exploratory Cdc42 dynamics in shorter sty1Δ efc25Δ gef1-S112A rga3-S683A cells (Figure 6L; Figure S7A), that also display low Cdc42 activity at the cell tips as compared to longer cells (Figure S7B). Conversely, longer cells manage over time to display a weaker but polarized Cdc42 distribution. Additional images are shown in Figure S7A. Thus, our findings suggest that aspects of the efc25Δ gef1-S112A rga3-S683A phenotype are maintained in the sty1Δ background mutant, especially in smaller cells. A partial suppression of the efc25Δ gef1-S112A rga3-S683A phenotype in longer cells could be due to the ability of the sty1Δ mutant to affect cell growth80,81,82,83 or the regulation of Cdc42 GAP Rga6, another Sty1 substrate.47

Discussion

Cdc42, a Rho-family GTPase, has a central role in regulating cell polarization and is highly conserved from yeast to human cells. The ability to control cell polarization is an essential process that changes dynamically in response to environmental stress. In fission yeast, Cdc42 changes the state of polarization in the cell in response to different environmental conditions such as mating,84 heat shock,49 oxidative stress,47 or nitrogen starvation.41 This change in polarization seen upon exposure to stress is an alternative exploratory pattern of Cdc42 where active Cdc42 localization changes dynamically along the cell membrane rather than oscillating at the cell tips as seen during polarized growth. Our lab has previously shown that inhibition of the nuclear Dbf2-related (NDR) kinase Orb6 activity induces the formation of exploratory active Cdc42 dynamics and extends chronological lifespan.41,44 We have also shown that exposure to nitrogen starvation leads to a decrease in Orb6 activity.41 Thus, we sought to understand the molecular mechanisms underpinning the emergence of exploratory Cdc42 dynamics and the role and regulation of Orb6 during stress.

Exploratory Cdc42 dynamics require dephosphorylation of Cdc42 GAP Rga3 on the Orb6-targeted phospho-site, serine S683

To define targets of Orb6 kinase in regulating Cdc42 dynamics, we identified factors that depend on Orb6 kinase for association with 14-3-3 protein Rad24 by mass spectrometry. In this study, we determined that the Cdc42 GAP Rga3 is a substrate of Orb6 and found that Orb6 phosphorylation on Rga3 serine 683 limits Rga3 localization to the cell tips. Rga3 is a Cdc42 GAP and plays a contributing role in cell morphology and polarization along with two other Cdc42 GAPs, Rga4 and Rga6.67 The Rga3 protein structure consists of two LIM domains at the N-terminal, two coiled-coil regions, a C-terminal RhoGAP domain, and is the only Cdc42 GAP that contains a C1 domain in fission yeast.67 This C1 domain is evolutionarily conserved and thought to have a conserved function in lipid binding from yeast to human.67,85,86 It has been previously shown that truncating the C1 domain reduces Rga3 localization at the cell tips.67 In Rga3, serine 683 lies very close to the C1 domain (Figure 2A), suggesting that Orb6 phosphorylation interferes with C1 domain function by promoting the binding of a bulky 14-3-3 protein, Rad24, and thereby negatively regulating Rga3 localization to the cell membrane. The human orthologs of Rga3 are Rac GAP Chimaerin proteins, CHN1 and CHN2, which also contain C1 domains. Chimaerins have been found to be involved in proper axonal growth and CHN1 mutations can cause a congenital eye movement disorder called Duane Retraction Syndrome.87,88

We previously showed that nitrogen starvation decreases Orb6 activity, promoting Cdc42 GEF Gef1 localization to the membrane at ectopic sites.41 Here, we report that Rga3 plays an essential role in decreasing active Cdc42 at the cells tips and promoting Cdc42 exploratory dynamics upon Orb6 inhibition or during nitrogen starvation. We found that the Orb6 substrates Rga3 and Gef1 cooperate during nitrogen starvation to induce stress-dependent Cdc42 dynamics. When both rga3 and gef1 are deleted, Cdc42 remains active at the cell tips, presumably activated by Cdc42 GEF Scd1, and does not form ectopic patches. Deletion of gef1 alone leads to almost complete abolishment of Cdc42 activation on the whole cell membrane during nitrogen starvation, indicating that increased Rga3 levels at the cell tips during starvation suppress Scd1-dependent Cdc42 activation. Loss of Rga3 alone increases active Cdc42 at the tips and reduces the frequency of cells displaying lateral patches of active Cdc42, during nitrogen starvation, as seen in rga3Δ mutants upon Orb6 inhibition. In summary, we conclude that Gef1 and Rga3 cooperate to induce exploratory Cdc42 dynamics in response to nitrogen deprivation. Without Gef1 and Rga3, cells maintain a state of Cdc42 dynamics that is similar to non-starved wild cells, suggesting that Rga3 and Gef1 comprise a nutrient stress-activated module that fosters the emergence of Cdc42 exploratory dynamics in stressed cells. Under nutrient-rich conditions, this Cdc42 regulatory module is kept largely inactive in the cytoplasm by binding to 14-3-3 protein Rad24. Decreased Orb6 kinase activity upon nitrogen stress leads to Rga3 and Gef1 dephosphorylation and membrane localization, and activation of exploratory Cdc42 dynamics. Rga3 affects the onset of exploratory Cdc42 dynamics also during mating and oxidative stress47,67; Gef1 also affects exploratory Cdc42 dynamics during oxidative stress,47 suggesting that the function of Orb6 in regulating the stress-dependent Cdc42 module may be crucial in the cellular response to other stresses, in addition to nutritional deprivation.

The emergence of exploratory Cdc42 dynamics requires the attenuation of the canonical Scd1-dependent Cdc42 polarity module

During nitrogen starvation the canonical Ras1-Scd1-Cdc42 polarity regulatory axis is attenuated.41 We previously showed that under nutrient rich conditions, Orb6 positively regulates the translation of Ras1 GEF Efc25 (Figure 7A). Upon the onset of nitrogen starvation, or Orb6 inhibition, Ras1 activity and Scd1 localization at the cell tips is attenuated (Figure 7B). We report here that increased levels of Rga3 at the cell tips are crucial to fully repress the canonical Scd1-dependent Cdc42 activity at the cell tips, and thereby promote the alternative exploratory Cdc42 activity. Indeed, we found that in the absence of Efc25, dephosphorylation of Orb6 sites on Gef1-S112 and Rga3-S683 induces the exploratory pattern of Cdc42 activation without stress stimuli. These results together lead us to conclude that upon Orb6 inhibition during nitrogen starvation, Rga3 works in concert with Efc25 downregulation to attenuate active Cdc42 from the cell tips and promote Gef1 at the surface to induce exploratory active Cdc42 dynamics. Here, we reveal the molecular mechanism behind the emergence of exploratory Cdc42 dynamics seen during stress.

Figure 7.

Figure 7

Stress-activated MAP Kinase Sty1 negatively regulates NDR kinase Orb6 to promote exploratory Cdc42 dynamics and cell survival during stress

(A) Orb6 activation in nitrogen-rich conditions stimulates the canonical Cdc42 polarity module to promote polarized growth.

(B) Upon stress (nitrogen starvation), Sty1 becomes active and inhibits Orb6 activity and phosphorylates Rga3 and Gef1 (represented by dashed arrow). This leads to the induction of the stress-dependent Rga3-Gef1 module to promote exploratory active Cdc42 dynamics.

MAP kinase Sty1 activity negatively regulates Orb6 kinase to induce exploratory Cdc42 dynamics

One crucial question pertains to how Orb6 kinase activity is downregulated during nutritional stress. Here, we report that the stress-activated mitogen-activated protein (MAP) kinase, Sty1, promotes Orb6 inactivation during nitrogen starvation. Sty1 is activated upon exposure to various types of stressors including heat stress, oxidative stress, osmotic changes, and nutritional starvation.50,51,52,53,54,55 Sty1 has been shown to alter active Cdc42 localization and dynamics during oxidative stress.47 Here, we report that also during acute nitrogen starvation, exploratory Cdc42 dynamics, as well as Gef1 and Rga3 localization to the cell membrane, are also Sty1-dependent, explaining why active Cdc42 does not form dynamic ectopic patches during nitrogen starvation in sty1 deletion mutants.

Consistent with the idea that Sty1 functions upstream of Orb6 kinase, we discovered that Orb6 kinase delocalizes from the cell tips during nutritional stress, in a manner that depends on Sty1. Further, we find that phosphorylation of Gef1 on Serine S112, a site which is specifically phosphorylated by Orb6 kinase40 remains high in sty1 deletion cells during nitrogen starvation, indicating that Gef1-S112 dephosphorylation is dependent on Sty1. Conversely, ectopic Sty1 activation in the absence of stress leads to Gef1-S112 dephosphorylation, indicating that Orb6 kinase activity decreases upon Sty1 activation. Remarkably, inhibition of Orb6 completely bypasses the requirement of Sty1, triggering the emergence of exploratory active Cdc42 dynamics, Gef1 lateral patch formation, and increased Rga3 localization at the cell tips. Thus, we show that Orb6 inhibition is necessary and sufficient to induce active Cdc42 exploratory dynamics downstream of Sty1 kinase.

