Abstract
Researchers commonly use cyclization recombination enzyme/locus of X-over P1 (Cre/loxP) technology-based conditional gene knockouts of model mice to investigate the functional roles of genes of interest in Sertoli and Leydig cells within the testis. However, the shortcomings of these genetic tools include high costs, lengthy experimental periods, and limited accessibility for researchers. Therefore, exploring alternative gene silencing techniques is of great practical value. In this study, we employed adeno-associated virus (AAV) as a vector for gene silencing in Sertoli and Leydig cells. Our findings demonstrated that AAV serotypes 1, 8, and 9 exhibited high infection efficiency in both types of testis cells. Importantly, we discovered that all three AAV serotypes exhibited exquisite specificity in targeting Sertoli cells via tubular injection while demonstrating remarkable selectivity in targeting Leydig cells via interstitial injection. We achieved cell-specific knockouts of the steroidogenic acute regulatory (Star) and luteinizing hormone/human chorionic gonadotropin receptor (Lhcgr) genes in Leydig cells, but not in Sertoli cells, using AAV9-single guide RNA (sgRNA)-mediated gene editing in Rosa26-LSL-Cas9 mice. Knockdown of androgen receptor (Ar) gene expression in Sertoli cells of wild-type mice was achieved via tubular injection of AAV9-short hairpin RNA (shRNA)-mediated targeting. Our findings offer technical approaches for investigating gene function in Sertoli and Leydig cells through AAV9-mediated gene silencing.
Keywords: adeno-associated virus, gene editing, gene silencing, Leydig cell, Sertoli cell
INTRODUCTION
Somatic cells of the testis, including Sertoli and Leydig cells, establish the microenvironment or niche of the testis, which plays a crucial role in regulating normal spermatogenesis.1,2,3 Sertoli cells, as the only somatic cells within the seminiferous tubules, are pivotal in establishing direct contact with and exerting control over the microenvironment within these tubules,4,5 facilitating spermatogenesis. Leydig cells, which serve as the primary site for androgen (mainly testosterone) synthesis and secretion in the testicular interstitial tissue, play an indispensable role in supporting sperm production and maturation.6,7 Recently, investigations into the functional genes of Sertoli8,9,10,11 and Leydig cells11,12,13 have emerged as a prominent focus within the area of male reproductive research. The Cre/loxP system-based technology for generating conditional gene knockouts is a widely employed approach for investigating the roles of specific genes in male reproductive cells,14 enabling the cell-specific investigation of genes of interest, specifically targeting Sertoli and Leydig cells.15,16,17 However, generating gene knockouts via the Cre/loxP system usually involves two strains of mice, requiring a long breeding cycle and high costs.18 Hence, there is a value in developing cost-efficient approaches for gene silencing that specifically target Sertoli and Leydig cells.
Adeno-associated virus (AAV) is a small, nonenveloped virus that belongs to family Parvoviridae and genus Dependoparvovirus.19 Because of its excellent safety record and high efficiency, AAV has gained recognition as a leading vector for gene delivery in both basic research and therapeutic applications.20 AAV-mediated gene silencing approaches, including clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9)-mediated gene editing and short hairpin RNA (shRNA) interference, have been widely applied in the nervous system21,22 and many organs, including the liver23,24 and eyes.25 In recent years, emerging studies have begun to apply AAV in testicular research.12,26,27 A previous study showed that AAVs could infect various cell types, including spermatogonial cells and Sertoli cells, through seminiferous tubule delivery.28 The achievement of AAV-mediated gene overexpression in Leydig cells was reported in two recent studies, one exploring a gene therapy and another investigating a molecular mechanism.12,29 However, AAV-mediated gene silencing in Sertoli and Leydig cells has rarely been reported.
To assess the efficacy of AAV-mediated gene silencing in Sertoli and Leydig cells, we chose steroidogenic acute regulatory (Star) and luteinizing hormone/human chorionic gonadotropin receptor (Lhcgr) as target genes in Leydig cells and androgen receptor (Ar) as a target gene in Sertoli cells. The StAR protein encoded by Star controls the initial and rate-limiting step of steroidogenesis: the transport of cholesterol from the outer to the inner mitochondrial membrane.30,31 Mutation of Star causes a disorder of spermatogenesis that results in male infertility.32,33 LHCGR is required for the maturation of Leydig cells and the synthesis of testosterone, promotes sexual development and spermatogenesis, and plays a central role in maintaining male reproductive function.34 Mutations in Lhcgr in rodents result in significantly reduced testosterone levels, stunted sexual development, defective spermatogenesis, and infertility.35,36 In mice with Lhcgr deficiencies, overexpression of Lhcgr via AAV-mediated gene manipulation restored Leydig cell function and normalized testosterone levels, leading to the generation of healthy offspring.12 Androgen and the AR play important roles in male spermatogenesis and fertility.37 It has been discovered that the development of germ cells in male mice with complete knockout of Ar is severely impaired.37 In mice with a conditional knockout of Ar in Sertoli cells generated using the Cre/loxP system, the testicles underwent significant atrophy, the mice were infertile, and few sperm were detected in the epididymis.38 Therefore, we used AAV-mediated gene silencing of these three genes to examine the development of spermatogenic dysgenesis phenotypes in mice.
