KRAS mutation promotes immune escape of lung adenocarcinoma via ZNF24/SLC7A5/PD-L1 axis

Abstract

Background

The imbalance of immune checkpoint molecules leads to immune escape of tumor cells. It has been established that KRAS mutation plays a key role in regulating PD-L1 expression of lung adenocarcinoma. However, the specific mechanism by which KRAS mutation regulates PD-L1 expression still needs further been clarified.

Methods

The relationship of KRAS mutation and ZNF24, SLC7A5 and PD-L1 expression in human lung adenocarcinoma tissues and cell lines were analyzed using relative assays. The effects of KRAS mutation on CD8⁺ T cell-dependent anti-tumor immunity via the ZNF24/SLC7A5/PD-L1 axis were analyzed through in vitro and in vivo experiments. Additionally, we examined whether and how targeting ZNF24 inhibits KRAS mutation-induced PD-L1 expression and evaluated the effect of ZNF24 inhibition and PD-L1 blocking on CD8⁺ T cell-dependent anti-tumor immunity.

Results

Our results found that KRAS mutation increases the expression of PD-L1 through the ZNF24/SLC7A5 axis and simultaneously inhibits the activation of CD8⁺ T cells in lung adenocarcinoma. Importantly, we discovered that Daptomycin (DAPT) binds to ZNF24 and inactivates it, representing the first reported inhibitor of ZNF24. DAPT combined with Anti PD-L1 monoclonal antibody may enhance CD8⁺ T cell-dependent anti-tumor immunity in KRAS mutated lung adenocarcinoma.

Conclusion

Our study provides the first evidence that KRAS mutation promotes immune escape in lung adenocarcinoma through the ZNF24/SLC7A5/PD-L1 axis.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12885-025-14336-0.

Introduction

Lung cancer is a highly prevalent and deadly disease, ranking as the second most common cancer worldwide in terms of incidence [1]. Among all types of lung cancer, lung adenocarcinoma is the most frequently occurring [2, 3]. In recent years, immune checkpoint blockades (ICIs) therapy has achieved significant efficacy in various tumor treatments, including lung adenocarcinoma. Targeted PD-1/PD-L1 therapies are currently widely used for immune checkpoint blockade therapy [4–6]. The use of PD-L1 blockade therapies has become widespread in the treatment of various types of cancer, including lung adenocarcinoma [7–11]. The combination of PD-L1 blockade therapies with the chemotherapeutic agent carboplatin has demonstrated remarkable benefits in terms of both overall survival (OS) and progression-free survival (PFS) for patients with advanced stage III-IV NSCLC [12, 13]. However, it is worth noting that only a subset of patients, accounting for less than 40% of cases, actual response positively to PD-L1 blockade therapies and experience prolonged PFS [14]. The overall objective response rate for PD-1/PD-L1 blockade therapies is 13–80% [6, 15–17]. This indicates that there might be additional factors contribute to immune evasion of tumor cells. Therefore, it is imperative to identify and understand these underlying mechanisms to develop effective strategies against tumor immune escape.

PD-L1 expression of tumor cells is one of the FDA (Food and Drug Administration) approved biomarkers for predicting PD-L1/PD-1 blockade therapies response [7]. Accumulating studies have shown that interfering with PD-L1 expression can impact tumor immunogenicity. For instance, miR-105-5p could reduce PD-L1 expression and increase the immunogenicity of gastric cancer cells [18]. Elizabeth A. et al. certificated that the loss of PTEN upregulated PD-L1 expression and decreased the immunogenicity of triple negative breast cancer [19]. Other research also found that lncRNA SNHG12 promoted immune escape by increasing the expression of PD-L1 in non-small cell lung cancer (NSCLC) [20]. There are also numerous studies on the relationship between KRAS mutation, PD-L1 expression, and immune escape. Numerous evidence supporting the correlation between KRAS mutation and increased level of PD-L1 in various tumors [21–23], containing NSCLC [24, 25]. Moreover, research has found that the efficacy of PD-1/PD-L1 therapy in patients with KRAS-mutant lung adenocarcinoma is comparable to that of patients with KRAS-wild type lung adenocarcinoma [4, 26]. However, patients with KRAS mutation in lung adenocarcinoma are prone to immune evasion, leading to resistance to immune checkpoint blockade therapy [27, 28], which indicates that KRAS mutation may be related to PD-L1 mediated immune escape. It has been discovered that KRAS mutation can stimulate the expression of PD-L1 by activating the MEK-dependent oncogenic transcription factor FRA1 [29]. Meanwhile, some studies have also revealed that KRAS mutation promoted PD-L1 expression through the MER/ERK pathway [30]. Interestingly, our previous research found that two new genes, SLC7A5 and ZNF24, are regulated by the KRAS mutation and located backward position of the MEK/ERK pathway [31]. However, it is still unclear whether ZNF24 and SLC7A5 are involved in regulating PD-L1 expression and how they participate in immune escape. Clarifying this issue is crucial for revealing the mechanism by which KRAS mutation leads to immune escape.

In this research, we found for the first time that KRAS mutation regulate PD-L1 expression and affect CD8⁺ T cell activity through the ZNF24/SLC7A5 axis, leading to immune escape. Overall, these findings provide important insights into the potential role of KRAS/ZNF24/SLC7A5 axis as a therapeutic target for improving immunotherapy outcomes in Ras-driven tumors.

Materials and methods

Cells and tissues

The lung adenocarcinoma cell lines of human, including Calu-3, H358, H23 and H2122, were obtained from Center for Molecular and Cellular Sciences of Shanghai. The Lewis lung cancer cell line derived from mice, LLC, was obtained from FengHuiShengWu in Hunan, China. These cell lines were cultured in RPMI-1640 or DMEM medium which were purchased from VivaCell in Shanghai, China. Additionally, the culture media were supplemented with 1% penicillin-streptomycin solution from Beyotime in Shanghai and 10% fetal bovine serum from VivaCell. All the cells mentioned above were cultured in a controlled environment at 37℃ with an atmosphere containing 5% CO₂. From 2013 to 2023, a total of fifty-five lung adenocarcinoma tissues and twenty normal lung epithelial tissues were collected from individuals who were undergoing lung cancer resection at our hospital (the 920th Hospital of the Joint Logistics Support Force of PLA). The selection criteria for inclusion in the study required a confirmed diagnosis of lung adenocarcinoma through pathology examination and a clear determination of the KRAS status through genetic testing. The entire process of sample collection was conducted in accordance with the ethical guidelines set forth by the ethics committee of our hospital.