Previous reports showed that Sty1 activation, either stress-independent or by Latrunculin A, induces lateral patches of active Cdc42 on the cell membrane.48 These results identified Sty1 as a regulator of active Cdc42 localization but did not expand on the mechanism behind Sty1 control of Cdc42 dynamics. Elegant work from the Hidalgo lab showed that Sty1 activation during oxidative stress promotes exploratory Cdc42 dynamics and that Sty1 directly phosphorylates Gef1 and Rga3 in vitro, identifying these two proteins as stress-dependent Sty1 targets in the control of Cdc42 dynamics.47 However, while they identified 7 possible Sty1 phosphorylation sites on Gef1 from amino acids 1–307 and 17 possible sites on Rga3 from amino acids 1–447, they could not report any phenotype associated with phosphomimetic or hypophosphorylated mutants of Gef1.47 Indeed, this could be explained by the fact that Orb6 inhibition is a crucial step downstream of Sty1 activation. Orb6 inactivation leads to the release of Rga3 and Gef1 from the grip of Rad24, allowing the direct Sty1 phosphorylation of Rga3 and Gef1 to perform a more subtle role in modulating Gef1 and Rga3 membrane localization. In the absence of Orb6 inactivation, Gef1 and Rga3 stay cytoplasmic, and the effects of mutations in the Sty1 consensus sites would likely be muted. Further work would need to be performed to determine which specific sites on Gef1 and Rga3 are phosphorylated by Sty1 and the functional outcome of Sty1 phosphorylation of Rga3 and Gef1. Furthermore, the exact mechanism of how Gef1 and Rga3 are dephosphorylated at their Orb6 phosphorylation sites is unknown. The fact that Gef1 becomes readily dephosphorylated when Orb6 is inhibited, even in the absence of Sty1 (Figures 6A and 6B) suggests that Sty1 is not necessary for Gef1 dephosphorylation. However, it is possible that Sty1 kinase has a role in enhancing Gef1 and Rga3 dephosphorylation, perhaps promoting the displacement of the Orb6 substrate binding to 14-3-3 Rad24. Additionally, other factors that are in a protein complex with Gef189,90 or Rga3 may also need to be dephosphorylated: for example, Gef1 is recruited by Tea4-PP1 to activate Cdc42 at the cell membrane.72 We found that Tea4 also interacts with Rad24 in an Orb6-dependent manner.

Thus, our data are consistent with a stepwise model (see Figure 7) where, during stress, (1) Sty1 becomes activated and inhibits Orb6, (2) Rga3 and Gef1 are dephosphorylated at their Orb6 sites, released by 14-3-3 Rad24, and localize to the membrane, and (3) Sty1 phosphorylation further promotes Rga3 and Gef1 function. This mechanism can be described as type 4 circuitry called a coherent feedforward loop,91 where a double inhibition (Sty1 inhibiting Orb6, Orb6 inhibiting Gef1 and Rga3) occurs in parallel with activation (Sty1 subtly promoting Gef1 and Rga3 localization, and Rga3 GAP activity47).

It should also be noted that Orb6 inactivation downstream of Sty1 activation also provides an explanation for the attenuation of the canonical, Scd1 dependent Cdc42 activity observed during oxidative stress.41,47 We previously showed that Orb6 inactivation leads to the downregulation of Efc25-Ras1 regulatory axis, leading to decreased recruitment of the Cdc42 GEF Scd1 at the tips.41 Here, we show that Orb6 inactivation leads to increased levels of the Cdc42 GAP Rga3 at the tips. Although the data was not shown, the Hidalgo lab has reported that Sty1 phosphorylation leads to the activation of Rga3 GAP activity to promote the hydrolysis of Cdc42-GTP.47 Thus, these observations collectively support the idea that Orb6 inactivation and Sty1 activation cooperate to promote Rga3 function, resulting in additional suppression of the Cdc42 activity at the tips. It appears that silencing the canonical Cdc42 pathway at the cell tips is a crucial step to allow the emergence of Cdc42 exploratory dynamics.

During nutritional deprivation, cells must be able to adapt to the environment appropriately to promote cell resilience and survival.92 Chronic nutrient starvation can lead the cells to enter a state of quiescence, a reversible process that occurs when cell division stops and leads to improved cell survival until nutrients become available (reviewed by Yanagiba93 and Valcourt et al.94). It has been found that Sty1 kinase is activated during stationary phase, when the cells are quiescent.95 Sty1 and other conserved signaling kinases such as TOR kinase are important regulators of chronological lifespan.96,97,98,99 Chronological lifespan assays, performed under nutrient restriction, provide a readout of cell resilience to stress.100,101,102 Sty1 activation is crucial in extending chronological lifespan during caloric restriction96 and TORC1 inhibition by caffeine and rapamycin also leads to lifespan extension.97 Previously, we have shown that Orb6 activity decreases when cells enter a state of quiescence.41 We have also shown that downregulation of Orb6 prior to entering cell quiescence leads to chronological lifespan extension.41 The mRNA binding protein Sts5 is an Orb6 substrate that is important in extending chronological lifespan.41 Orb6 phosphorylation of Sts5 promotes the translation of many polarity factors, including Efc25, a GEF of Ras1 GTPase. Inactivation of Orb6 during nutritional deprivation promotes the downregulation of Ras1 activity, a key event in extending cell survival.41 Ectopic Ras1 activation shortens, while Ras1 activity downregulation extends chronological lifespan,41 suggesting that continued activity of the canonical Cdc42 polarity complex at the cell tips is detrimental during starvation. Cdc42 also has a known function in polarized secretion and cell wall biogenesis74,103 and may be crucial for the necessary changes in the cytoskeleton and cell wall remodeling during stress. Indeed, preliminary experiments show that the loss of both rga3 and gef1 is shorter lived than controls suggesting that decreasing exploratory active Cdc42 dynamics during starvation is detrimental to the cell (data not shown). Additionally, exposure to prolonged starvation, particularly nitrogen starvation, triggers an important survival mechanism during which fission yeast cells switch from asexual to sexual reproduction.104,105 By mating, fission yeast form spores that are highly resilient to environmental stressors until conditions become favorable, prompting germination of the spores.106,107,108 Cdc42 has been shown to play an important role during mating, when active Cdc42 exploratory dynamics foster mate selection.84 It has been found that cells lacking rga3 exhibit reduced exploratory Cdc42 dynamics and a competitive disadvantage during mating.67 These findings, coupled with the results of this study, suggest an important function for exploratory Cdc42 dynamics upon negative regulation of Orb6 by Sty1 in promoting different cell survival mechanisms during nitrogen starvation, such as supporting resilience during nutritional stress and mate selection. Further research remains to be performed to elucidate how these Cdc42 dynamics could improve cell resilience during stress. Interestingly, in mice and human cells, increased levels of active Cdc42 and “apolar distribution” of active Cdc42 are detected upon aging,109,110 highlighting the conserved role of cell polarity control factors in this process.

In conclusion, here, we demonstrate that MAP kinase Sty1 is a negative regulator of Orb6 kinase during nutritional stress, promoting the onset of exploratory Cdc42 dynamics. In this proposed model (Figure 7), Sty1 is activated upon stress and negatively regulates Orb6 inducing the exploratory pattern of Cdc42 dynamics mediated by Gef1 and Rga3 (Figure 7B). Our findings reveal the elegant mechanism whereby Sty1 and Orb6 kinases control the emergence of an alternative pattern of Cdc42 dynamics during stress. The interplay between Orb6 inactivation and Sty1 activation allows the transition from a “canonical” to an “exploratory” active Cdc42 distribution. Since NDR kinases and stress-activated MAP kinases are highly conserved from yeast to human, both structurally and functionally, uncovering the mechanisms regulating stress signaling and cell polarization could provide valuable insight into human health and onset of disease.

Limitations of the study

In this study, we find that Sty1 negatively regulates Orb6 activity to induce an alternative exploratory pattern of active Cdc42 dynamics during stress. Whether Sty1 is directly inhibiting Orb6 remains to be elucidated, although Orb6 contains several putative Sty1 phosphorylation sites (S/TP) which could mediate this response. Other components of Orb6 signaling module could also be involved such as Mob2 and Nak1, which contain one and ten putative Sty1 phosphorylation sites, respectively. It is important to acknowledge that nitrogen starvation triggers many different pathways of the cell besides Orb6 and Sty1, perhaps most notably, the growth and stress control complexes TORC1/2. As TORC1/2 play key roles in cell growth and nutrient sensing and Sty1 has been found to interact with Sin1, a part of the TORC2 complex, further studies will need to be performed to elucidate the connection between Orb6, Sty1, and TORC1/2 and how they may regulate stress signaling.111,112,113,114,115,116

Resource availability

Lead contact

Further information and requests for resources should be directed to the lead contact, Fulvia Verde (fverde@miami.edu).

Materials availability

All unique and stable reagents generated in this study are available from the lead contact.

Data and code availability

  • The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE117 partner repository with the dataset identifier PXD066553 and are publicly available as of the date of publication.

  • Data reported in this paper is available upon request.

  • This paper does not report any original code.

  • Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Acknowledgments

We thank Sophie Martin (University of Geneva, Geneva, Switzerland) and James Moseley (Geisel School of Medicine at Dartmouth, Hanover, New Hampshire, USA) for sharing strains. We thank Daniel Isom for his helpful guidance on using CRISPR-Cas9 and Vera Mariani for assisting in data acquisition. Research reported in this publication was supported by the National Institutes of Health, United States, Award Number R01 GM129514 and by the University of Miami Sylvester Comprehensive Cancer Center which receives funding from the National Cancer Institute of the National Institutes of Health under Award Number P30CA240139. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Author contributions

Conceptualization, L.P.D., D.M., K.L.G., and F.V.; methodology, L.P.D. and F.V.; investigation, L.P.D., J.-S.C., D.M., and F.V.; writing, L.P.D., J.-S.C., K.L.G., D.M., and F.V.

Declaration of interests

The authors declare no competing interests.