In this study, we observed that AAV serotypes 1, 8, and 9 exhibited strong affinities for the infection of testicular cells. We achieved high-efficiency knockout of the Star and Lhcgr genes in Leydig cells via the interstitial injection of AAV9-single guide RNA (sgRNA) in Rosa26-LoxP-Stop-LoxP (LSL)-Cas9 mice, as well as knockdown of Ar gene expression in Sertoli cells via the tubular injection of AAV9-shRNA (Supplementary Figure 1 (166.1KB, tif) ). Taken together, our findings represent a novel approach using AAVs to investigate the functional role of specific genes in Sertoli and Leydig cells.
MATERIALS AND METHODS
Animals
Wild-type C57BL/6J male mice (age: 3–4 weeks) were obtained from the Animal Research Center at Nanjing Medical University (Nanjing, China) and housed in a specific pathogen-free (SPF) facility. The Rosa26-LSL-Cas9 strain (JAX stock #026481; The Jackson Laboratory, Bar Harbor, ME, USA) features Cre recombinase-dependent expression of CRISPR/Cas9 endonuclease and enhanced green fluorescent protein (EGFP). When utilized in combination with sgRNAs and a Cre source, they allow editing of single or multiple mouse genes in vivo or ex vivo. The mice were provided with sufficient food and water, and efforts were made to minimize any discomfort. All animal care and treatment procedures adhered to the protocols approved by the ethical committee of Nanjing Medical University (Approval No. IACUC-2205024).
Design of sgRNAs and shRNAs
The sgRNAs were designed using CRISPOR (http://crispor.gi.ucsc.edu/),39 as shown in Supplementary Table 1. The sgRNAs were constructed into the lentiviral vector lentiCRISPR version 2 (plasmid #52961; Addgene, Watertown, MA, USA). The sgRNA with the highest editing efficiency was selected and cloned into the following AAV backbone vectors: pAAV-CMV-mCherry-U6-sgRNA (plasmid #P1051; Miaoling, Wuhan, China), pAAV-CMV-SaCas9-HA-U6-sgRNA (plasmid #61591; Addgene), and pAAV-U6-sgRNA-Cre-HA (plasmid #60229; Addgene). The shRNAs were designed using BLOCK-iT™ Designer (https://rnaidesigner.thermofisher.com/rnaiexpress/), as shown in Supplementary Table 1. Each shRNA was cloned into the lentiviral vector pLKO.1-mcherry-puro (plasmid #P10494; Miaoling). The shRNA with the highest silencing efficiency was selected and cloned into an AAV vector that we engineered to carry a nuclear localization signal for precise tagging of the reporter protein tdTomato (pAAV-H1-shRLuc-CMV-NLS-tdTomato).
Supplementary Table 1.
Sequences of single-guide RNAs and short hairpin RNAs used in the study
| Gene | sgRNAs/shRNAs | Sense primers (5’–3’) | Antisense primers (5’–3’) |
|---|---|---|---|
| Star | sgRNA-1 | CACACAGCTTGAACGTAGCG | CGCTACGTTCAAGCTGTGTG |
| sgRNA-2 | CATATTCCGCATATGTCTAT | ATAGACATATGCGGAATATG | |
| sgRNA-3 | GGATGGGTCAAGTTCGACGT | ACGTCGAACTTGACCCATCC | |
| sgRNA-4 | AGCAACACTCTATAGTGACC | GGTCACTATAGAGTGTTGCT | |
| sgRNA-5 | CTTGGGCATACTCAACAACC | GGTTGTTGAGTATGCCCAAG | |
| Lhcgr | sgRNA-1 | CCATCCGGCGCGCAGTCGCA | TGCGACTGCGCGCCGGATGG |
| sgRNA-2 | TGAGCCCTGCGACTGCGCGC | GCGCGCAGTCGCAGGGCTCA | |
| sgRNA-3 | GTCGGGCGAGGCCAGCTCGA | TCGAGCTGGCCTCGCCCGAC | |
| sgRNA-4 | GCGTCGTCCCATTGAATGCA | TGCATTCAATGGGACGACGC | |
| sgRNA-5 | GCACCTTCCAGGGGGCCACG | CGTGGCCCCCTGGAAGGTGC | |
| Ar | shRNA-1 | GCAGAAACGATTGTACCATTG | CAATGGTACAATCGTTTCTGC |
| shRNA-2 | GCTGAAGAAGGCCAATTATAT | ATATAATTGGCCTTCTTCAGC | |
| shRNA-3 | GGTCCTTCACTAATGTCAACT | AGTTGACATTAGTGAAGGACC |
Lhcgr: luteinizing hormone/human chorionic gonadotropin receptor; Star: steroidogenic acute regulatory; Ar: androgen receptor; sgRNA: single guide RNA; shRNA: short hairpin RNA
Lentivirus production and infection
HEK-293FT cells (BNCC342056; BNCC, Beijing, China) were transfected with lentiviral backbone and packaging vectors, including pRSV-Rev (plasmid #12253; Addgene), pVSVG (plasmid #8454; Addgene), and pMDL (plasmid #12251; Addgene). After 8 h, the culture medium was replaced with fresh medium and maintained for another 24 h, and the supernatant containing lentivirus particles were harvested and stored at 4°C.