Transfection

The lentivirus carrying ZNF24 gene knockdown constructs were transfected into the cells. The lentivirus and plasmid were acquired from Genechem, a biotechnology company located in Shanghai, China. The cells were initially cultured in a 6-well plate at a density of 2 × 10⁴ cells. Then, the lentivirus carrying the gene knockdown constructs (at a multiplicity of infection (MOI) of 10 and a volume of 2 mL) was added to the cells. After 6–8 h, the RPMI 1640 medium containing 10% Fetal Bovine Serum was replaced, and the cells were further cultivated for 48 h. To select for cells that underwent successful gene knockdown, the researchers used RPMI 1640 medium containing 2 mg/mL purinomycin for a period of 3–5 days. This allowed for the elimination of cells that did not exhibit stable ZNF24 expression decrease. Additionally, the researchers were also interested in studying the overexpression of KRAS^G12C and SLC7A5 genes. To achieve this, the over-SLC7A5 or over-KRAS^G12C plasmids were transfected into the cells using the Lipofectamine 3000 kit, following the instructions provided by the manufacturer.

Screening and validation of ZNF24 inhibitors

Molecular docking is a virtual screening of the compound database based on various scoring functions, and the strongest compounds that can bind to target proteins can be predicted. Accelrys Discovery Studio 3.5 [32], Pymol [33, 34] and Autodock [32] were used for docking. The crystal structure of ZNF24 was mainly screened from the protein database (www.pdb.org), and human protein and prioritizing the protein crystal structure with higher resolution were selected and prioritized from the database. Then, the Pymol software was used to optimize the crystal structure of ZNF24 protein, remove water molecules and ligand molecules and add hydrogenation and charges to obtain a ZNF24 protein structure that is close to the activity in the organism. In this study, the LibDock tool of Discovery Studio (DS) was used to specify the number of conformations and docked them through ‘’High Quality’’. LibDock was a high-throughput docking algorithm used to locate the formation of protein active site based on polar interaction sites (hot spots) in ligands generated by catalysts [32]. The conformational space of ligands was recognized by AutoDock using the Lamarckian Genetic Algorithm (LGA). Both receptors and ligands were used in MOL2 format. Virtual screening of small molecules was completed in this study from small molecule databases (https://www.apexbt.com/search/screening-library?cat=778).

Next, to demonstrate the affinity between small molecule compounds and target protein ZNF24 through Surface Plasmon Resonance (SPR). Firstly, the ZNF24 gene was inserted into the prokaryotic expression plasmid pET-28a (+) (Qingke, China). The expression plasmids of ZNF24 were transformed into Escherichia coli BL21 (DE3) and screened with 50 µg/ml kanamycin. After PCR and agarose gel electrophoresis identification, a single positive colony was inoculated into 100 mL of LB medium and grown at 37 °C. The protein was expressed inducibly with Auto-induction Medium for 6 h at 37 °C and overnight at 30 ℃, 200 rpm. E. coli BL21 (DE3) was collected by centrifugation at 12,000 rpm for 20 min and ultrasonicated. The supernatant contained soluble protein, and the precipitate contained inclusion body protein. The inclusion body protein was collected by bacterial sonication in a bacterial lysis buffer. The dissolved inclusion body proteins were purified with the HisPur Ni-NTA Purification Kit (88,229, Thermo, Germany). 8% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and WB were used to detect the expression of target proteins. The ZNF24 protein was diluted to 50 µ g/mL with a fixed reagent (10 mM sodium acetate, pH 4.0). Firstly, the surface of the CM5 chip is coated with 400 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) and 100 mM N-Hydroxy succinimide (NHS) at a flow rate of 10 µ L/min for 420 s. Secondly, the ZNF24 protein (50 µg/mL) was added to the experimental channel (Fc2) for flow rate of 10 µ L/min with a fixed amount of approximately 10,000 RU. Finally, the chip was loaded with 1 M ethanolamine at a rate of 10 µ L/min was blocked for 420 s. The reference channel (Fc1) was not injected with ZNF24 protein and other operations were the same as the experimental channel. Daptomycin was diluted 20 times with a dilution reagent to reduce the DMSO content from 100 to 5%. Daptomycin was injected into the experimental and reference channels at a rate of 30 µ L/min with appropriate time for binding and dissociation.

Bioinformatics analysis

The association between the mutation status of the KRAS gene and the infiltration of CD8⁺ T cells was examined using the TIMER database (https://cistrome.shinyapps.io/timer/) [35]. Specifically, it included a total of 164 cases of lung adenocarcinoma tissues with KRAS mutation and 351 cases of lung adenocarcinoma tissues with wild-type KRAS. In addition, the relationship between the expression of PD-L1 and the infiltration of CD8⁺ T cells was also predicted using the TIMER database.

Immunohistochemical (IHC)

Initially, the sections were incubated at a relatively high temperature of 68℃ for a duration of 2 h. Following this, the sections underwent dewaxing using xylene, anhydrous ethanol, a gradient ethanol series, and distilled water. To create a suitable environment for further analysis, the sections were then boiled in an acid buffer with a pH of 6.0 under high temperature and pressure for a duration of 2 min. After ensuring optimal conditions for analysis, the endogenous peroxidase activity in the tissue sections was blocked using a 0.3% hydrogen peroxide solution. To specifically evaluate the expression levels of PD-L1, ZNF24, and SLC7A5 proteins, the tissue sections were first incubated with a normal goat serum containing 5% concentration for 25–30 min. Subsequently, the ZNF24 antibody (11219-1-AP, Proteintech, USA), PD-L1 antibody (ab213524, Abcam, England), and SLC7A5 antibody (28670-1-AP, Proteintech, USA) were diluted at a ratio of 1:200 and allowed to incubate overnight at a temperature of 4℃. Additionally, we conducted immunohistochemistry tests of animal tumor tissues using antibodies specifically targeting CD4 antibody (ab183685, Abcam, England), CD8 antibody (ab217344, Abcam, England), CD34 antibody (L08JU02, ZEN-BIOSCIENCE, China), Ki-67 antibody (ab279653, Abcam, England), PD-1 antibody (ab214421, Abcam, England) and PD-L1 antibody (ab233482, Abcam, England). To detect the presence of the primary antibodies, the sections were further processed by incubating them with HRPlabeled secondary antibody (PV-6000, ZSGB-BIO, China) at a temperature of 37 °C for 1 h. Following this incubation step, the sections were stained with DAB (3,3’-diaminobenzidine) for a duration of 30 to 60 s, allowing the visualization of the target proteins.

RNA extraction and real-time fluorescent quantitative PCR assay (RT-qPCR)

Total RNA was isolated from cells according to the instructions of the RNA extraction kit (LS1040, Promega, Shanghai, China). The quality and concentration of total RNA were checked by using a NanoDrop 2000 spectrophotometer. Next, cDNA was synthesized using a fixed one-step RT-PCR kit (A6120, Promega, Shanghai, China) according to the manufacturer’s instructions. RT‐qPCR experiments were completed using the SYBR Green SuperMix system (Tsingke Bio technology, TSE201, Beijing, China) as follows: 94 ℃ for 10 min, followed by 40 cycles at 94 ℃ for 15 s and 60 ℃ for 1 min. GAPDH was used as a reference gene. The changes in gene level were estimated by the 2^−ΔΔCT method. Finally, the primer sequences used for RT-qPCR were visually presented and listed in Table 1.

Table 1.