STAR★Methods

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

Mouse anti-Atf1 Abcam AB18123; RRID:AB_444264
Mouse anti-beta Actin Abcam AB8224; RRID:AB_449644
Mouse anti-myc Santa Cruz Biotechnology Sc-40; RRID:AB_627268
Mouse anti-GFP Roche 11814460001; RRID:AB_390913
Rabbit anti-GST Santa Cruz Biotechnology Sc-459; RRID:AB_631586
Rabbit anti-His Santa Cruz Biotechnology Sc-804; RRID:AB_631656
Rabbit anti-phospho-Gef1-S112 Verde lab (Chen et al.41) N/A
Rabbit anti-Thiophosphate Ester Epitomics 2686–1; RRID:AB_10585667
IRDye® 800CW Goat anti-Rabbit IgG Secondary Antibody Li-Cor 926–32211; RRID:AB_621843
IRDye® 680RD Goat anti-Mouse IgG Secondary Antibody Li-Cor 926-68070; RRID:AB_10956588

Bacterial and virus strains

NEB® 10-beta Competent E. coli New England Biolabs C3019H

Chemicals, peptides, and recombinant proteins

4-Amino-1-tert-butyl-3-(1′-naphthyl)pyrazolo[3,4-day]pyrimidine (1-NA-PP1) Toronto Research Chemicals A603004
Dynabeads protein G Invitrogen 10003D
N6- Benzyladenosine- 5′- O- (3- thiotriphosphate) (6-Bn-ATP-γ-S) Biolog B072
p-Nitrobenzyl mesylate (PNBM) Sigma-Aldrich SML3810
Pierce Glutathione Magnetic Agarose beads Thermo Scientific 78601
4-Amino-1-tert-butyl-3-(3-bromobenzyl)pyrazolo[3,4-day]pyrimidine (3-BrB-PP1) Toronto Research Chemicals A602985
Nourseothricin Sulfate Gold Biotechnology N-500

Critical commercial assays

RC DC Protein Assay Kit II Bio-Rad 5000122

Deposited data

Mass Spectrometry Data ProteomeXchange Consortium - Proteomics Identifications Datbase (PRIDE) PRIDE: PXD066553

Experimental models: Organisms/strains

S. pombe strains See Table S3 in supplemental information N/A

Oligonucleotides

Rga3-Ligation-free sgFw: AAGTCTGCCGATCC
TGTAGTgttttagagctagaaatagcaagttaaaataa
GenScript N/A
Rga3-Ligation-free sgRv: ACTACAGGATCGGC
AGACTTttcttcggtacaggttatgttttttggcaaca
GenScript N/A
HR template (rga3-S683A): ATGTAAACCGTAAA
GTCCCGTTCAAATCAATGCATACTAAATCAAAG
GCTGCCGACCCAGTTGTAGGAAATGAAGAT
CGTACTCAATGTGACCATGTGTT
GenScript N/A
Wis1-Ligation-free sgFw: CATTGGATGTCAAT
CTTACAgttttagagctagaaatagcaagttaaaataa
MilliporeSigma N/A
Wis1-Ligation-free sgRv: TGTAAGATTGACAT
CCAATGttcttcggtacaggttatgttttttggcaaca
MilliporeSigma N/A
HR template (wis1-AA): GTTAAGTTATGTG
ACTTTGGCGTGAGTGGGAATCTTGTGGC
TGCTATATCCAAAGCGAACATCGGTTGCC
AGTCTTACATGGCTCCTGAAAGAATTCGTGTT
MilliporeSigma N/A
HR template (wis1-DD): GTTAAGTTATGTGACTTT
GGCGTGAGTGGGAATCTTGTGGCTGATATATCC
AAAGATAACATCGGTTGCCAGTCTTACATGGC
TCCTGAAAGAATTCGTGTT
MilliporeSigma N/A

Recombinant DNA

pJK148: orb6-as2 Verde lab (Das et al.44) N/A
pMZ379 Mikel Zaratiegui (Rodríguez-López et al.118) Addgene plasmid # 74215; http://n2t.net/addgene:74215; RRID:Addgene_74215
pFA6-Gef1-3YFP (1168–2317) Verde lab (Das et al.44) N/A

Software and algorithms

CRISPR4P Bähler lab https://www.Bahlerlab.info/crispr4p
GraphPad Prism 10 GraphPad https://www.Graphpad.com
SlideBook 6 Intelligent Imaging Innovations https://www.intelligent-imaging.com/slidebook
Scansifter (v2.1.25) Vanderbilt University
SEQUEST Thermo Fisher Scientific
Scaffold Proteome Software https://www.proteomesoftware.com/
Image Studio Li-Cor https://www.licor.com/bio/image-studio/
Fiji NIH https://imagej.net/software/fiji/downloads

Experimental model and study participant details

S. pombe strains used in this study are listed in Table S3 in supplemental information. All strains used in this study are isogenic to the original strain 972. Fission yeast cells were grown in a shaking incubator at 180 RPM at 25°C and cultured in Edinburgh minimal medium (EMM) plus required supplements unless otherwise specified. Cells used in nitrogen starvation experiments were prototrophic and were cultured in unsupplemented EMM ±0.5% nitrogen resource (NH4Cl) and grown at 30°C. Experiments using strains with sty1Δ deletion or wis1 mutants were grown at 30°C. Exponential growth was maintained for at least eight generations before experiments, and genetic manipulations and analyses were carried out following standard techniques.119 Strains were authenticated by PCR and/or sequencing.

Method details

Rad24-TAP purification

Rad24-3HA-TAP was purified from wildtype and orb6-25 cells as described previously.120 Cells were grown in 1.5-L cultures of 4x YE media at 25°C to 1.6 OD, shifted to 35.5 °C for 3 h, collected by centrifugation at 3000 RPM, and frozen in liquid nitrogen. Cells pellets were thawed on ice and washed with NP-40 Buffer (1% NP-40, 150 mM NaCl, 2 mM EDTA, 6 mM Na2HPO4, and 4 mM NaH2 PO4) supplemented with yeast protease inhibitor cocktail (Sigma-Aldrich), 1 mM phenylmethylsulfonyl fluoride (PMSF), and phosphatase inhibitors (50 mM NaF, and 100 μM NaVO4). Cells were lysed on ice using a bead beater (Biospec) filled with approximately 250 mL of glass beads (425–600 μm G8772 Sigma). The bead beater chamber was immersed in an ice-water mix and run for 8 cycles of 30 s with 30 s cooling periods in between each cycle. Beads were then extracted three times with 50 mL of NP-40 buffer with inhibitors (see above). Cells extracts were then cleared by centrifugation at 3000 RPM for 5 min at 4°C. Subsequent TAP purification was performed as described.120

Analysis of TAP complexes by mass spectrometry (MS)

Proteins were digested by trypsin and analyzed by two-dimensional liquid chromatography-tandem mass spectrometry (MS) (2D-LC-MS/MS) as previously described.121 MS2 and MS3 spectra were extracted separately from RAW files and converted to DTA files using Scansifter software122 (v2.1.25). Spectra with less than 20 peaks were excluded and the remaining spectra were searched using the SEQUEST algorithm (ThermoFisher Scientific, San Jose, CA, USA; version 27, rev. 12). Sequest was set up to search the S. pombe protein database (pombe_contams_20151012_rev database, created in October 2015 from pombase.org). Common contaminants were added, and all sequences were reversed to estimate the false discovery rate (FDR), yielding 10390 total entries. Variable modifications (C+57, M+16, [STY]+80 for all spectra and [ST]-18 for MS3), strict trypsin cleavage, <10 missed cleavages, fragment mass tolerance: 0.00 Da (because of rounding in SEQUEST, this results in 0.5 Da tolerance), and parent mass tolerance: 2.5 Da were allowed. Peptide identifications were assembled and filtered in Scaffold (v4.8.4, Proteome Software, Portland, OR) using the following criteria: minimum of 99.0% protein identification probability; minimum of two unique peptides; minimum of 95% peptide identification probability. FDRs were estimated in Scaffold based on the percentage of decoy sequences identified after using the above filtering criteria; for the combined MudPITs, the protein level FDR was 0.4% and the peptide level FDR was 0.1%. Proteins containing the same or similar peptides that could not be differentiated based on MS/MS alone were grouped to satisfy the principles of parsimony.

Fluorescence microscopy

Cells expressing fluorescently tagged proteins were photographed with an Olympus fluorescence BX61 microscope (Melville, NY) equipped with Nomarski differential interference contrast (DIC) optics, a 100× objective (numerical aperture [NA] 1.35), a Roper Cool-SNAP HQ camera (Tucson, AZ), Sutter Lambda 10 + 2 automated excitation and emission filter wheels (Novato, CA), and a 175-W Xenon remote source lamp with liquid light guide. Images were acquired and processed using Intelligent Imaging Innovations SlideBook image analysis software (Version 6.0.4; Denver, CO) and prepared with Fiji.123 For the measurements of Rga3-GFP, Gef1-3YFP, and CRIB-GFP cell tip intensity, we measured the intensity of fluorescence at the tips and subtracted the cytoplasmic background for each cell. 20 cells (40 cell tips) were measured per experiment totaling to 60 cells (120 cell tips) for 3 experiments, unless otherwise specified in which case the number of cells quantified (n = ) is included in the figure. To quantify the percentage of cells with ectopic CRIB-GFP localization, we counted cells that had CRIB-GFP fluorescence on the membrane outside of the cell tips as ectopic. When analyzing CRIB-GFP in the triple mutant efc25Δ gef1-S112-HA rga3S683A, cells that were spherical and had no discernible cell tip were considered positive for ectopic CRIB-GFP localization.

To generate the heatmap of CRIB-GFP, we plotted the intensity of CRIB-GFP fluorescence as a function of cell length. For each cell, we used the higher CRIB-GFP intensity of the two tips (n = 60 for each mutant). The cell lengths for each mutant were placed into 5 percentile groups (0-20th, 20th-40th, 40th-60th, 60th-80th, or 80th-100th). The heatmap displays the median value of the CRIB-GFP fluorescence intensity of the cells within their respective cell length percentile.