For cell infection, supernatants containing lentiviral particles carrying sgRNAs and shRNAs were added to TM3 cells (CC9048; Cellcook, Guangzhou, China) and TM4 cells (CC9071; Cellcook), respectively, and incubated for 24 h. The medium was replaced with fresh medium, and the cells were cultured for another 48 h. Afterward, cells were selected using puromycin (2 µg ml−1 for TM3 and 4 µg ml−1 for TM4; P012; MDbio, Qingdao, China).
T7 endonuclease I (T7EI) assay
The T7EI assay was used to test the efficiency of gene editing. Briefly, the genomic sequences flanking the sgRNA target sites were amplified by polymerase chain reaction (PCR) with Q5 High-fidelity DNA Polymerase (M0491V; NEB, Ipswich, MA, USA). The PCR fragments were purified and incubated with T7 endonuclease I (M0302S; NEB) at 37°C for 15 min, followed by gel electrophoresis on a 1.5% agarose gel. Editing efficiency was calculated using the following formula: editing efficiency = 100% × (1 − [1 − percentage of cleavage product]1/2).
Quantitative real-time PCR assay (qPCR)
Total RNA was extracted using TRIzol reagent (9109; Takara, Tokyo, Japan). A total of 1000 ng of RNA was converted into cDNA using HiScript III RT SuperMix for qPCR (R323; Vazyme, Nanjing, China). The qPCR was performed with ChamQ SYBR qPCR Master Mix Reagent (Q331; Vazyme). The relative expression of Ar gene amplified using the primer sequences (Supplementary Table 2) was calculated and normalized to β-actin. The knockdown efficiency of shRNA was calculated using qPCR.
Supplementary Table 2.
Primers sequences used in quantitative real-time polymerase chain reaction reactions
| Gene | Forward primers (5’–3’) | Reverse primers (5’–3’) |
|---|---|---|
| Ar | CTGGGAAGGGTCTACCCAC | GGTGCTATGTTAGCGGCCTC |
| β-actin | TTCGCGGGCGACGAT | CATCTTTTCACGGTTGGCCT |
Ar: androgen receptor
Packaging of AAVs
For packaging of AAVs, AAV-293 cells (CBP60863; Cobioer Biosciences, Nanjing, China) were transfected with AAV helper plasmid pAdDeltaF6 (plasmid #112867; Addgene), an AAV packaging plasmid (Supplementary Table 3), and AAV backbone plasmid (the vector carrying sgRNAs or shRNAs) using polyethylenimine reagent (23966-1; Polysciences, Warrington, PA, USA) for 10 h, after which the medium was replaced with fresh culture medium. At 72 h post-transfection, viral particles from transfected cells and supernatant were harvested. After freeze-thawing, AAVs were purified and concentrated by iodixanol density-gradient ultracentrifugation. AAV titers were determined using qPCR. Concentrated AAVs were diluted with phosphate-buffered saline (PBS) to 1013 vg ml−1 for in vivo experiments. Viral aliquots were stored at −80°C before stereotaxic injection.
Supplementary Table 3.
Adenovirus-associated virus packaging plasmids used in the study
| Serotypes | Plasmid number | Company |
|---|---|---|
| AAV1 | P13638 | Miaoling, Wuhan, China |
| AAV2 | P12264 | Miaoling, Wuhan, China |
| AAV5 | P13488 | Miaoling, Wuhan, China |
| AAV8 | P13271 | Miaoling, Wuhan, China |
| AAV9 | 112865 | Addgene, Watertown, MA, USA |
| AAV BI30 | 183749 | Addgene, Watertown, MA, USA |
AAV: adenovirus-associated virus
Local testicular injection of AAV
Mice were anesthetized by intraperitoneal injection of 1.25% avertin and then bound to an operating plate. A 5 μl aliquot of AAV-shRNA or AAV-sgRNA virus (titer: 1013 vg ml−1) was administered to the testis of mice (age: 3–4 weeks) via either tubular injection or interstitial injection using a stereoscopic microscope.
For tubular injection, the AAV was injected into the testicular reticulum with a thin glass needle inserted along the efferent duct. For interstitial injection, the AAV was administered via a fine glass syringe needle into the interstitial tissue of the testis. Post-injection, the mice were placed in an incubator at 37°C until they reached full wakefulness and returned to normal. After 8 weeks of AAV injection, the efficiency of gene silencing and the quality of sperm were measured.