The primer sequences for qPCR

Primers for Validated Genes Gene	Prime sequence (5’-3’) Forward Reverse
GAPDH SLC7A5	TATGACAACAGCCTCAAGAT CCTGCCTGTGTTCTTCAT	AGTCCTTCCACGATACCA GCTGAGGATGATGGTGAA
ZNF24	TGGAGCACTAGCTCCAAAGC	CGTCGCCGTCCAGCTCGACCAG
PD-L1	TAAGACCACCACCACCAA	GCTACACCAAGGCATAATAAG

Protein isolation and Western blotting

The total protein was isolated from cells using the protein extraction kit (Solarbio, R0010, Beijing, China). To determine the protein concentration, the BCA protein assay kit (Beyotime, P0010, Shanghai, China) was employed. For the experiment, primary antibodies specifically targeting ZNF24, SLC7A5, β-actin, and PD-L1 were obtained from Proteintech (11219-1-AP, USA, diluted at 1:1000), Santa Cruz (sc-374232, USA, diluted at 1:500), ZSGB-BIO (TA-09, China, diluted at 1:1000), and Abcam (ab82458, England, diluted at 1:1000) respectively. These primary antibodies were then incubated at 4℃ overnight. After the primary antibodies were incubated with the samples, the next step involved diluting the secondary antibodies. Specifically, either goat anti-mouse IgG-HRP or goat anti-rabbit IgG-HRP antibodies (ZSGB-BIO, Zhongshan, China) were mixed in a dilution ratio of 1:10000 and incubated at 37℃ for 1 h. ImageJ software was utilized for quantitative analysis.

Immunofluorescence

To prepare the cell monolayers, every slide was spread with 2 × 10⁵ cells. These slides were then placed in an incubator at 37 ° C for a period of 4–6 h, allowing the cells to adhere and form a monolayer. Following this, the drugs were added according to pre-set groups and continued to cultivate for 24 h. Then, cells were fixed with 4% paraformaldehyde and permeabilized with 0.5% Triton X-100 at room temperature for 30 min. To further prepare the slides for subsequent analyses, they were percolated with a 0.5% Triton X-100 solution for a duration of 15 min. Following the permeabilization step, the slides were blocked using a 5% BSA solution. After blocking, a primary antibody specific to PD-L1 (ab213524, England) was incubated with the cells at a dilution of 1:100. The incubation was carried out overnight at 4 °C to ensure sufficient time for antibody binding. Following the overnight incubation, the slides were washed three times with PBS. To visualize the bound primary antibody, a goat anti-rabbit secondary antibody (ZSGB-BIO, Zhongshan, China) conjugated with a fluorescent marker was added to the slides. The secondary antibody was incubated with the slides for 1 h at 37 °C. Additionally, DAPI, a fluorescent dye that stains DNA, was added to the slides. The final step involved obtaining photographs of the slides using a fluorescence microscope.

Cell counting Kit-8 (CCK-8) assay

Cells (H2122, H2122-shZNF24, H358, H358-shZNF24) were evenly distributed in 96-well plates, with each well containing 4 × 10³ cells. CD8⁺ T cells were added to the plates and allowed to co-culture with the target cells. The cells were subjected to different drug treatments based on their respective conditions. Following this, 10 µL of the CCK-8 solution (CA1210, Solarbio) was added to each well of the experimental plates. The plates were then incubated once again at a temperature of 37 °C, this time for a duration of 1 h. To measure the impact of the drugs and treatment on the cells, we utilized a microplate reader (Model 680, Bio-RAD). The reader was equipped with a 450 nm absorbance filter, which helped in reading and analyzing the values obtained from the experimental wells.

Isolation of CD8⁺ T cells

PBMCs were isolated with Human Peripheral Blood Lymphocyte Isolate (P8610, Solarbio, China). CD8 + T cells were then isolated from the PBMCs using the EasySep™ Direct Human CD8⁺ T cell Isolation kit (19663, StemCell Technologies, Canada). The separation methods were carried out according to the provided instructions. CD8⁺ T cells were cultured in RPMI-1640 medium and activated by Ultra-LEAF™ Purified anti-human T-Activator CD3/CD28 (317325/302933, BioLegend, USA) for 3 days. Then, pre-activated CD8⁺ T cells directly co-cultured with cancer cells.

Co‑culture and lactate dehydrogenase (LDH) cytotoxicity assays

H2122 or H358 cells were seeded into 96-well plates at a concentration of 8 × 10³ per well. After 24 h, activated CD8⁺ T cells were co-cultured with adherent NSCLC cells at a ratio of 3:1 or 5:1 or 10:1 for 48 h. After co-culture, CD8⁺ T cells were harvested with the application of the density separation method. The cytotoxicity of CD8⁺ T cells was detected using the LDH cytotoxicity detection kit (C0017, Beyotime, China). After selecting the optimal ratio of tumor cells and CD8⁺ T cells, the subsequent experiments were conducted by the above method.

Co‑culture and flow cytometry

CD8⁺ T cells of co-cultured supernatant were collected in a 15 ml centrifuge tube, centrifuged at 400 g for 5 min, washed twice with PBS, and resuspended with 100ul Cell Staining Buffer for cell precipitation. Following the standard procedures of flow cytometry, cells were stained with anti-CD3 (317306, Biolegend, USA), anti-PD-1 (379206, Biolegend, USA), anti-PD-L1 (329708, Biolegend, USA) or anti-CD8 (344722, Biolegend, USA). The results were obtained from the Fortessa platform (BD Biosciences) and analyzed using FlowJo software (BD Biosciences).

Co‑culture and enzyme‑linked immunosorbent assay (ELISA)

Tumor cells and CD8⁺ T cells were co-cultured at a ratio of 1:5 for 48 h. Cell culture medium was collected and centrifuged at 500 g 4 °C for 15 min. The top layer was collected, and the levels of interleukin-2 (IL-2, RXSWS106150H, QUANZHOURUIXIN, China), interferon-γ (IFN-γ, RXSWS106205H, QUANZHOURUIXIN, China) and Tumor Necrosis Factor-α (TNF-α, RXSWS8100010H, QUANZHOURUIXIN, China) were measured using a commercial ELISA kit following the manufacturer’s protocol. The OD value of each well was measured at 450 nm via a Microplate Reader (Thermo Fisher Scientific Inc., USA) and calculated at the linear portion of the curve.