To determine how active Cdc42 distribution changes at the cell membrane in Scd1 mutants (Figure S3), we measured the intensity of CRIB-GFP along the entire cell membrane of a representative cell and made a plot profile. We then used the first and last 10 intensity measurements to create a baseline to determine the number of CRIB-GFP peaks in the cell as a reference to how many active Cdc42 patches were present. To measure cell length and width, cells were stained with Calcofluor at a working concentration of 2 μg/mL and Fiji line tool was used to measure length and width of cells undergoing septation. As calcofluor stains growing cell ends brighter, we measured the percentage of bipolar cells by counting cells that had both cell ends stained brightly as bipolar.

Orb6-as2 kinase inhibition

The design and construction of the orb6-as2 analogue-sensitive mutant were as previously described.44 Inhibition of Orb6-as2 kinase was achieved using the ATP analog 1-NA-PP1 diluted in DMSO (5 mM stock concentration) and stored at −20°C. In all experiments, the final concentration of 1-NA-PP1 used was 50 μM and cells were treated for 30 min.

CRISPR/Cas9 construction of Rga3 mutant strains

CRISPR/Cas9 was performed as previously described with some modifications.118 We used the CRISPR4P program (bahlerlab.info/crispr4p) to select our sgRNA. We used the ligation-free method to clone our sgRNA into the CRISPR/Cas9 plasmid pMZ379 (Addgene). NEB 10-beta Competent E. coli cells were transformed with our ligated plasmid. 12 colonies were selected, and the plasmids were sent for Sanger sequencing. As our homologous recombination (HR) template, we used single-stranded DNA containing our point mutation of interest as well as three (for Rga3) or four (for Wis1) silent point mutations between the point mutation of interest and the PAM site to prevent further Cas9 cleavage. Synchronized competent S. pombe cells were transformed using 20 μg denaturated salmon sperm DNA, 1 μg of HR template, 2 μg of sgRNA plasmid, and 145 μL 50% PEG4000. Cells were plated on YES plates with 100 μg/mL Nourseothricin. Once colonies were formed, 12–18 of the smallest colonies were streaked out onto YES plates without Nourseothricin to eliminate Cas9 plasmid. Colony PCR was performed and purified PCR samples were sent for sequencing to confirm successful point mutation construction.

Bacterial expression of His-tagged Rga3 protein

First, full-length Rga3 protein sequence with or without S683A mutation was tagged with N-terminal 6xHis by cloning into a pET-22b expression vector. The plasmid was transformed into DE3 cells, and Rga3-6xHis expression was autoinduced from 5 mL culture by incubation with 95 mL ZY-5052 media (1% tryptone, 0.5% yeast extract, 25 mM Na2HPO4, 25 mM KH2PO4, 50 mM NH4Cl, 5 mM Na2SO4, 2 mM Mg2SO4, 0.5% glycerol, 0.05% glucose, 0.2% α-lactose, and 100 μM FeCl3·6H2O, 100 μg/mL of ampicillin) for 8 h at 37°C followed by 16–18 h at 18°C. Western blot using anti-His6 antibody (Santa Cruz Biotechnology) was performed to confirm the induced expression of 6xHis-Rga3.

Mob2-associated Orb6-as2 thiophosphorylation kinase assay

Purification of Mob2-associated Orb6 kinase was performed using previously established methods41,42,124 and in vitro thiophosphorylation assay was optimized from published protocols.125,126,127,128 Myc-tagged Mob2 Orb6-as2 were expressed in S. pombe cells grown at 30°C exponentially to harvest ∼7.5 × 108 cells total. Cells were lysed using Savant FastPrep FP120 bead beater in HB buffer (25 mM MOPS, 15 mM EGTA (ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid), 100 mM NaCl, pH 7.2, 60 mM β-glycerophosphate, 15 mM p-nitrophenyl phosphate, 15 mM MgCl2, , 1 mM dithiothreitol (DTT), 0.1 M sodium vanadate, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride (PMSF), and protease and phosphatase inhibitor cocktail (Halt Protease and Phosphatase Inhibitor Cocktail (100X)). Extracts from cells expressing Myc-tagged Mob2 Orb6-as2 were incubated with 20 μL Dynabeads Protein G (Invitrogen-ThermoFisher) bound to mouse anti-Myc antibodies (Santa Cruz Biotechnology) for 1 h at 4°C, washed twice with 300 μL HB buffer, and then washed once with 300 μL kinase buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 10 mM MgCl2, 1 mM MnCl2). The beads were resuspended in 26 μL of kinase buffer, 4 μL of 10 mM 6-Bn-ATPγS (Biolog, final concentration: 1 mM) and with 10 μL bacterially expressed His-Rga3, His-Rga3-S683A, or empty His- (0.2 μg/μL). The kinase reaction was stopped after 30 min at 30°C with 20 mM EDTA (stock concentration: 0.45M) and alkylated by incubating with 2.5 mM p-nitrobenzylmesylate (Sigma-Aldrich, stock 50 mM) for 2 h. To elute, 17 μL of 4X Laemmli Sample Buffer (Biorad) was added to the reaction and boiled at 98°C for 3 min. Beads were magnet separated and 60uL of sample was frozen at −80°C. Proteins were analyzed by western blot (see western blot analysis methods) Thiophosphorylation of His-Rga3 was detected with thiophosphate ester antibody (Epitomics), total His-Rga3 with His-antibody (Santa Cruz Biotechnology), Mob2-myc with Myc antibody (Santa Cruz Biotechnology), and loading control with anti-β-Actin (Abcam).

Nitrogen starvation

All strains used in nitrogen starvation experiments were prototrophic and were cultured in unsupplemented EMM to eliminate the effect of supplemented amino acids as potential nitrogen sources. Therefore, the starvation of the nitrogen source in this study was achieved by removal of 0.5% NH4Cl. For starvation experiments, cells cultured in EMM+0.5% NH4Cl (EMM+N) were spun down, washed once in EMM+0% NH4Cl (EMMN), and resuspended in EMM+0% NH4Cl (EMM-N) for study.

GST-Rad24 pull-down assay

The Rad24 binding assay was performed as previously described.40,41,42 Bacterially expressed GST- and GST-Rad24 were bound to Glutathione Magnetic Agarose beads (Pierce). Then, the beads were incubated overnight at 4°C with fission yeast protein extracts from rga3-GFP or rga3-S683A-GFP strains in control and after nitrogen starvation for 30 min. The beads were washed three times with Tris lysis buffer (50 mM Tris-Cl, pH 7.7, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-, 1 mM PMSF, protease and phosphatase inhibitor cocktail (Halt Protease and Phosphatase Inhibitor Cocktail (100X)) and proteins were analyzed by western blot (see western blot analysis methods). Rga3-GFP levels were detected by anti-GFP (Roche), GST-Rad24 by anti-GST (Santa Cruz Biotechnology), and loading control with anti-β-Actin (Abcam).

Protein extraction and western blot analysis

Protein extraction was modified from previously described protocol.129 ∼7.5 × 107 total cells growing exponentially were harvested and cell pellets were resuspended in 300 μL of H2O with protease and phosphatase inhibitor cocktail (Halt Protease and Phosphatase Inhibitor Cocktail (100X)) and transferred to 1.5 mL microcentrifuge tube. 300 μL of 0.6M NaOH with inhibitor cocktail (see above) was added to the cells and resuspended. Cells were left to incubate for 5 min at room temperature, inverting the tubes 2–3 times halfway through incubation. Cells were then centrifuged at 2300 RCF for 2 min. The supernatant was discarded, and the pellet was resuspended in 75 μL modified SDS buffer (60 mM Tris-HCl [pH 6.8], 4% 2-Mercaptoethanol, 4% SDS, 5% glycerol) with inhibitor cocktail (see above) and boiled at 98°C for 3 min. Cells were placed on ice and centrifuged at 4°C at 3500 RCF for 1 min 65 μL of the supernatant (protein extract) was collected with 60 μL stored at −80°C immediately, and 5 μL used for downstream protein quantification assay. To quantify protein, the RC DC protein assay kit was used as it is compatible with the concentration of reducing agents and detergents present in the modified SDS buffer. Standard western blotting procedures were performed as follows: protein was separated using SDS-PAGE and transferred onto a nitrocellulose membrane. The membranes were probed with antibodies of interest and visualized through fluorescent detection on Li-Cor Odyssey 9120. Gef1-3YFP strains were used in detecting total Gef1 protein with anti-GFP (Roche) and phosphorylated Gef1-S112 was detected using a custom-made previously described antibody.41 Two-color detection was used with using LiCor IRDye secondary antibodies anti-rabbit 800CW for anti-pGef1-S112 or anti-mouse 680RD for anti-GFP (Gef1-3YFP). Quantification of the blots was performed using Image Studio software. To quantify, a rectangle was drawn around the signal band of interest and pixel intensity was recorded. To remove background signal, background settings were set to median, segment: top and bottom, border width: 3. With the pixel intensity measurements, a ratio was determined between pGef1-S112 (fluorescent channel 800) and total Gef1-3YFP (fluorescent channel 700) to measure how much total Gef1-3YFP protein is phosphorylated at S112. Data was normalized by creating a ratio with all values with the average ratio of control strains and/or conditions. Similar procedures were performed for ectopic activation of Sty1 with the addition of detecting Atf1 levels with anti-Atf1 (Abcam). Uncropped blots are provided in Figures S8–S11.

Stress-independent Sty1 activation

The stress-independent activation of Sty1 was performed as previously described.48 Cells were transformed with pFA6-Gef1-3YFP as previously described.44 Cells were grown in YES media at 30°C in the presence of 5 μM 3BrB-PP1. 3BrB-PP1 was diluted in methanol for a stock solution concentration of 50 mM and stored in −80°C. To activate Sty1, cells were washed twice in YES media with or without 5 μM 3BrB-PP1 (without containing equal volume of methanol) and incubated with shaking for 30 or 60 min.