Brain stereotactic injection of AAV
After identifying the brain injection coordinates (anterior-posterior [AP], −1.50 mm; dorsal-ventral [DV], −5.80 mm; and left-right [LR], ±0.30 mm), 8-week-old male mice were anesthetized with isoflurane and secured on a stereotaxic frame (R510-22; RWD Life Science, Shenzhen, China). The head was carefully fixed in the holder, and a small incision was made to expose the skull. An injection needle was then inserted into the brain at the designated coordinates. The AAV was delivered using a microsyringe pump, and the needle was left in place for 10 min after the injection to ensure proper diffusion before being slowly withdrawn. The scalp was sutured, and the mice were placed in a 37°C incubator and allowed to fully recover before being returned to their normal environment.
Isolation, culture, and identification of Leydig cells
After 8 weeks of interstitial injection with AAV-sgStar and AAV-sgLhcgr, Leydig cells were isolated from the mouse testis and subjected to the T7EI assay to determine the in vivo editing efficiency of Star and Lhcgr. Briefly, both testicles were removed from the body and washed twice in precooled Dulbecco’s modified Eagle’s medium (DMEM)/F12 (C11330500bt; Gibco, Grand Island, NY, USA) before peeling away the white connective tissue membrane. A 10 ml volume of a mixed enzyme solution (0.5 mg ml−1 collagenase and 0.1 mg ml−1 DNase I dissolved in DMEM/F12, pH 7.4) was added, and the mixture was shaken at 80 rpm per min at 34°C for 10–15 min and allowed to settle. Importantly, we took care not to break the spermatogenic tubules during the collagenase incubation because broken tubules can result in poor yield and purity of Leydig cells. The supernatant containing Leydig cells was collected, spun by centrifuge (TDZ5-WS, Bioridge, Shanghai, China) at 400g for 5 min, rinsed with 10 ml DMEM/F12 at 4°C, and the liquid was filtered through a 40-μm cell sieve. Leydig cells were cultured in DMEM/F12 containing 10% fetal bovine serum and 1% penicillin and streptomycin at 37°C with 5% CO2. After 24 h of culture, the Leydig cells were harvested, and their purity was determined through immunofluorescence staining with an anti-StAR antibody. Genomic DNA was extracted from the Leydig cells and subjected to the T7EI assay.
Stereofluorescence microscopy
A stereofluorescence microscope (Nikon, Tokyo, Japan) was used to directly observe the fluorescence of AAV-injected testicular tissues, thereby verifying the efficiency of viral infection.
Immunofluorescence staining
After perfusion with saline and 4% paraformaldehyde (PFA), mouse brains and testes were carefully removed and transferred to 4% PFA for 12 h of fixation at 4°C. The brains were then dehydrated in 20% sucrose for 24 h, followed by dehydration in 30% sucrose for another 24 h. Finally, the brains were embedded in Tissue-Tek optimal cutting temperature (OCT) compound (4583; SAKURA, Tokyo, Japan), sliced into 20-μm sections, and stored at −80°C. The 4% PFA-fixed testes were incubated in 5% sucrose for 3 h and 20% sucrose for 12 h, embedded in OCT compound, sliced into 8-μm sections, and stored at −80°C.
The sections were blocked with 5% goat serum (SL038; Solarbio, Beijing, China) and 0.3% Triton X-100 in PBS for 1 h, then incubated overnight at 4°C with primary antibodies. The next day, the sections were incubated with secondary antibodies at room temperature for 1 h, then stained with 4’,6-diamidino-2-phenylindole (DAPI; C0060; Solarbio) and mounted using an antifade solution. The following antibodies were used at the indicated dilutions: primary antibodies anti-Wilms’ tumor 1 (WT1; 1:200; 83535; CST, Danvers, MA, USA), anti-DDX4 (1:1000; ab13840; Abcam, Cambridge, MA, USA), anti-Lin-28 homolog A (LIN28A; 1:200; 11724-1-AP; Proteintech, Wuhan, China), anti-StAR (1:200; 8449; CST), anti-HA (1:800; 3724; CST), and anti-AR (1:200; ab133273; Abcam); and secondary antibodies goat anti-rabbit IgG, Alexa Fluor Plus 488 (1:500; A32731; Thermo Fisher Scientific, Waltham, MA, USA), and goat anti-rabbit IgG, Alexa Fluor Plus 555 (1:500; A32732; Thermo Fisher Scientific). All the images were captured and processed with a confocal laser scanning microscope (LSM 800; Carl Zeiss, Jena, Germany).
Western blotting
Total protein was extracted from testes tissues and boiled for 10 min. After quantification using a BCA Protein Assay Kit (P0009; Beyotime, Shanghai, China), lysates were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electrotransferred to a polyvinylidene fluoride (PVDF) membrane. The membranes were blocked with 5% non-fat milk in Tris-buffered saline containing Tween-20 (TBST) solution for 2 h at room temperature, incubated with primary antibodies overnight at 4°C, washed three times with TBST buffer, and incubated with secondary antibodies for 1 h at room temperature. The results were developed using the Chemiluminescent Imaging System (Tanon, Shanghai, China) and quantified by ImageJ (Fiji) software (version 1.53c; NIH, Bethesda, MD, USA). The following primary and secondary antibodies were used at the indicated dilutions: anti-AR (1:1000; ab133273; Abcam), anti-β-actin (1:10 000; BS6007M; Bioworld Technology, Nanjing, China), and goat anti-rabbit IgG (H+L)-horseradish peroxidase (HRP; 1:10 000; BS13278; Bioworld Technology).