Animal experiments

To investigate the effect of KRAS/ZNF24/SLC7A5/PD-L1 axis on the immune function of mice in vivo, we used C57BL/6 mice with normal immune function. Fifteen 6-week-old female C57BL/6 mice (SiBeiFu biotechnology company, Beijing, China) were randomly divided into three groups. These mice were kept under specific pathogen-free (SPF) conditions to ensure their health and wellbeing throughout the experiment. Mice experiments were approved by the Animal Ethics Committee of 920th Hospital of the Joint Logistics Support Force of PLA. To induce tumor growth, we subcutaneously injected cells (2 × 10⁶ at each spot) into the armpits of the mice. Mice were challenged with PBS, DAPT or RGD-KGH-R1-ScFv in the intra-tumoral. Tumor size was measured by caliper every two days. At the end of the experiment, the method of spinal dislocation is used to euthanize mice. The tumor tissues were collected and prepared for further analysis by embedding them in paraffin. The changes of histology were observed by HE staining. Additionally, we conducted immunohistochemistry tests using antibodies specifically targeting CD4 antibody (ab183685, Abcam, England), CD8 antibody (ab217344, Abcam, England), CD34 antibody (L08JU02, ZEN-BIOSCIENCE, China), Ki-67 antibody (ab279653, Abcam, England), PD-1 antibody (ab214421, Abcam, England) and PD-L1 antibody (ab233482, Abcam, England). These antibodies were diluted according to the manufacturer’s instructions and were incubated with the tissue sections overnight at a temperature of 4 ℃. HRP‑labeled secondary antibody (PV-6000, ZSGB-BIO, China) was incubated at 37 °C for 1 h. Finally, the tissue sections were stained with DAB for 30–60 s to visualize the immune-related markers.

Statistical analysis

Data are shown as the mean ± standard deviation. All statistical analyses were performed using SPSS software version 22.0 and graphed with GraphPad Prism 8.0 software. Pearson’s chi-square test was used to analyze the IHC results. Unpaired Student’s t-test was used to compare the means of two groups of data. One-way ANOVA was used to compare multiple groups. The data are expressed as the mean ± SD of three independent experiments. p < 0.05 indicates statistical significance.

Results

KRAS mutation upregulates PD-L1 expression through the ZNF24/SLC7A5 axis in lung adenocarcinoma

To investigate the relationship between ZNF24, SLC7A5, and PD-L1 in lung adenocarcinoma with KRAS mutation, various experiments were conducted. Firstly, several lung adenocarcinoma cell lines with KRAS mutation were compared to KRAS wild-type lung adenocarcinoma cell lines and normal lung epithelial cells. It was found that the expression levels of ZNF24, SLC7A5, and PD-L1 were significantly higher in the lung adenocarcinoma cell lines with KRAS mutation (Fig. 1A, B). Next, lung adenocarcinoma tissue samples with KRAS mutation or KRAS wild-type or normal lung epithelial tissues were subjected to IHC analysis. The IHC H-scores showed that the expression of ZNF24, SLC7A5, and PD-L1 in lung adenocarcinoma tissues with KRAS mutation was significantly higher than in KRAS wild-type lung adenocarcinoma tissues and normal lung epithelial tissues. Furthermore, the levels of the three genes were positively correlated in KRAS-mutant lung adenocarcinoma (Fig. 1C). To further confirm the role of KRAS in regulating the expression of the three genes, KRAS wild-type lung cancer cells (Calu-3) were transfected with overexpression plasmids containing the KRAS G12C mutation. Different methods were used to inhibit KRAS in these cells, and it was observed that the levels of ZNF24, SLC7A5, and PD-L1 were vitally expanded after introducing the KRAS mutation. Conversely, when KRAS was inhibited, the levels of the three genes decreased, which indicated that KRAS mutation induces PD-L1 expression in lung adenocarcinoma (Fig. 1D-E).

Fig. 1.

High expression of ZNF24, SLC7A5 and PD-L1 in NSCLC with KRAS mutation. A-B. The expression of all genes was detected by WB (A) and RT-qPCR (B). The expression of ZNF24, SLC7A5 and PD-L1 in NSCLC cell lines with KRAS mutation (H358^G12C, H2122^G12C, LLC^mut) was significantly higher than that in NSCLC cell lines with KRAS wild-type (Calu-3^wild) and normal lung epithelial cells (Beas2B). C. IHC was used to detect the expression of ZNF24, SLC7A5 and PD-L1 in lung adenocarcinoma (LUAD) tissues. The expression levels of ZNF24, SLC7A5, and PD-L1 were markedly increased in lung adenocarcinoma tissues that had a KRAS mutation compared to those with a normal KRAS gene. Furthermore, the researchers also observed a positive correlation between the expression levels of ZNF24, SLC7A5, and PD-L1. D-E. The overexpression plasmid of KRAS^G12C mutation was transfected into KRAS wild-type lung cancer cell line (Calu-3^wild). The expression of ZNF24, SLC7A5 and PD-L1 was increased after transfection with the KRAS^G12C mutant plasmid by WB (D) and RT-qPCR (E). The increase of genes caused by KRAS^G12C mutation partially reversed by anti-p21Ras-scFv or Sotorasib. The experiments were repeated 3 times. Data are shown as means ± SD. P values were calculated with two-tailed Student’s t-test, *p < 0.05, **p < 0.01, ***p < 0.001. ns, not significant

Then, to verify the hypothesis that KRAS mutation is responsible for regulating the expression of PD-L1 in lung adenocarcinoma through the ZNF24/SLC7A5 axis, a series of experiments were conducted. Initially, two lung adenocarcinoma cell lines (H358 and H2122) known to carry the KRAS mutation were selected. To investigate the role of ZNF24 in this process, ZNF24 knockdown cell lines were generated using shRNA-ZNF24. WB and RT-qPCR techniques were utilized to analyze the levels of ZNF24, SLC7A5, and PD-L1. We found that in the ZNF24 knockdown cell lines, the levels of PD-L1 were significantly decreased (Fig. 2A-F). To further validate the involvement of the ZNF24/SLC7A5 axis in the regulation of PD-L1 expression, an overexpression plasmid containing SLC7A5 was introduced into the ZNF24 knockdown cell lines. The results demonstrated a substantial upregulation in both the protein and mRNA levels of PD-L1 (Fig. 2A-F). Previous studies have shown that in non-small cell lung cancer, KRAS mutation primarily regulated PD-L1 expression through the MEK-ERK pathway [22]. Based on the previous research results of the research group, ZNF24 and SLC7A5 were located downstream of the Ras-MEK-ERK pathway, and ZNF24 could up-regulate the protein translation of SLC7A5 [31]. In conclusion, these findings provided strong evidence for the role of the ZNF24/SLC7A5 axis in KRAS mutation-mediated upregulation of PD-L1 expression in lung adenocarcinoma.

Fig. 2.