Quantification and statistical analysis

Data are presented as described in legends. Experiments were completed in independent biological triplicates. A two-tailed unpaired Student’s t test was used to assess statistical significance between two groups. One-way or two-way analysis of variance (ANOVA) followed by appropriate post hoc test was applied to evaluate the difference between more than two groups (one-way) or more than 2 groups and more than one condition (two-way). Statistical analyses and visualization were performed with GraphPad Prism 10 (GraphPad Software, San Diego, CA). p-value <0.05 was set as the threshold for statistical significance. Power analyses were performed using G∗Power to determine minimum sample size.130,131

Published: August 5, 2025

Footnotes

Supplemental information can be found online at https://doi.org/10.1016/j.isci.2025.113298.

Supplemental information

Document S1. Figures S1–S11 and Tables S1–S3
mmc1.pdf (5.2MB, pdf)

References

  • 1.Chen C., Fingerhut J.M., Yamashita Y.M. The ins(ide) and outs(ide) of asymmetric stem cell division. Curr. Opin. Cell Biol. 2016;43:1–6. doi: 10.1016/j.ceb.2016.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Knoblich J.A. Asymmetric cell division during animal development. Nat. Rev. Mol. Cell Biol. 2001;2:11–20. doi: 10.1038/35048085. [DOI] [PubMed] [Google Scholar]
  • 3.Piroli M.E., Blanchette J.O., Jabbarzadeh E. Polarity as a physiological modulator of cell function. Front. Biosci. 2019;24:451–462. doi: 10.2741/4728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Allam A.H., Charnley M., Russell S.M. Context-Specific Mechanisms of Cell Polarity Regulation. J. Mol. Biol. 2018;430:3457–3471. doi: 10.1016/j.jmb.2018.06.003. [DOI] [PubMed] [Google Scholar]
  • 5.Ridley A.J., Schwartz M.A., Burridge K., Firtel R.A., Ginsberg M.H., Borisy G., Parsons J.T., Horwitz A.R. Cell Migration: Integrating Signals from Front to Back. Science. 2003;302:1704–1709. doi: 10.1126/science.1092053. [DOI] [PubMed] [Google Scholar]
  • 6.Friedl P., Gilmour D. Collective cell migration in morphogenesis, regeneration and cancer. Nat. Rev. Mol. Cell Biol. 2009;10:445–457. doi: 10.1038/nrm2720. [DOI] [PubMed] [Google Scholar]
  • 7.Knoblich J.A. Mechanisms of Asymmetric Stem Cell Division. Cell. 2008;132:583–597. doi: 10.1016/j.cell.2008.02.007. [DOI] [PubMed] [Google Scholar]
  • 8.Lechler T., Fuchs E. Asymmetric cell divisions promote stratification and differentiation of mammalian skin. Nature. 2005;437:275–280. doi: 10.1038/nature03922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Abrahamsen G., Sundvold-Gjerstad V., Habtamu M., Bogen B., Spurkland A. Polarity of CD4+ T cells towards the antigen presenting cell is regulated by the Lck adapter TSAd. Sci. Rep. 2018;8 doi: 10.1038/s41598-018-31510-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Oliaro J., Van Ham V., Sacirbegovic F., Pasam A., Bomzon Z., Pham K., Ludford-Menting M.J., Waterhouse N.J., Bots M., Hawkins E.D., et al. Asymmetric Cell Division of T Cells upon Antigen Presentation Uses Multiple Conserved Mechanisms. J. Immunol. 2010;185:367–375. doi: 10.4049/jimmunol.0903627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ciocca M.L., Barnett B.E., Burkhardt J.K., Chang J.T., Reiner S.L. Cutting Edge: Asymmetric Memory T Cell Division in Response to Rechallenge. J. Immunol. 2012;188:4145–4148. doi: 10.4049/jimmunol.1200176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Schwamborn J.C., Püschel A.W. The sequential activity of the GTPases Rap1B and Cdc42 determines neuronal polarity. Nat. Neurosci. 2004;7:923–929. doi: 10.1038/nn1295. [DOI] [PubMed] [Google Scholar]
  • 13.Stankiewicz T.R., Linseman D.A. Rho family GTPases: key players in neuronal development, neuronal survival, and neurodegeneration. Front. Cell. Neurosci. 2014;8 doi: 10.3389/fncel.2014.00314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Pruyne D., Bretscher A. Polarization of cell growth in yeast: I. Establishment and maintenance of polarity states. J. Cell Sci. 2000;113:365–375. doi: 10.1242/jcs.113.3.365. [DOI] [PubMed] [Google Scholar]
  • 15.Slaughter B.D., Smith S.E., Li R. Symmetry breaking in the life cycle of the budding yeast. Cold Spring Harb. Perspect. Biol. 2009;1 doi: 10.1101/cshperspect.a003384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Das M., Drake T., Wiley D.J., Buchwald P., Vavylonis D., Verde F. Oscillatory Dynamics of Cdc42 GTPase in the Control of Polarized Growth. Science. 2012;337:239–243. doi: 10.1126/science.1218377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Das M., Verde F. Role of Cdc42 dynamics in the control of fission yeast cell polarization. Biochem. Soc. Trans. 2013;41:1745–1749. doi: 10.1042/BST20130241. [DOI] [PubMed] [Google Scholar]
  • 18.Martin S.G., Arkowitz R.A. Cell polarization in budding and fission yeasts. FEMS Microbiol. Rev. 2014;38:228–253. doi: 10.1111/1574-6976.12055. [DOI] [PubMed] [Google Scholar]
  • 19.Miller P.J., Johnson D.I. Cdc42p GTPase is involved in controlling polarized cell growth in Schizosaccharomyces pombe. Mol. Cell Biol. 1994;14:1075–1083. doi: 10.1128/mcb.14.2.1075-1083.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Gladfelter A.S., Moskow J.J., Zyla T.R., Lew D.J. Isolation and characterization of effector-loop mutants of CDC42 in yeast. Mol. Biol. Cell. 2001;12:1239–1255. doi: 10.1091/mbc.12.5.1239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Genova J.L., Jong S., Camp J.T., Fehon R.G. Functional analysis of Cdc42 in actin filament assembly, epithelial morphogenesis, and cell signaling during Drosophila development. Dev. Biol. 2000;221:181–194. doi: 10.1006/dbio.2000.9671. [DOI] [PubMed] [Google Scholar]
  • 22.Allen W.E., Zicha D., Ridley A.J., Jones G.E. A role for Cdc42 in macrophage chemotaxis. J. Cell Biol. 1998;141:1147–1157. doi: 10.1083/jcb.141.5.1147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kroschewski R., Hall A., Mellman I. Cdc42 controls secretory and endocytic transport to the basolateral plasma membrane of MDCK cells. Nat. Cell Biol. 1999;1:8–13. doi: 10.1038/8977. [DOI] [PubMed] [Google Scholar]
  • 24.Etienne-Manneville S. Cdc42 - the centre of polarity. J. Cell Sci. 2004;117:1291–1300. doi: 10.1242/jcs.01115. [DOI] [PubMed] [Google Scholar]
  • 25.Ubukawa K., Goto T., Asanuma K., Sasaki Y., Guo Y.-M., Kobayashi I., Sawada K., Wakui H., Takahashi N. Cdc42 regulates cell polarization and contractile actomyosin rings during terminal differentiation of human erythroblasts. Sci. Rep. 2020;10 doi: 10.1038/s41598-020-68799-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Etienne-Manneville S., Hall A. Integrin-Mediated Activation of Cdc42 Controls Cell Polarity in Migrating Astrocytes through PKCζ. Cell. 2001;106:489–498. doi: 10.1016/S0092-8674(01)00471-8. [DOI] [PubMed] [Google Scholar]
  • 27.Tatebe H., Nakano K., Maximo R., Shiozaki K. Pom1 DYRK Regulates Localization of the Rga4 GAP to Ensure Bipolar Activation of Cdc42 in Fission Yeast. Curr. Biol. 2008;18:322–330. doi: 10.1016/j.cub.2008.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.de Beco S., Vaidžiulytė K., Manzi J., Dalier F., di Federico F., Cornilleau G., Dahan M., Coppey M. Optogenetic dissection of Rac1 and Cdc42 gradient shaping. Nat. Commun. 2018;9:4816. doi: 10.1038/s41467-018-07286-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Howell A.S., Jin M., Wu C.F., Zyla T.R., Elston T.C., Lew D.J. Negative feedback enhances robustness in the yeast polarity establishment circuit. Cell. 2012;149:322–333. doi: 10.1016/j.cell.2012.03.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Machacek M., Hodgson L., Welch C., Elliott H., Pertz O., Nalbant P., Abell A., Johnson G.L., Hahn K.M., Danuser G. Coordination of Rho GTPase activities during cell protrusion. Nature. 2009;461:99–103. doi: 10.1038/nature08242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tamaskovic R., Bichsel S.J., Hemmings B.A. NDR family of AGC kinases – essential regulators of the cell cycle and morphogenesis. FEBS Lett. 2003;546:73–80. doi: 10.1016/S0014-5793(03)00474-5. [DOI] [PubMed] [Google Scholar]
  • 32.Hergovich A., Stegert M.R., Schmitz D., Hemmings B.A. NDR kinases regulate essential cell processes from yeast to humans. Nat. Rev. Mol. Cell Biol. 2006;7:253–264. doi: 10.1038/nrm1891. [DOI] [PubMed] [Google Scholar]