Computer-aided sperm analysis (CASA)
One cauda epididymis was dissected and cut, then placed in 400 μl DMEM and incubated in a water bath at 37°C for 5 min to induce the sperm to swim out into the medium. The solution was mixed gently, and 10 μl of supernatant was removed for CASA (Hamilton Thorne, Hamilton, MA, USA).
Hematoxylin and eosin (H&E) staining
For H&E staining, testis tissues were fixed with 4% PFA for 24 h at 4°C, dehydrated with ethanol, embedded in paraffin, and sliced. The sections were then stained with H&E. The histological morphology of testicular tissue was examined using a light microscope.
Statistical analyses
GraphPad Prism software (version 9, GraphPad, CA, USA) was used for statistical analysis and figure production. The qPCR and western blotting data are expressed as mean ± standard error of the mean (s.e.m.). Student’s t-test was used for comparisons of the two groups. P < 0.05 was considered to indicate statistical significance. Experiments were repeated at least three times to ensure reproducibility.
RESULTS
AAV serotypes 1, 8, and 9 exhibited high affinity for infection of testicular cells
The infection efficiency and specificity of AAVs can vary greatly by serotype, with different AAV serotypes exhibiting distinct preferences for specific host cell types.40 Therefore, we evaluated the infection efficiency of six types of AAVs with distinct capsids (AAV1, AAV2, AAV5, AAV8, AAV9, and AAVBI30) in testicular tissue using enhanced green fluorescent protein (EGFP) as a reporter (Figure 1a and 1b). After injection into the seminiferous tubules of the testes, we observed robust expression of EGFP in the testes injected with AAV1, AAV8, and AAV9 (Figure 1c and 1d). Conversely, weak EGFP expression was detected in the testes injected with AAV2, AAV5, and AAVBI30 (Figure 1c). Interestingly, injection of AAV1, AAV8, and AAV9 into the interstitial region also led to a high level of EGFP expression under stereofluorescence microscopy (Figure 1e and 1f). Examination of testis sections under a fluorescence microscope revealed that tubular injection of AAVs led to the exclusive infection of tubule cells (Figure 1d), whereas interstitial injection of AAVs led to specific targeting of interstictial cells (Figure 1g).
Figure 1.
The serotypes that transduced Sertoli and Leydig cells were screened. (a) Schematic representation of the AAV-CAG-EGFP plasmid. (b) Schematic representation of AAV microinjection into seminiferous tubules. (c) The AAV vector expressing EGFP was packaged into serotypes 1, 2, 8, 9, and BI30 and then microinjected into the seminiferous tubules. After 3 weeks, the appearance of the testes was photographed by stereofluorescence microscopy. Scale bars = 500 µm. (d) Immunostaining of the testis with tubular injection of AAV1-EGFP, AAV8-EGFP, AAV9-EGFP, and PBS at 3 weeks. Scale bars = 20 µm. (e) Schematic representation of interstitial injection of AAV. (f) AAV1-EGFP, AAV8-EGFP, and AAV9-EGFP were injected into the testis by interstitial injection, respectively. After 3 weeks, the appearance of the testis was photographed by stereofluorescence microscopy. Scale bars = 500 µm. (g) The testis with interstitial injection of AAV1, AAV8, AAV9, and PBS was sectioned and examined under a fluorescence microscope at 3 weeks post-injection. Scale bars = 20 µm. EGFP: enhanced green fluorescent protein; AAV: adeno-associated virus; PBS: phosphate-buffered saline; DAPI: 4’,6-diamidino-2-phenylindole; ITR: inverted terminal repeat; WHP: woodchuck hepatitis virus; WPRE: posttranscriptional regulatory element.
Figure 2.
The adeno-associated virus (AAV) serotypes of specific transduction Sertoli and Leydig cells were screened. (a) Schematic representation of interstitial injection of AAV. (b) The representative image of co-localization of Leydig cell marker StAR with AAV-EGFP. Scale bars = 20 µm. (c) Schematic representation of the AAV-CMV-nuclear localization signal (NLS)-tdTomato plasmid. (d) Schematic representation of tubular injection of AAV. (e) Immunostaining of sections of AAV1-tdTomato-injected testes for Sertoli cell marker (WT1), germ cell marker (DDX4), and spermatogonia stem cell markers (LIN28A). Scale bars = 20 µm. (f) Immunostaining of AAV8-tdTomato-injected testes for WT1, DDX4, and LIN28A. Scale bars = 20 µm. (g) Immunostaining of AAV9-tdTomato-injected testes for WT1, DDX4, and LIN28A. Scale bars = 20 µm. EGFP: enhanced green fluorescent protein; AAV: adeno-associated virus; DAPI: 4’,6-diamidino-2-phenylindole; ITR: inverted terminal repeat; CMV: cytomegalovirus; StAR: steroidogenic acute regulatory protein.