The KRAS mutation upregulates PD-L1 expression through the ZNF24/SLC7A5 axis. A-D. WB was used to detect the expression of ZNF24, SLC7A5 and PD-L1 after inhibiting ZNF24 with shRNA in NSCLC cells with KRAS mutation. The protein expression levels of SLC7A5 and PD-L1 were decreased after inhibiting ZNF24. Overexpression of SLC7A5 partially reversed the decrease of PD-L1 caused by shZNF24, but had no effect on ZNF24. E-F. RT-qPCR was used to detect the expression of mRNA. The mRNA of PD-L1 was reduced after shZNF24 treatment. But shZNF24 had no significant effect on the mRNA expression of SLC7A5. Overexpression of SLC7A5 partially reversed the decrease of PD-L1 caused by shZNF24, but had no effect on ZNF24. The experiments were repeated 3 times. Data are shown as means ± SD. P values were calculated with two-tailed Student’s t-test, *p < 0.05, **p < 0.01, ***p < 0.001. ns, not significant

Computer simulation screening of ZNF24 small molecule inhibitors

Our previous research has shown that ZNF24 plays a role in promoting the proliferation of lung adenocarcinoma with KRAS mutation, making it a potential target for tumor treatment [31]. However, there are currently no drugs available that specifically target ZNF24. To address this, we decided to use computer simulation technology to identify a small molecule inhibitor of ZNF24. Molecular docking, a commonly used computational tool, was employed in this study to predict the most stable conformation of the ligand within the active site of a specific target molecule by calculating the Gibbs free energy. To start the research process, we first conducted a screening of the PDB database to identify the crystal structure of ZNF24. Once we had this information, we proceeded to gather all the compounds of the ligand dataset that would be suitable for docking with the ZNF24 receptor. The purpose of this step was to identify potential compounds that could interact with the ZNF24 receptor. After the docking process, we obtained valuable data on the binding energies and the highest LibDock score for each of the docked ligands. Table 2 presents a comprehensive overview of these scores, which serve as indicators of the inhibitory ability of the compounds against the protein. A higher LibDock score suggests a stronger inhibitory effect. Based on this information, we selected the compound with the highest LibDock score for further analysis. In this case, the compound that displayed the highest inhibitory potential was Daptomycin (DAPT). We then proceeded to perform docking simulations and Surface Plasmon Resonance (SPR) experiments using DAPT and ZNF24. Autodock, a popular software tool, was employed for the docking simulation process, which involved visualizing the interaction between DAPT and ZNF24. The successful docking of the two molecules was depicted in Fig. 3A. This confirmed that DAPT had the ability to bind to ZNF24 and potentially exerted an inhibitory effect on its activity.

Table 2.

Binding energies of docked ligands using LibDock

Compounds	Libdock score	Binding Energy(kcal/mol)
Daptomycin	345.013	-727.9749
Exendin-4	313.691	-833.234
Nisin	289.149	-418.254
PKA inhibitor fragment (6–22) amide	246.139	-250.633
SM-164	223.144	-539.264
Methylcobalamin	192.154	-199.945
Leuprolide Acetate	191.067	-290.787
GnRH Associated Peptide	188.175	-217.134
A 779	184.888	-457.959
GHRP-2	183.381	-276.738
ubiquitin specific protease 3 fragment	180.34	-364.018
ABT-263 (Navitoclax)	178.236	-195.646
ZIP (SCRAMBLED)	175.364	-473.797
Octreotide acetate	175.106	-531.017
Endostatin (84–114)-NH2 (JKC367)	170.903	-283.504

Fig. 3.

DAPT can bind and inactivate ZNF24 by Molecular docking and SPR. A. DAPT could bind to ZNF24 through Autodock software. B-C. Affinity determination curve and fitting curve of ZNF24 protein with DAPT (3.906–62.5 µM). DAPT could specifically bind to ZNF24 within the concentration range of 3.906–62.5 µM. DAPT bound to the ZNF24 protein with KD values of 1.48 × 10^− 4 M. D-G. WB demonstrated that DAPT could downregulate the protein expression of SLC7A5 and PD-L1 in NSCLC cells with KRAS mutation compared to DMSO or PBS group. H-I. RT-qPCR displayed that DAPT downregulated the mRNA expression of PD-L1, but had no effect on the mRNA of SLC7A5 in NSCLC cells with KRAS mutation compared to DMSO or PBS group. The experiments were repeated 3 times. Data are shown as means ± SD. P values were calculated with two-tailed Student’s t-test, *p < 0.05, **p < 0.01, ***p < 0.001. ns, not significant

To further investigate the binding relationship between ZNF24 and DAPT, SPR experiments were conducted at ACRO Biosystems Co., Ltd in Beijing, China. Protein expression plasmid was purchased from the Tsingke Biotech Co., Ltd. in Kunming, China. The plasmids were then transferred into BL21 (DE3) receptive cells and evenly coated on LB solid culture medium. Mono-clone was selected for bacterial liquid PCR, and agarose gel electrophoresis was performed to confirm the size of the PCR product in the bacterial solution. The expected DNA size was 1119 base pairs, and the results of the gel electrophoresis were consistent with the expected size (sFig 1 A). The PCR product was sent to Tsingke Biotech Co., Ltd. in Kunming for sequencing, and the results confirmed that the sequence was identical to the constructed plasmid sequence (sFig 1B). Next, Auto-induction Medium was used to induce the expression of proteins. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and WB were performed, revealing that a large quantity of target proteins was expressed in the inclusion bodies after auto-induction (sFig 1 C, D). Next, Auto-induction Medium was used to induce the expression of proteins. SDS-PAGE and WB were performed, revealing that a large quantity of target proteins was expressed in the inclusion bodies after auto-induction. SDS-PAGE analysis showed that the eluent 1 contained a substantial amount of the target protein (sFig 1E). The concentration of the eluted protein in eluent 1 was measured to be 2.4 mg/ml. Subsequently, SPR experiments were conducted at ACRO Biosystems Co., Ltd (Beijing, China) to validate the interaction between DAPT and ZNF24. The SPR data revealed that the ZNF24 protein bound to DAPT with a KD value of 1.48 × 10^− 4 M (steady state affinity) and exhibited a higher binding affinity towards DAPT (3.906–62.5 µM) (Fig. 3B, C). A concentration of 20 µM DAPT was chosen for co-culturing with tumor cells for 48 h, and WB and RT-qPCR analysis showed a significant decrease in the expression of PD-L1 (Fig. 3D-G). RT-qPCR demonstrated that DAPT did not affect the mRNA expression of SLC7A5, which is consistent with the effect of ZNF24 on the expression of SLC7A5 at the translation level (Fig. 3H, I). In conclusion, these findings clearly demonstrated that DAPT could bind to ZNF24 and inactivate its function.

The suppression of KRAS/ZNF24/SLC7A5 axis in tumors cells reduced the PD-L1 expression and affected T-cells activity in vitro co-culture experiments

To estimate the effect of KRAS/ZNF24/SLC7A5/PD-L1 axis on the immunogenicity of tumor cells, the co-culture experiments in vitro were completed. CD8⁺ T cells isolated from healthy blood donors were activated with α-CD3/CD28 beads for three days and then co-cultured with tumor cells. Firstly, the concentration gradient of CD8⁺ T cells designed to co-culture with tumor cells to estimate the lethality of CD8⁺ T cells (1:3, 1:5 and 1:10), and the LDH experiment results showed that 1:5 was the optimal ratio (sFig 2). So, 1:5 was used as the optimal concentration for co-culture. Next, different methods were used to inhibit the expression of KRAS or ZNF24 of tumor cells co-cultured with the CD8⁺ T cells. RGD-KGH-R1-scFv [36] (RGD-scFv) is an antibody developed by our research group in the early stage that targets Ras. Firstly, WB, RT-qPCR, immunefluorescence and flow cytometry experiments were performed to evaluate the effect after inhibiting KRAS or ZNF24 after 48 h of co-culture. Inhibiting KRAS significantly downregulated the expression of ZNF24, SLC7A5 and PD-L1 (Fig. 4A-F). Inhibition of ZNF24 reduced also the expression of SLC7A5 and PD-L1 proteins (Fig. 4A-D). Overexpression of SLC7A5 partially reversed the decrease of PD-L1 expression caused by knocking down ZNF24 (Fig. 4A-G, sFig 3). RT-qPCR results revealed that inhibiting ZNF24 does not affect SLC7A5 mRNA levels, which was consistent with the result of ZNF24 upregulating SLC7A5 expression at the protein level (Fig. 4E, F). Similarly, flow cytometry and immunofluorescence displayed that inhibiting KRAS or ZNF24 reduced the number of PD-L1 positive cells (Fig. 4G, sFig 3). The above results demonstrated that after co-culture of lung adenocarcinoma cells with CD8⁺ T cells, KRAS mutation induces PD-L1 expression through ZNF24/SLC7A5.

