TABLE 1.
Sequences of oligonucleotide probes targeting 16S rDNA sequencesc
Probe | Target organisms | Sequence (5′-3′) | Positiona |
---|---|---|---|
ARCH915 | Archaea | GTGCTCCCCCGCCAATTCCT | |
EUB338 | Eubacteria | GCTGCCTCCCGTAGGAGT | |
S-S-D.frap-327 (D. frappieri)-a-A-19b | All strains of D. frappieri, Desulflitobacterium hafniense, and Desulfitobacterium chlororespirans | GCGGATCCATCTACTAACG | 345-327 |
S-S-D.frap-86 (D. frappieri)-a-A-20b | All strains of D. frappieri except strain DP7 | ATCCACTTATCTGCTCCTTA | 105-86 |
S-S-D.frap-576 (D. frappieri)-a-A-19b | All strains of D. frappieri and Desulfitobacterium hafniense | CCGTCATGTAAGTACATTA | 594-576 |
S-S-D.frap-555 (D. frappieri)-a-A-21 | Helpers for the S-S-D.frap-576(D. frappieri)-a-A-19 probe | TTTACATACTTACCGTTCGTC | 575-555 |
S-S-D.frap-595 (D. frappieri)-a-A-18 | Helpers for the S-S-D.frap-576(D. frappieri)-a-A-19 probe | GGGCTTCCTCCTCAGGTA | 612-595 |
Position relative to strain PCP-1 16S rDNA sequence.
Sequence is identical to the 16S rDNA sequence of the mentioned desulfitobacteria.
All oligonucleotides were labeled with Cy3 except S-S-D.frap-576(D. frappieri)-a-A-19, which was labeled with Cy5 and two helpers (unlabeled).