AAV serotypes 1, 8, and 9 exhibited distinct preferences for infecting Sertoli and Leydig cells
To identify the specific cell types targeted by AAVs in interstictial cells, we performed immunostaining for the Leydig cell marker StAR and looked for co-localization with EGFP-positive cells within the interstitial region. Interestingly, all interstitial EGFP-positive cells resulting from transduction with the AAV1, AAV8, and AAV9 vectors, also co-expressed StAR protein. This indicated that the AAVs injected through the interstitial region possessed an exclusive preference for the transduction of Leydig cells (Figure 2a and 2b).
Owing to the large, irregular cytoplasmic structure of Sertoli cells, which resulted in diffuse EGFP expression throughout the seminiferous tubules, it was challenging to identify other EGFP-positive cell types in the tubules. To address this issue, we developed pAAV-H1-shRLuc-CMV-NLS-tdTomato, a vector with a nuclear localization signal for precise tagging of the reporter protein tdTomato, for tubular injection-mediated delivery of the packaged AAVs to the testis (Figure 2c and 2d). Our findings indicated that the tubular region contained tdTomato-positive cells that were exclusively co-localized with the Sertoli cell marker WT1. By contrast, the germ cell marker DDX4 and the spermatogonia stem cell marker Lin28A did not co-localize with tdTomato-positive cells (Figure 2e–2g). Taken together, these data demonstrated that AAV serotypes 1, 8, and 9 exhibit specific tropism for Sertoli cells when administered via tubular injection.
Failure of AAV-mediated CRISPR/Cas9 systems to express CAS9 in Sertoli and Leydig cells
Next, we employed AAV-mediated CRISPR/Cas9 systems to establish gene editing capability in Sertoli and Leydig cells. For these experiments, we selected two CRISPR/Cas9 AAV systems that have been demonstrated to exhibit the expression in the hypothalamus in our laboratory: SpCas9 and SaCas9. The SpCas9 system, derived from Streptococcus pyogenes, is one of the most prominent and widely used CRISPR/Cas9 systems in the field of genome editing. To assess the efficacy of the SpCas9 system in Sertoli and Leydig cells, we administered AAV9-spCas9 (titer: 1013 vg ml−1) into the testis of wild-type mice via either tubular or interstitial injection (Supplementary Figure 2a (467.5KB, tif) ). Surprisingly, while no expression of SpCas9 was detected in either Sertoli or Leydig cells (Supplementary Figure 2b (467.5KB, tif) ), robust expression of SpCas9 was observed in the hypothalamus (Supplementary Figure 2c (467.5KB, tif) and 2d (467.5KB, tif) ). Similarly, the SaCas9 system, which is derived from Staphylococcus aureus and produces Cas9 of a smaller molecular size compared with SpCas9 (Supplementary Figure 2e (467.5KB, tif) ), showed robust SaCas9 expression within the hypothalamus (Supplementary Figure 2f (467.5KB, tif) and 2g (467.5KB, tif) ), but no discernible expression in Sertoli or Leydig cells (Supplementary Figure 2h (467.5KB, tif) ). Thus, the delivery of the CRISPR/Cas9 components using AAV9 was unsuccessful in inducing Cas9 expression in Sertoli and Leydig cells.
AAV-mediated delivery of Cre recombinase to induce Cas9 expression in Leydig cells, but not Sertoli cells, of Rosa26-LSL-Cas9 mice
The Rosa26-LSL-Cas9 mouse model is a versatile tool for precise gene editing and functional analysis, allowing researchers to study target genes in specific cell types or at specific developmental stages.41 To assess the feasibility of establishing gene editing capability in Sertoli and Leydig cells of Rosa26-LSL-Cas9 mice, we administered AAV9-sgRNA-Cre-HA (titer: 1013 vg ml−1; Supplementary Figure 2i (467.5KB, tif) ) into the hypothalamus of the brain via brain stereotactic injection (Supplementary Figure 2j (467.5KB, tif) and 2k (467.5KB, tif) ) and the testis via tubular injection or interstitial injection (Supplementary Figure 2l (467.5KB, tif) and 2m (467.5KB, tif) ). Consistent with our previous study, we observed the expression of CAS9-EGFP in the hypothalamus.41 Interestingly, we also observed the expression of both Cre recombinase and CAS9-EGFP in the Leydig cells (Supplementary Figure 2l (467.5KB, tif) ), but CAS9-EGFP was not detected in Sertoli cells following tubular injection of AAV9-sgRNA-Cre-HA (Supplementary Figure 2m (467.5KB, tif) ). We speculated that the Rosa26-LSL-Cas9 mouse model could be used to perform AAV-mediated gene editing in Leydig cells but not in Sertoli cells.