Fig. 4.

Inhibition of KRAS/ZNF24/SLC7A5 axis of tumor cells by co-culturing with CD8⁺ T cells can reduce PD-L1 expression. A-D. WB showed that inhibiting KRAS or ZNF24 of tumor cells by co-culturing with CD8⁺ T cells reduced the protein expression of PD-L1, and overexpression of SLC7A5 partially reversed the downregulation of PD-L1 caused by inhibiting ZNF24. E-F. RT-qPCR demonstrated that inhibiting KRAS or ZNF24 of tumor cells by co-culturing with CD8⁺ T cells decreased the mRNA levels of PD-L1, and overexpression of SLC7A5 partially reversed the mRNA downregulation of PD-L1 caused by inhibiting ZNF24. G. Immunofluorescence showed that inhibition of KRAS or ZNF24 of tumor cells by co-culturing with CD8⁺ T cells resulted in a decrease in the number of PD-L1 positive cells. Overexpression of SLC7A5 can partially reverse the number downregulation of PD-L1 positive cells caused by inhibition of ZNF24. The experiments were repeated 3 times. Data are shown as means ± SD. P values were calculated with two-tailed Student’s t-test, *p < 0.05, **p < 0.01, ***p < 0.001. ns, not significant

Next, we further tested the effect of inhibiting KRAS/ZNF24/SLC7A5 axis on the number of activated CD8⁺ T cells. The LDH assay results showed that inhibiting KRAS or ZNF24 could increase the cytotoxicity of CD8⁺ T cells (Fig. 5A, B). The CCK-8 experiment results displayed that inhibition of KRAS or ZNF24 resulted in a decrease in tumor cells proliferation (Fig. 5C-D). But these effects caused by inhibiting ZNF24 were partially reversed after overexpression of SLC7A5 (Fig. 5A-D). Then, bioinformatics analysis showed that the number of infiltrating CD8⁺ T cells in lung adenocarcinoma with KRAS mutation was lower than that in KRAS wild-type lung adenocarcinoma (sFig 4 A). The expression of PD-L1 was negatively correlated with the number of infiltrating CD8⁺ T cells (sFig 4B). Flow cytometry was used to detect the proportion of activated CD8⁺ T cells, and the results also exhibited that inhibiting KRAS or ZNF24 increased the proportion of activated CD8⁺ T cells (Fig. 5E). But shZNF24 + oveSLC7A5 group, the proportion of activated CD8⁺ T cells was decreased compared with the shZNF24 group (Fig. 5E).

Fig. 5.

Inhibiting the KRAS/ZNF24/SLC7A5 axis of tumor cells can increase the number and activity of CD8⁺ T cells in vitro. A-B. LDH experiments were utilized to evaluate the activity of CD8⁺ T cells. Inhibiting KRAS or ZNF24 could increase the activity of CD8⁺ T cells, which partially was reversed by over-expression of SLC7A5. C-D. The proliferation ability of tumor cells was tested through CCK-8. Inhibiting KRAS or ZNF24 reduced the proliferation ability of tumor cells. However, the proliferation ability of tumor cells in the shZNF24 + oveSLC7A5 group was increased respectively, compared to the ZNF24 group. E. The proportion of CD8⁺ T cells was evaluated by flow cytometry. The number of CD8⁺ T cells was increased by repressing KRAS or ZNF24 of tumor cells, which was partially reversed by over-expression of SLC7A5. F. The proportion of CD8⁺PD-1⁺ T cells was evaluated by flow cytometry. The number of CD8⁺PD-1⁺ T cells was decreased by repressing KRAS or ZNF24 of tumor cells, which was partially reversed by over-expression of SLC7A5. The experiments were repeated 3 times. Data are shown as means ± SD. P values were calculated with two-tailed Student’s t-test, *p < 0.05, **p < 0.01, ***p < 0.001. ns, not significant

To evaluate the relationship between KRAS/ZNF24/SLC7A5/PD-L1 axis and CD8⁺ T cell depletion, relevant experiments were conducted. The number of CD8⁺PD-1⁺ cells was decreased in inhibiting KRAS or ZNF24 groups. In shZNF24 + oveSLC7A5 group, the proportion of CD8⁺PD-1⁺ cells were increased compared with the shZNF24 group (Fig. 5F). Simultaneously the supernatant of co-cultured cells was collected from each group, and texted the concentration IL-2, IFN-γ and TNF-α secreted by CD8⁺ T cells in the supernatant using ELISA kit. ELISA assay exhibited that inhibition of KRAS or ZNF24 contributed to the elevate of IL-2, IFN-γ and TNF-α (sFig 4 C).

The suppression of KRAS/ZNF24/SLC7A5/PD-L1 axis in tumor cells decelerates tumor progression and increases the number of intra-tumoral antitumor CD8⁺ T cells in vivo

To evaluate the effect KRAS/ZNF24/SLC7A5/PD-L1 axis on the tumorigenesis and immunogenicity of lung adenocarcinoma in vivo, a C57BL/J mouse xenograft assay was performed using the Lewis cells (LLC). Mice were randomly divided into three groups, PBS, RGD-KGH-R1-scFv [36] (30 mg/kg) and DAPT (2.5 mg/kg) (Fig. 6A). The results showed that the tumor formation speed of Lewis cells after KRAS or ZNF24 inhibited was significantly slower than that of the PBS group, and the final volume and weight of tumors in the DAPT and RGD-KGH-R1-scFv group were also significantly smaller and lower than those in the PBS group (p < 0.05; Fig. 6B-D). The analysis of HE staining revealed that massive necrosis of tumor cells in PBS group. In contrast, the focal necrosis of tumor cells was observed in the other two groups. The nuclear mitosis was increased in PBS group compared to the other two groups (Fig. 6E-F). The excessive necrosis indicates rapid growth of tumor cells and ischemic necrosis of tumor cells. The excessive necrosis is often associated with tumor hypoxia and acidosis, possibly by recruiting myeloid derived suppressor cells (MDSCs) and tumor associated macrophages (TAMs) to form an immunosuppressive microenvironment. The morphological characteristics of focal necrosis suggest that it may be related to immune activation. Similar research reports suggest that this type of necrosis may be driven by necroptosis, by releasing DAMPs molecules such as HMGB1 and ATP, recruiting CD8⁺ T cells and dendritic cells, and transforming cold tumors into immune infiltrating hot tumors. CD34 and ki-67 were also tested. The inhibition of KRAS or ZNF24 decreased the expression of ki-67 and CD34 in transplanted tumors (Fig. 6G-H).