  • 33.Chen B., Liu B., Yu T., Han Y.-F., Wu C., Wang Z.-Y. Nuclear Dbf2-related Kinase 1 functions as tumor suppressor in glioblastoma by phosphorylation of Yes-associated protein. Chin. Med. J. 2021;134:2054–2065. doi: 10.1097/CM9.0000000000001653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ye X., Ong N., An H., Zheng Y. The Emerging Roles of NDR1/2 in Infection and Inflammation. Front. Immunol. 2020;11 doi: 10.3389/fimmu.2020.00534. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Norkett R., del Castillo U., Lu W., Gelfand V.I. Ser/Thr kinase Trc controls neurite outgrowth in Drosophila by modulating microtubule-microtubule sliding. eLife. 2020;9 doi: 10.7554/eLife.52009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Emoto K. The growing role of the Hippo–NDR kinase signalling in neuronal development and disease. J. Biochem. 2011;150:133–141. doi: 10.1093/jb/mvr080. [DOI] [PubMed] [Google Scholar]
  • 37.Emoto K., He Y., Ye B., Grueber W.B., Adler P.N., Jan L.Y., Jan Y.-N. Control of Dendritic Branching and Tiling by the Tricornered-Kinase/Furry Signaling Pathway in Drosophila Sensory Neurons. Cell. 2004;119:245–256. doi: 10.1016/j.cell.2004.09.036. [DOI] [PubMed] [Google Scholar]
  • 38.Yang R., Kong E., Jin J., Hergovich A., Püschel A.W. Rassf5 and Ndr kinases regulate neuronal polarity through Par3 phosphorylation in a novel pathway. J. Cell Sci. 2014;127:3463–3476. doi: 10.1242/jcs.146696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Verde F., Wiley D.J., Nurse P. Fission yeast orb6, a ser/thr protein kinase related to mammalian rho kinase and myotonic dystrophy kinase, is required for maintenance of cell polarity and coordinates cell morphogenesis with the cell cycle. Proc. Natl. Acad. Sci. USA. 1998;95:7526–7531. doi: 10.1073/pnas.95.13.7526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Das M., Nuñez I., Rodriguez M., Wiley D.J., Rodriguez J., Sarkeshik A., Yates J.R., 3rd, Buchwald P., Verde F. Phosphorylation-dependent inhibition of Cdc42 GEF Gef1 by 14-3-3 protein Rad24 spatially regulates Cdc42 GTPase activity and oscillatory dynamics during cell morphogenesis. Mol. Biol. Cell. 2015;26:3520–3534. doi: 10.1091/mbc.E15-02-0095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Chen C., Rodriguez Pino M., Haller P.R., Verde F. Conserved NDR/LATS kinase controls RAS GTPase activity to regulate cell growth and chronological lifespan. Mol. Biol. Cell. 2019;30:2598–2616. doi: 10.1091/mbc.E19-03-0172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Nuñez I., Rodriguez Pino M., Wiley D.J., Das M.E., Chen C., Goshima T., Kume K., Hirata D., Toda T., Verde F. Spatial control of translation repression and polarized growth by conserved NDR kinase Orb6 and RNA-binding protein Sts5. eLife. 2016;5 doi: 10.7554/eLife.14216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Liu G., Young D. Conserved Orb6 Phosphorylation Sites Are Essential for Polarized Cell Growth in Schizosaccharomyces pombe. PLoS One. 2012;7 doi: 10.1371/journal.pone.0037221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Das M., Wiley D.J., Chen X., Shah K., Verde F. The conserved NDR kinase Orb6 controls polarized cell growth by spatial regulation of the small GTPase Cdc42. Curr. Biol. 2009;19:1314–1319. doi: 10.1016/j.cub.2009.06.057. [DOI] [PubMed] [Google Scholar]
  • 45.Tu H., Wigler M. Genetic evidence for Pak1 autoinhibition and its release by Cdc42. Mol. Cell Biol. 1999;19:602–611. doi: 10.1128/mcb.19.1.602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Chang E.C., Barr M., Wang Y., Jung V., Xu H.P., Wigler M.H. Cooperative interaction of S. pombe proteins required for mating and morphogenesis. Cell. 1994;79:131–141. doi: 10.1016/0092-8674(94)90406-5. [DOI] [PubMed] [Google Scholar]
  • 47.Salat-Canela C., Carmona M., Martín-García R., Pérez P., Ayté J., Hidalgo E. Stress-dependent inhibition of polarized cell growth through unbalancing the GEF/GAP regulation of Cdc42. Cell Rep. 2021;37 doi: 10.1016/j.celrep.2021.109951. [DOI] [PubMed] [Google Scholar]
  • 48.Mutavchiev D.R., Leda M., Sawin K.E. Remodeling of the Fission Yeast Cdc42 Cell-Polarity Module via the Sty1 p38 Stress-Activated Protein Kinase Pathway. Curr. Biol. 2016;26:2921–2928. doi: 10.1016/j.cub.2016.08.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Vjestica A., Zhang D., Liu J., Oliferenko S. Hsp70-Hsp40 Chaperone Complex Functions in Controlling Polarized Growth by Repressing Hsf1-Driven Heat Stress-Associated Transcription. PLoS Genet. 2013;9 doi: 10.1371/journal.pgen.1003886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Corral-Ramos C., Barrios R., Ayté J., Hidalgo E. TOR and MAP kinase pathways synergistically regulate autophagy in response to nutrient depletion in fission yeast. Autophagy. 2022;18:375–390. doi: 10.1080/15548627.2021.1935522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Degols G., Shiozaki K., Russell P. Activation and regulation of the Spc1 stress-activated protein kinase in Schizosaccharomyces pombe. Mol. Cell Biol. 1996;16:2870–2877. doi: 10.1128/mcb.16.6.2870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Kristell C., Orzechowski Westholm J., Olsson I., Ronne H., Komorowski J., Bjerling P. Nitrogen depletion in the fission yeast Schizosaccharomyces pombe causes nucleosome loss in both promoters and coding regions of activated genes. Genome Res. 2010;20:361–371. doi: 10.1101/gr.098558.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Toone W.M., Kuge S., Samuels M., Morgan B.A., Toda T., Jones N. Regulation of the fission yeast transcription factor Pap1 by oxidative stress: requirement for the nuclear export factor Crm1 (Exportin) and the stress-activated MAP kinase Sty1/Spc1. Genes Dev. 1998;12:1453–1463. doi: 10.1101/gad.12.10.1453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Shieh J.C., Wilkinson M.G., Buck V., Morgan B.A., Makino K., Millar J.B. The Mcs4 response regulator coordinately controls the stress-activated Wak1-Wis1-Sty1 MAP kinase pathway and fission yeast cell cycle. Genes Dev. 1997;11:1008–1022. doi: 10.1101/gad.11.8.1008. [DOI] [PubMed] [Google Scholar]
  • 55.Asp E., Nilsson D., Sunnerhagen P. Fission yeast mitogen-activated protein kinase Sty1 interacts with translation factors. Eukaryot. Cell. 2008;7:328–338. doi: 10.1128/ec.00358-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Pérez P., Soto T., Gómez-Gil E., Cansado J. Functional interaction between Cdc42 and the stress MAPK signaling pathway during the regulation of fission yeast polarized growth. Int. Microbiol. 2020;23:31–41. doi: 10.1007/s10123-019-00072-6. [DOI] [PubMed] [Google Scholar]
  • 57.Gupta S., Mana-Capelli S., McLean J.R., Chen C.T., Ray S., Gould K.L., McCollum D. Identification of SIN pathway targets reveals mechanisms of crosstalk between NDR kinase pathways. Curr. Biol. 2013;23:333–338. doi: 10.1016/j.cub.2013.01.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Mah A.S., Elia A.E.H., Devgan G., Ptacek J., Schutkowski M., Snyder M., Yaffe M.B., Deshaies R.J. Substrate specificity analysis of protein kinase complex Dbf2-Mob1 by peptide library and proteome array screening. BMC Biochem. 2005;6:22. doi: 10.1186/1471-2091-6-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Johnson J.L., Yaron T.M., Huntsman E.M., Kerelsky A., Song J., Regev A., Lin T.Y., Liberatore K., Cizin D.M., Cohen B.M., et al. An atlas of substrate specificities for the human serine/threonine kinome. Nature. 2023;613:759–766. doi: 10.1038/s41586-022-05575-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Hergovich A. The Roles of NDR Protein Kinases in Hippo Signalling. Genes. 2016;7 doi: 10.3390/genes7050021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Hao Y., Chun A., Cheung K., Rashidi B., Yang X. Tumor suppressor LATS1 is a negative regulator of oncogene YAP. J. Biol. Chem. 2008;283:5496–5509. doi: 10.1074/jbc.M709037200. [DOI] [PubMed] [Google Scholar]
  • 62.Lee S., Devamani T., Song H.D., Sandhu M., Larsen A., Sommese R., Jain A., Vaidehi N., Sivaramakrishnan S. Distinct structural mechanisms determine substrate affinity and kinase activity of protein kinase Cα. J. Biol. Chem. 2017;292:16300–16309. doi: 10.1074/jbc.M117.804781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Miller C.J., Turk B.E. Homing in: Mechanisms of Substrate Targeting by Protein Kinases. Trends Biochem. Sci. 2018;43:380–394. doi: 10.1016/j.tibs.2018.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Yaffe M.B., Rittinger K., Volinia S., Caron P.R., Aitken A., Leffers H., Gamblin S.J., Smerdon S.J., Cantley L.C. The structural basis for 14-3-3:phosphopeptide binding specificity. Cell. 1997;91:961–971. doi: 10.1016/s0092-8674(00)80487-0. [DOI] [PubMed] [Google Scholar]
  • 65.van Heusden G.P.H., Steensma H.Y. Yeast 14-3-3 proteins. Yeast. 2006;23:159–171. doi: 10.1002/yea.1338. [DOI] [PubMed] [Google Scholar]