Efficient editing of Star and Lhcgr in Leydig cells of Rosa26-LSL-Cas9 mice through AAV-mediated delivery of Cre recombinase and sgRNA
Next, we evaluated the efficiency of gene editing in Leydig cells of Rosa26-LSL-Cas9 mice through AAV-mediated delivery of Cre recombinase and sgRNA. Our target genes, Star42 and Lhcgr,43 were carefully selected on the basis of their pivotal roles in maintaining testicular function. To facilitate gene editing of Star, we designed five sgRNAs targeting the exon regions (Figure 3a). Sanger sequencing and T7EI assays were employed to investigate the gene-editing capabilities of these sgRNAs (Figure 3b and 3c). One of these, sgRNA4, exhibited the highest gene editing efficacy and was incorporated into the pAAV-U6-sgRNA-Cre-HA vector. Following the production of serotype 9 AAV particles, we administered either AAV9-sgCtrl-Cre-HA or AAV9-sgRNA4-Cre-HA via interstitial injection into the testis of Rosa26-Lsl-Cas9 mice (Figure 3d). Eight weeks post-injection, the virus-injected testes showed strong GFP expression under stereofluorescence microscopy (Figure 3e). The expression of StAR in the AAV9-sgRNA4-Cre-HA-injected testes was significantly reduced compared with the AAV9-sgCtrl-Cre-HA-injected testes (Figure 3f). We isolated Leydig cells from AAV9-sgRNA4-Cre-HA-injected testes and performed the T7EI assay and Sanger sequencing on the sgRNA4-targeted Star genomic locus. The T7EI assay results confirmed the genomic editing at the Star locus (Figure 3g). The sequencing chromatograms revealed the presence of double peaks at positions 3–5 base pairs upstream of the protospacer adjacent motif (PAM), indicating successful CRISPR/Cas9-mediated gene editing at the Star locus (Figure 3h). Next, we examined the spermatogenic function of AAV9-sgRNA4-Cre-HA-injected mice, which exhibited impaired spermatogenic tubule formation, thinning of the spermatogenic epithelium, and reduced sperm count in the epididymis (Figure 3i). We also assessed the spermatogenic function of these mice using CASA. This revealed significant decreases in sperm quality parameters, including total sperm count (P < 0.001), motility percentage (P < 0.001), progressive motility percentage (P < 0.001), static motility percentage (P < 0.05), straight-line velocity (VSL; P < 0.05), linearity (LIN; P < 0.05), and straightness (STR; P < 0.05), as shown in Figure 3j–3t.
Figure 3.
AAV-mediated Star gene editing in Leydig cells. (a) Schematic representation of Star sgRNA targets genomic locations. (b) Sanger sequencing chromatogram of the genomic targeting site for Star sgRNA in TM3 cell lines. (c) Evaluation of gene editing efficacies at the Star locus by T7EI nuclease assay for five distinct Star-sgRNAs in TM3 cell lines. (d) Schematic representation of the AAV-sgRNA-Cre-HA plasmid and experimental overview of the in vivo studies. (e) The testis was interstitial injected with AAV9-sgCtrl and AAV9-sgStar, respectively; and after 8 weeks, the appearance of the testis was photographed by stereofluorescence microscopy. Scale bars = 500 µm. (f) Immunostaining of the Leydig cell marker StAR in testes after interstitial injection with AAV9-sgCtrl and AAV9-sgStar, 8 weeks post-injection. Scale bars = 20 µm. (g) Agarose gel electrophoresis results displaying the T7EI-specific digestion products of genomic DNA isolated from Leydig cells after interstitial injection with AAV9-sgCtrl and AAV9-sgStar. DNA (200 ng) was loaded per well. (h) Sanger sequencing chromatograms of genomic DNA isolated from Leydig cells after interstitial injection with AAV9-sgStar. (i) H&E staining of testes and epididymides from mice after interstitial injection with AAV9-sgCtrl and AAV9-sgStar. Scale bars = 20 µm. (j) The total count of free sperm, (k) the percentage of motile sperm, (l) the percentage of progressive sperm, (m) the percentage of static sperm, (n) the VAP, (o) the VCL, (p) the VSL, (q) the ALH, (r) the BCF, (s) the LIN, and (t) the STR in the cauda epididymis from mice after interstitial injection with AAV9-sgCtrl and AAV9-sgStar. Results are expressed as mean ± standard error of the mean. *P < 0.05 and ***P < 0.001 (Student’s t-test). HA: hemagglutinin; Star: steroidogenic acute regulatory; VAP: average path velocity; VCL: curvilinear velocity; VSL: straight-line velocity; ALH: amplitude of lateral head, BCF: beat cross frequency; LIN: linearity; STR: straightness; AAV: adeno-associated virus; H&E: hematoxylin and eosin; Cre: cyclization recombination enzyme; sgRNA: single guide RNA; NS: not significant.