Fig. 6.

Inhibiting the KRAS/ZNF24/SLC7A5 axis can inhibit the growth of transplanted tumors and promote tumor cells apoptosis. A. The model of C57BL/6 mouse transplantation tumor was established by using LLC cells. B-D. Compared with the PBS group, inhibiting KRAS (by RGD-KGH-R1-scFv) or ZNF24 (by DAPT) repressed the growth of transplanted tumors, and the final tumor weight was also significantly lower than that of the PBS group. E-F. Histological morphology was observed via HE. Spotty necrosis was seen in inhibiting KRAS or ZNF24 group. But in the PBS group, extensive necrosis was observed (Bottom right corner). The mitotic figures in the PBS group were significantly higher than those in inhibiting KRAS or ZNF24 group. G-H. IHC was used to detect the number of Ki-67⁺ and CD34⁺ cells. The results showed that the number of positive cells in the KRAS or ZNF24 inhibition group was significantly lower than that in the PBS. The experiments were repeated 3 times. Data are shown as means ± SD. P values were calculated with two-tailed Student’s t-test, *p < 0.05, **p < 0.01, ***p < 0.001. ns, not significant

To investigate the effect of KRAS/ZNF24/SLC7A5/PD-L1 axis on tumor immunogenicity in vivo experiments, the number of CD8⁺ T cells and relevant indicators were detected in the above-mentioned mouse models by immunohistochemistry. A significantly increased in tumor-infiltrating CD8⁺ T cells was found in the group in which KRAS or ZNF24 was inhibited, compared with the PBS group (Fig. 7). By contrast, tumors carrying cells with the suppression of KRAS or ZNF24 reduced the expression of PD-1 and PD-L1 (Fig. 7). Taken Together, the results demonstrated that KRAS mutation contributed to impacting tumor immunogenicity partly by impairing the number of tumor-infiltrating CD8⁺ T cells through the ZNF24/SLC7A5/PD-L1 axis in vivo.

Fig. 7.

Inhibiting the KRAS/ZNF24/SLC7A5 axis can increase the number of CD8 positive cells and reduce the number of PD-L1 positive tumor cells. IHC was used to detect the relative markers of immune escape. The number of PD-L1⁺ and PD-1⁺ cells in inhibiting KRAS or ZNF24 group was smaller than the PBS group. Inhibiting KRAS or ZNF24 group has more CD8⁺ T cells than PBS group. However, the number of CD4⁺ cells was no significant difference between the three group. At the same time, the expression of CD34 and Ki-67 was lower in the DAPT and RGD-KGH-R1-scFv group compared to the PBS group. The experiments were repeated 3 times. Data are shown as means ± SD. P values were calculated with two-tailed Student’s t-test, *p < 0.05, **p < 0.01, ***p < 0.001. ns, not significant.

Discussion

In previous research, we have identified ZNF24 and SLC7A5 as key players in the progression of lung adenocarcinoma with KRAS mutation [31]. Yet, whether they are involved in immune escape in lung adenocarcinoma with KRAS mutation are still unclear. Through this study, we have provided evidence that KRAS mutation contributes to the immune escape of lung adenocarcinoma via the two newly implicated genes. Mechanistically, our data suggest that KRAS mutation increased PD-L1 levels through the ZNF24/SLC7A5 pathway, thereby inhibiting the activation of CD8⁺ T cells. Additionally, we employed computer simulations to identify small molecule inhibitors specifically targeting ZNF24. The inhibitor held the potential to selectively interfere with the activity of ZNF24 and enhance the activity of CD8⁺ T cells against KRAS-mutant tumor cells, offering a novel therapeutic approach in combination with immunotherapy for KRAS mutant tumors. Significantly, to the best of our knowledge, this is the first report identifying this specific signaling pathway as a crucial regulator of immune escape mediated by PD-L1 levels in lung adenocarcinoma.

First identified in 1998 [37], ZNF24 has since been recognized as a crucial regulator of organ development. Disruptions of ZNF24 in experimental models result in early mortality at varying developmental stages, underlining its importance [38]. However, recent studies have revealed diverse roles for ZNF24 as a transcription factor across different cancer types. In liver cancer, ZNF24 reportedly binds directly to the CTNNB1 promoter, activating β-catenin cyclin D1 expression and subsequently promoting liver cancer cell proliferation [39]. In prostate cancer, upregulated ZNF24 has been associated with the facilitation of epithelial-to-mesenchymal transition via Twist1 [40]. Conversely, microRNA-940 has been observed to inhibit ZNF24 expression in gastric cancer, correlating with enhanced malignant cell proliferation [41]. Our earlier work demonstrated that ZNF24 promotes tumor progression by enhancing the translation of SLC7A5 in lung adenocarcinoma-carrying KRAS mutation [31]. Expanding on these findings, the present investigation pioneers the discovery of ZNF24’s capability to augment PD-L1 expression, thereby enabling an immune-evasive environment within the tumor.

PD-L1 is expressed on the surface of tumor cells and stromal immune cells, allowing tumors to evade the cytotoxic effects of infiltrating T cells [42]. Although numerous studies have demonstrated high PD-L1 expression in non-small cell lung cancer with KRAS mutations, the specific molecular mechanisms by which KRAS mutations regulate PD-L1 expression remain unclear. This study confirmed through extensive experiments that KRAS mutation induces PD-L1 expression through ZNF24/SLC7A5 in lung adenocarcinoma (Fig. 2). In recent years, studies have shown that [43] SLC7A5 and PD-L1 are highly expressed and positively correlated in breast cancer, which is consistent with the results of this study. In addition, previous studies have shown that KRAS mutation mainly regulate PD-L1 expression through the MEK-ERK pathway in non-small cell lung cancer [22]. Our previous studies have demonstrated that ZNF24 and SLC7A5 are located downstream of the KRAS-MEK-ERK pathway. Therefore, our research results further elucidate the specific mechanism by which the KRAS-MEK-ERK pathway regulates PD-L1 expression, and for the first time, identify the regulatory relationship between the KRAS-MEK-ERK-ZNF24-SLC7A5-PD-L1 signaling axis. But there is one study worth noting, which suggests that high expression of PD-L1 in KRAS-mutant non-small cell lung cancer is caused by smoking [21]. Regarding this research finding, possible explanations could be attributed to poor specificity and sensitivity of the immunohistochemical antibody used for detecting PD-L1 expression eight years ago, or it could be due to a small sample size leading to errors.