  • 66.Swaffer M.P., Jones A.W., Flynn H.R., Snijders A.P., Nurse P. Quantitative Phosphoproteomics Reveals the Signaling Dynamics of Cell-Cycle Kinases in the Fission Yeast Schizosaccharomyces pombe. Cell Rep. 2018;24:503–514. doi: 10.1016/j.celrep.2018.06.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Gallo Castro D., Martin S.G. Differential GAP requirement for Cdc42-GTP polarization during proliferation and sexual reproduction. J. Cell Biol. 2018;217:4215–4229. doi: 10.1083/jcb.201806016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Arellano M., Niccoli T., Nurse P. Tea3p is a cell end marker activating polarized growth in Schizosaccharomyces pombe. Curr. Biol. 2002;12:751–756. doi: 10.1016/s0960-9822(02)00821-7. [DOI] [PubMed] [Google Scholar]
  • 69.Tatebe H., Shimada K., Uzawa S., Morigasaki S., Shiozaki K. Wsh3/Tea4 is a novel cell-end factor essential for bipolar distribution of Tea1 and protects cell polarity under environmental stress in S. pombe. Curr. Biol. 2005;15:1006–1015. doi: 10.1016/j.cub.2005.04.061. [DOI] [PubMed] [Google Scholar]
  • 70.Martin S.G., McDonald W.H., Yates J.R., 3rd, Chang F. Tea4p links microtubule plus ends with the formin for3p in the establishment of cell polarity. Dev. Cell. 2005;8:479–491. doi: 10.1016/j.devcel.2005.02.008. [DOI] [PubMed] [Google Scholar]
  • 71.Vo T.V., Das J., Meyer M.J., Cordero N.A., Akturk N., Wei X., Fair B.J., Degatano A.G., Fragoza R., Liu L.G., et al. A Proteome-wide Fission Yeast Interactome Reveals Network Evolution Principles from Yeasts to Human. Cell. 2016;164:310–323. doi: 10.1016/j.cell.2015.11.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Kokkoris K., Gallo Castro D., Martin S.G. The Tea4–PP1 landmark promotes local growth by dual Cdc42 GEF recruitment and GAP exclusion. J. Cell Sci. 2014;127:2005–2016. doi: 10.1242/jcs.142174. [DOI] [PubMed] [Google Scholar]
  • 73.Halova L., Cobley D., Franz-Wachtel M., Wang T., Morrison K.R., Krug K., Nalpas N., Maček B., Hagan I.M., Humphrey S.J., Petersen J. A TOR (target of rapamycin) and nutritional phosphoproteome of fission yeast reveals novel targets in networks conserved in humans. Open Biol. 2021;11 doi: 10.1098/rsob.200405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Rutkowski D.M., Vincenzetti V., Vavylonis D., Martin S.G. Cdc42 mobility and membrane flows regulate fission yeast cell shape and survival. Nat. Commun. 2024;15:8363. doi: 10.1038/s41467-024-52655-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Das M., Wiley D.J., Medina S., Vincent H.A., Larrea M., Oriolo A., Verde F. Regulation of cell diameter, For3p localization, and cell symmetry by fission yeast Rho-GAP Rga4p. Mol. Biol. Cell. 2007;18:2090–2101. doi: 10.1091/mbc.e06-09-0883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Kelly F.D., Nurse P. Spatial control of Cdc42 activation determines cell width in fission yeast. Mol. Biol. Cell. 2011;22:3801–3811. doi: 10.1091/mbc.E11-01-0057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Pino M.R., Nuñez I., Chen C., Das M.E., Wiley D.J., D’Urso G., Buchwald P., Vavylonis D., Verde F. Cdc42 GTPase-activating proteins (GAPs) regulate generational inheritance of cell polarity and cell shape in fission yeast. Mol. Biol. Cell. 2021;32 doi: 10.1091/mbc.E20-10-0666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Choi E., Lee K., Song K. Function of rax2p in the Polarized Growth of Fission Yeast. Mol. Cells. 2006;22:146–153. doi: 10.1016/S1016-8478(23)17403-6. [DOI] [PubMed] [Google Scholar]
  • 79.Shiozaki K., Shiozaki M., Russell P. Heat stress activates fission yeast Spc1/StyI MAPK by a MEKK-independent mechanism. Mol. Biol. Cell. 1998;9:1339–1349. doi: 10.1091/mbc.9.6.1339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Warbrick E., Fantes P.A. The wis1 protein kinase is a dosage-dependent regulator of mitosis in Schizosaccharomyces pombe. EMBO J. 1991;10:4291–4299. doi: 10.1002/j.1460-2075.1991.tb05007.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Shiozaki K., Russell P. Cell-cycle control linked to extracellular environment by MAP kinase pathway in fission yeast. Nature. 1995;378:739–743. doi: 10.1038/378739a0. [DOI] [PubMed] [Google Scholar]
  • 82.López-Avilés S., Grande M., González M., Helgesen A.L., Alemany V., Sanchez-Piris M., Bachs O., Millar J.B.A., Aligue R. Inactivation of the Cdc25 phosphatase by the stress-activated Srk1 kinase in fission yeast. Mol. Cell. 2005;17:49–59. doi: 10.1016/j.molcel.2004.11.043. [DOI] [PubMed] [Google Scholar]
  • 83.Murciano-Julià G., Francos-Cárdenas M., Salat-Canela C., Hidalgo E., Ayté J. FLCCR is a fluorescent reporter system that quantifies the duration of different cell cycle phases at the single-cell level in fission yeast. PLoS Biol. 2025;23 doi: 10.1371/journal.pbio.3002969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Bendezú F.O., Martin S.G. Cdc42 Explores the Cell Periphery for Mate Selection in Fission Yeast. Curr. Biol. 2013;23:42–47. doi: 10.1016/j.cub.2012.10.042. [DOI] [PubMed] [Google Scholar]
  • 85.Kreider-Letterman G., Carr N.M., Garcia-Mata R. Fixing the GAP: The role of RhoGAPs in cancer. Eur. J. Cell Biol. 2022;101 doi: 10.1016/j.ejcb.2022.151209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Yang C., Kazanietz M.G. Chimaerins: GAPs that bridge diacylglycerol signalling and the small G-protein Rac. Biochem. J. 2007;403:1–12. doi: 10.1042/bj20061750. [DOI] [PubMed] [Google Scholar]
  • 87.Miyake N., Chilton J., Psatha M., Cheng L., Andrews C., Chan W.M., Law K., Crosier M., Lindsay S., Cheung M., et al. Human CHN1 mutations hyperactivate alpha2-chimaerin and cause Duane's retraction syndrome. Science. 2008;321:839–843. doi: 10.1126/science.1156121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Niftullayev S., Lamarche-Vane N. Regulators of Rho GTPases in the Nervous System: Molecular Implication in Axon Guidance and Neurological Disorders. Int. J. Mol. Sci. 2019;20 doi: 10.3390/ijms20061497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Coll P.M., Rincon S.A., Izquierdo R.A., Perez P. Hob3p, the fission yeast ortholog of human BIN3, localizes Cdc42p to the division site and regulates cytokinesis. EMBO J. 2007;26:1865–1877. doi: 10.1038/sj.emboj.7601641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Hercyk B.S., Das M.E. F-BAR Cdc15 Promotes Cdc42 Activation During Cytokinesis and Cell Polarization in Schizosaccharomyces pombe. Genetics. 2019;213:1341–1356. doi: 10.1534/genetics.119.302649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Mangan S., Alon U. Structure and function of the feed-forward loop network motif. Proc. Natl. Acad. Sci. USA. 2003;100:11980–11985. doi: 10.1073/pnas.2133841100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Broach J.R. Nutritional control of growth and development in yeast. Genetics. 2012;192:73–105. doi: 10.1534/genetics.111.135731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Yanagida M. Cellular quiescence: are controlling genes conserved? Trends Cell Biol. 2009;19:705–715. doi: 10.1016/j.tcb.2009.09.006. [DOI] [PubMed] [Google Scholar]
  • 94.Valcourt J.R., Lemons J.M.S., Haley E.M., Kojima M., Demuren O.O., Coller H.A. Staying alive: metabolic adaptations to quiescence. Cell Cycle. 2012;11:1680–1696. doi: 10.4161/cc.19879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Zuin A., Vivancos A.P., Sansó M., Takatsume Y., Ayté J., Inoue Y., Hidalgo E. The Glycolytic Metabolite Methylglyoxal Activates Pap1 and Sty1 Stress Responses in Schizosaccharomyces pombe. J. Biol. Chem. 2005;280:36708–36713. doi: 10.1074/jbc.M508400200. [DOI] [PubMed] [Google Scholar]
  • 96.Zuin A., Carmona M., Morales-Ivorra I., Gabrielli N., Vivancos A.P., Ayté J., Hidalgo E. Lifespan extension by calorie restriction relies on the Sty1 MAP kinase stress pathway. EMBO J. 2010;29:981–991. doi: 10.1038/emboj.2009.407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Rallis C., Codlin S., Bähler J. TORC1 signaling inhibition by rapamycin and caffeine affect lifespan, global gene expression, and cell proliferation of fission yeast. Aging Cell. 2013;12:563–573. doi: 10.1111/acel.12080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Ohtsuka H., Shimasaki T., Aiba H. Genes affecting the extension of chronological lifespan in Schizosaccharomyces pombe (fission yeast) Mol. Microbiol. 2021;115:623–642. doi: 10.1111/mmi.14627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Rodríguez-López M., Gonzalez S., Hillson O., Tunnacliffe E., Codlin S., Tallada V.A., Bähler J., Rallis C. The GATA Transcription Factor Gaf1 Represses tRNAs, Inhibits Growth, and Extends Chronological Lifespan Downstream of Fission Yeast TORC1. Cell Rep. 2020;30:3240–3249.e4. doi: 10.1016/j.celrep.2020.02.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Mirisola M.G., Longo V.D. Yeast Chronological Lifespan: Longevity Regulatory Genes and Mechanisms. Cells. 2022;11 doi: 10.3390/cells11101714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Chen B.R., Runge K.W. A new Schizosaccharomyces pombe chronological lifespan assay reveals that caloric restriction promotes efficient cell cycle exit and extends longevity. Exp. Gerontol. 2009;44:493–502. doi: 10.1016/j.exger.2009.04.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Ohtsuka H., Shimasaki T., Aiba H. Extension of chronological lifespan in Schizosaccharomyces pombe. Genes Cells. 2021;26:459–473. doi: 10.1111/gtc.12854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103.Estravis M., Rincon S., Pérez P. Cdc42 regulation of polarized traffic in fission yeast. Commun. Integr. Biol. 2012;5:370–373. doi: 10.4161/cib.19977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Seike T., Niki H. Pheromone Response and Mating Behavior in Fission Yeast. Microbiol. Mol. Biol. Rev. 2022;86 doi: 10.1128/mmbr.00130-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105.Egel R. Physiological aspects of conjugation in fission yeast. Planta. 1971;98:89–96. doi: 10.1007/bf00387025. [DOI] [PubMed] [Google Scholar]