CD8⁺ T cells play a critical role in anti-tumor immune response. An abundance of evidence underscores the role of CD8⁺ tumor-infiltrating lymphocytes (TILs) as indicators of an anti-tumor immune response [44, 45]. A negative correlation was observed between PD-L1 expression and the number of infiltrating CD8⁺ T cells in lung adenocarcinoma through bioinformatics analysis. Our also demonstrated that inhibiting KRAS/ZNF24/SLC7A5 axis encourages the activation of CD8⁺ T cells by downregulating PD-L1 level in vitro experiments. Miliotis C al. [18] also found that the expression of PD-L1 inhibited the activation of CD8⁺ T cells. In vivo evaluation using immune-functional C57BL/6 mice echoed the in vitro conclusions. It is well-documented that CD8⁺ T cells, a type of immune cell, can become exhausted following incessant stimulation by chronic inflammation or tumor antigens. This exhaustion manifests as diminished proliferative capacity, increased apoptotic propensity, and compromised ability to secrete effector cytokines (IL-2, IFN-γ, TNF-α), all of which compromise their immune response [46]. In this study, ELISA experiments demonstrated that inhibiting KRAS/ZNF24/SLC7A5 axis could increase the level of IL-2, IFN-γ, and TNF-α in the co-cultured supernatants (sFig 3 C).

SLC7A5, an amino acid transporter protein, has been associated with aberrant nutritional metabolism and exhibits elevated expression in cancerous tissue compared to normal tissue. This heightened expression has been positively correlated with tumoral growth and proliferation, rendering SLC7A5 an independent prognostic factor [47]. In addition, SLC7A5 has been found to facilitate tumor cells in sequestering nutrients from the microenvironment, thus endowing them with enhanced growth and proliferation capabilities. At the same time, the accelerated growth and exceptional nutrient uptake of tumor cells transform the tumor microenvironment into an acidic, hypoxic, and nutrient-deficient area. This transformation impairs CD8⁺ T cells that also rely on these environmental nutrients, thereby disabling their tumor cell-killing ability [48]. Our research further noted elevated SLC7A5 expression in lung adenocarcinoma with KRAS mutation [31]. Overexpression of SLC7A5 inhibits CD8⁺ T cell activation, leading to their inactivation. Therefore, the heightened SLC7A5 expression in lung adenocarcinoma with KRAS mutation may contribute to the reduction of activated CD8⁺ T cells and aid tumor cells in monopolizing amino acids, culminating in tumor cell immune evasion. Nevertheless, the role of SLC7A5 in the immune escape of lung adenocarcinoma with KRAS mutation necessitates further experimental clarification. Concurrently, other research has shown that the cytotoxic ability of exhausted CD8⁺ T cells is weakened or lost, and this condition is associated with elevated expression of inhibitory molecules such as PD-1, TIM3, LAG3, and CTLA4 [49]. Our results substantiate that the inhibition of the KRAS/ZNF24/SCL7A5 axis decreases the number of CD8⁺PD-1⁺ T cells (Figs. 5H and 7) and heightens the tumor cell-killing capability of CD8⁺ T cells (Fig. 5A, B). Substantially, this study unveils that inhibiting the KRAS/ZNF24/SLC7A5 axis could augment the number of activated CD8⁺ T cells by diminishing PD-L1 expression. However, the synergistic effects of KRAS/ZNF24/SLC7A5 axis inhibition and PD-L1 blockade warrant further investigation to ascertain whether the former increases the sensitivity to immunotherapy. We utilized computer simulation to screen the small molecule inhibitor DAPT targeting ZNF24. Our results confirmed that DAPT could inhibit the immune escape of lung adenocarcinoma with KRAS mutation by decreasing PD-L1 expression (Figs. 3, 5 and 7). This open-up the possibility of improving the prognosis of lung adenocarcinoma patients with KRAS mutation through administering DAPT or RGD-KGH-R1-scFv in conjunction with immunotherapy in the future. However, validating this proposition necessitates further clinical trials to establish efficacy. While this study has validated one small molecule inhibitor of ZNF24, it is essential to conduct additional comparative studies on ZNF24’s small molecule inhibitors. The extensive use of ZNF24 small molecule inhibitors still requires identification of their toxicity and effectiveness. Such investigations will enable the selection of an inhibitor exhibiting the most potent inhibitory effect.

Conclusions

In conclusion, our findings illustrate that KRAS mutation instigates tumor immune evasion by obstructing the activation of CD8⁺ T cells through the ZNF24/SLC7A5/PD-L1 axis (Fig. 8). Additionally, our study uncovers the potential therapeutic utility of ZNF24 inhibitors, such as DAPT, in mitigating immune escape in lung adenocarcinoma with KRAS mutation. A synergistic approach combining ZNF24 inhibitors with immunotherapy may present a novel therapeutic strategy for RAS-driven tumors.

Fig. 8.

Schematic diagram of the mechanism in KRAS mutation promoted immune escape of lung adenocarcinoma via ZNF24/SLC7A5/PD-L1 axis. KRAS mutation upregulated PD-L1 expression through the MEK/ERK/ZNF24/SLC7A5 pathway. ZNF24 could upregulate the level of PD-L1 through SLC7A5. ZNF24 and SLC7A5 promoted PD-L1 expression in the form of protein complexes. DAPT and RGD-KGH-R1-scFv reduced PD-L1 expression induced by KRAS mutation and reprogram immunosuppressive tumor microenvironment to enhance CD8⁺ T cell activity through inhibiting ZNF24 or KRAS respectively

Electronic supplementary material

Below is the link to the electronic supplementary material.

Abbreviations

SLC7A5

solute carrier family 7 member 5

RT‒qPCR

quantitative reverse transcription-polymerase chain reaction

WB

Western blot

SDS‒PAGE

sodium dodecyl sulfate‒polyacrylamide gel electrophoresis

CCK-8

Cell Counting Kit-8

IHC

immunohistochemistry

Author contributions

The concept and design of this study were provided by Junlun Yang, Leilei Li. Leilei Li and Ya Jiang conducted the research and data analysis. The collected experimental data were completed by Xinyan Pan and Qiang Feng. HE and IHC analyzed by Hong Fang and Lilin Yang. Pathologic diagnosis was conducted by Wenmang Xu and Yuanyuan Wang. Leilei Li made the manuscript. Julun Yang and Leilei Li conducted the data review and manuscript review. All authors read and approved the final version of the manuscript.

Funding

Yunnan Province Applied Basic Research Program Kunming Medical University Joint Project (202301AY070001-021), Yunnan Province Applied Basic Research Program Kunming Medical University Joint Project (202301AY070001-244), the Scientific Research Fund of Education Department of Yunnan Province (2023Y0791) and Yunnan Provincial Health Commission High Level Talent Subsidy Project in 2023 (2023-KHRCBZ-A03).

Data availability

The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

This study was supported by the Ethics Committee of the 920th Hospital of the Joint Logistic Support Force of the People’s Liberation Army, with approval number 2023-022-01. Specimens were handled in accordance with legal and ethical regulations.

Consent for publication

All authors read and approved the final manuscript for publication.

Competing interests

The authors declare no competing interests.