  • 106.Fukunishi K., Miyakubi K., Hatanaka M., Otsuru N., Hirata A., Shimoda C., Nakamura T. The fission yeast spore is coated by a proteinaceous surface layer comprising mainly Isp3. Mol. Biol. Cell. 2014;25:1549–1559. doi: 10.1091/mbc.E13-12-0731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Egel R. Selective spore survival during replica-plating of fission yeast. Arch. Microbiol. 1977;112:109–110. doi: 10.1007/bf00446662. [DOI] [PubMed] [Google Scholar]
  • 108.Ohtsuka H., Imada K., Shimasaki T., Aiba H. Sporulation: A response to starvation in the fission yeast Schizosaccharomyces pombe. Microbiologyopen. 2022;11 doi: 10.1002/mbo3.1303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109.Amoah A., Keller A., Emini R., Hoenicka M., Liebold A., Vollmer A., Eiwen K., Soller K., Sakk V., Zheng Y., et al. Aging of human hematopoietic stem cells is linked to changes in Cdc42 activity. Haematologica. 2022;107:393–402. doi: 10.3324/haematol.2020.269670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 110.Florian M.C., Dörr K., Niebel A., Daria D., Schrezenmeier H., Rojewski M., Filippi M.D., Hasenberg A., Gunzer M., Scharffetter-Kochanek K., et al. Cdc42 activity regulates hematopoietic stem cell aging and rejuvenation. Cell Stem Cell. 2012;10:520–530. doi: 10.1016/j.stem.2012.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 111.Hardie D.G. AMPK--sensing energy while talking to other signaling pathways. Cell Metab. 2014;20:939–952. doi: 10.1016/j.cmet.2014.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112.Laplante M., Sabatini D.M. mTOR signaling in growth control and disease. Cell. 2012;149:274–293. doi: 10.1016/j.cell.2012.03.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113.Wullschleger S., Loewith R., Hall M.N. TOR signaling in growth and metabolism. Cell. 2006;124:471–484. doi: 10.1016/j.cell.2006.01.016. [DOI] [PubMed] [Google Scholar]
  • 114.Avruch J., Long X., Ortiz-Vega S., Rapley J., Papageorgiou A., Dai N. Amino acid regulation of TOR complex 1. Am. J. Physiol. Endocrinol. Metab. 2009;296:E592–E602. doi: 10.1152/ajpendo.90645.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 115.Takahara T., Maeda T. TORC1 of fission yeast is rapamycin-sensitive. Genes Cells. 2012;17:698–708. doi: 10.1111/j.1365-2443.2012.01618.x. [DOI] [PubMed] [Google Scholar]
  • 116.Morigasaki S., Chin L.C., Hatano T., Emori M., Iwamoto M., Tatebe H., Shiozaki K. Modulation of TOR complex 2 signaling by the stress-activated MAPK pathway in fission yeast. J. Cell Sci. 2019;132 doi: 10.1242/jcs.236133. [DOI] [PubMed] [Google Scholar]
  • 117.Perez-Riverol Y., Bandla C., Kundu D.J., Kamatchinathan S., Bai J., Hewapathirana S., John N.S., Prakash A., Walzer M., Wang S., Vizcaíno J.A. The PRIDE database at 20 years: 2025 update. Nucleic Acids Res. 2025;53:D543–D553. doi: 10.1093/nar/gkae1011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 118.Rodríguez-López M., Cotobal C., Fernández-Sánchez O., Borbarán Bravo N., Oktriani R., Abendroth H., Uka D., Hoti M., Wang J., Zaratiegui M., Bähler J. A CRISPR/Cas9-based method and primer design tool for seamless genome editing in fission yeast. Wellcome Open Res. 2016;1:19. doi: 10.12688/wellcomeopenres.10038.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 119.Moreno S., Klar A., Nurse P. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 1991;194:795–823. doi: 10.1016/0076-6879(91)94059-l. [DOI] [PubMed] [Google Scholar]
  • 120.Gould K.L., Ren L., Feoktistova A.S., Jennings J.L., Link A.J. Tandem affinity purification and identification of protein complex components. Methods. 2004;33:239–244. doi: 10.1016/j.ymeth.2003.11.019. [DOI] [PubMed] [Google Scholar]
  • 121.Roberts-Galbraith R.H., Chen J.S., Wang J., Gould K.L. The SH3 domains of two PCH family members cooperate in assembly of the Schizosaccharomyces pombe contractile ring. J. Cell Biol. 2009;184:113–127. doi: 10.1083/jcb.200806044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 122.Ma Z.Q., Tabb D.L., Burden J., Chambers M.C., Cox M.B., Cantrell M.J., Ham A.J.L., Litton M.D., Oreto M.R., Schultz W.C., et al. Supporting tool suite for production proteomics. Bioinformatics. 2011;27:3214–3215. doi: 10.1093/bioinformatics/btr544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 123.Schindelin J., Arganda-Carreras I., Frise E., Kaynig V., Longair M., Pietzsch T., Preibisch S., Rueden C., Saalfeld S., Schmid B., et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods. 2012;9:676–682. doi: 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 124.Hou M.-C., Wiley D.J., Verde F., McCollum D. Mob2p interacts with the protein kinase Orb6p to promote coordination of cell polarity with cell cycle progression. J. Cell Sci. 2003;116:125–135. doi: 10.1242/jcs.00206. [DOI] [PubMed] [Google Scholar]
  • 125.Opalko H.E., Moseley J.B. Dynamic regulation of Cdr1 kinase localization and phosphorylation during osmotic stress. J. Biol. Chem. 2017;292:18457–18468. doi: 10.1074/jbc.M117.793034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 126.Lee M.E., Rusin S.F., Jenkins N., Kettenbach A.N., Moseley J.B. Mechanisms Connecting the Conserved Protein Kinases Ssp1, Kin1, and Pom1 in Fission Yeast Cell Polarity and Division. Curr. Biol. 2018;28:84–92.e4. doi: 10.1016/j.cub.2017.11.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 127.Allen J.J., Li M., Brinkworth C.S., Paulson J.L., Wang D., Hübner A., Chou W.H., Davis R.J., Burlingame A.L., Messing R.O., et al. A semisynthetic epitope for kinase substrates. Nat. Methods. 2007;4:511–516. doi: 10.1038/nmeth1048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 128.Hertz N.T., Wang B.T., Allen J.J., Zhang C., Dar A.C., Burlingame A.L., Shokat K.M. Chemical genetic approach for kinase-substrate mapping by covalent capture of thiophosphopeptides and analysis by mass spectrometry. Curr. Protoc. Chem. Biol. 2010;2:15–36. doi: 10.1002/9780470559277.ch090201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 129.Matsuo Y., Asakawa K., Toda T., Katayama S. A Rapid Method for Protein Extraction from Fission Yeast. Biosci. Biotechnol. Biochem. 2006;70:1992–1994. doi: 10.1271/bbb.60087. [DOI] [PubMed] [Google Scholar]
  • 130.Faul F., Erdfelder E., Lang A.G., Buchner A. G∗Power 3: a flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav. Res. Methods. 2007;39:175–191. doi: 10.3758/bf03193146. [DOI] [PubMed] [Google Scholar]
  • 131.Kang H. Sample size determination and power analysis using the G∗Power software. J. Educ. Eval. Health Prof. 2021;18:17. doi: 10.3352/jeehp.2021.18.17. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Video S1. Active Cdc42 oscillatory dynamics, related to Figure 1A

Fluorescent microscopy timelapse showing oscillations of active Cdc42 (CRIB-GFP) between cell tips.

Download video file (68.8KB, mp4)
Video S2. Active Cdc42 dynamics during Orb6 inhibition, related to Figure 1B

Fluorescent microscopy timelapse showing exploratory pattern of active Cdc42 (CRIB-GFP) along the cell membrane when analogue-sensitive orb6-as2 mutant is inhibited (+1-NA-PP1).

Download video file (25.8KB, mp4)
Document S1. Figures S1–S11 and Tables S1–S3
mmc1.pdf (5.2MB, pdf)

Data Availability Statement

  • The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE117 partner repository with the dataset identifier PXD066553 and are publicly available as of the date of publication.

  • Data reported in this paper is available upon request.

  • This paper does not report any original code.

  • Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.


Articles from iScience are provided here courtesy of Elsevier

RESOURCES