Similarly, we designed five sgRNAs for targeted editing of Lhcgr gene exons. A screening process identified sgRNA2 as having the highest editing efficiency (Supplementary Figure 3a (463.7KB, tif) –3c (463.7KB, tif) ), and thus it was cloned into the vector pAAV-U6-sgRNA-Cre-HA. Following the production of serotype 9 AAV particles, we performed interstitial injection of either AAV9-sgCtrl-Cre-HA or AAV9-sgRNA2-Cre-HA into the testis of Rosa26-LSL-Cas9 mice. Again, we detected strong green fluorescence signals in virus-injected testes under stereofluorescence microscopy (Supplementary Figure 3d (463.7KB, tif) ). In addition, Leydig cells isolated from testes that underwent interstitial AAV injection expressed the Leydig cell markers StAR and EGFP (Supplementary Figure 3e (463.7KB, tif) ). T7EI assay and Sanger sequencing results further confirmed the genomic editing at the Lhcgr locus (Supplementary Figure 3f (463.7KB, tif) and 3g (463.7KB, tif) ). Examination of the spermatogenic function of the AAV9-sgRNA2-Cre-HA-injected mice showed that the knockout of Lhcgr in Leydig cells impaired spermatogenic tubule formation and reduced the number of spermatozoa in the epididymis (Supplementary Figure 3h (463.7KB, tif) ). In addition, sperm quality parameters, including total sperm count (P < 0.001), motility percentage (P < 0.001), progressive motility percentage (P < 0.001), static motility percentage (P < 0.001), average path velocity (VAP; P < 0.001), curvilinear velocity (VCL; P < 0.001), VSL (P < 0.001), amplitude of lateral head displacement (ALH; P < 0.05), beat cross frequency (BCF; P < 0.01), LIN (P < 0.01), and STR (P < 0.001), were significantly decreased in these mice (Supplementary Figure 3i (463.7KB, tif) –3s (463.7KB, tif) ).
AAV-mediated shRNA silencing of Ar in Sertoli cells
To achieve efficient gene silencing in Sertoli cells, we investigated the application of AAV-mediated shRNA technology for Sertoli cell-specific gene knockdown. As our focal gene, we selected Ar, which is crucial for the optimal functioning of Sertoli cells and facilitates the generation of viable sperm, thereby playing a vital role in male fertility.44 The efficiencies of different shRNAs were screened in the TM4 cell line using qPCR and western blotting (all P < 0.001; Figure 4a–4c). The one that exhibited the most optimal performance, shRNA3, was cloned into the vector pAAV-H1-shRLuc-CMV-NLS-tdTomato. After encapsulation within serotype 9 AAV particles, both the AAV-shAr and control (Ctrl) virus construct were administered by tubular injection. Eight weeks post-injection, both AAV9-shCtrl-injected and AAV9-shAr-injected testes were observed to express tdTomato under stereofluorescence microscopy (Figure 4d). Immunostaining of testis sections showed significantly reduced AR expression in the Sertoli cells of AAV9-shAr-injected testes compared with that of AAV9-shCtrl-injected testes (P < 0.001; Figure 4e and 4f). Western blot also showed a significant reduction in AR protein expression in AAV9-shAr-injected testes (P < 0.05; Figure 4g and 4h). No significant difference in the body testis coefficient was observed between the AAV9-shAr-injected and AAV9-shCtrl-injected mice (Figure 4i). Next, we examined the spermatogenic function of the AAV9-shAr-injected and AAV9-shCtrl-injected mice. H&E staining of testis sections showed thinning of the spermatogenic tubules and reduced numbers of spermatozoa in the epididymis (Figure 4j). Knockdown of Ar expression in Sertoli cells led to decreases in sperm quality parameters, including total sperm count, motility percentage, progressive motility percentage, static motility percentage, VAP, VCL, VSL, ALH, BCF, LIN, and STR (all P < 0.001; Figure 4k–4u).
Figure 4.
AAV-mediated Ar gene silencing in Sertoli cells. (a) The qPCR analysis of Ar mRNA expression levels in TM4 cell lines treated with different shRNAs. (b) Western blot assays of AR protein expression levels in TM4 cell lines treated with different shRNAs. (c) Statistical analysis of relative AR protein expression levels of b. (d) Stereofluorescence microscope images of testes 8 weeks after microinjection with AAV9-shCtrl and AAV9-shAr. Scale bars = 500 µm. (e) Immunostaining of AR in testes 8 weeks posttubular injection with AAV9-shCtrl and AAV9-shAr. Scale bars = 20 µm. (f) Quantification of the percentage of cells positive for AR staining in cells infected with AAV9-shCtrl and AAV9-shAr. (g) Western blot assays of AR protein expression levels in testes 8 weeks after tubular injection with AAV9-shCtrl and AAV9-shAr. (h) Quantitative analysis of relative AR protein expression levels in testes 8 weeks following tubular injection of AAV9-shCtrl and AAV9-shAr. (i) Body-testis coefficient of mice 8 weeks after tubular injection with AAV9-shCtrl and AAV9-shAr. (j) H&E staining of testes and epididymides from mice after tubular injection with AAV9-shCtrl and AAV9-shAr. Scale bars = 20 µm. (k) The total count of free sperm, (l) the percentage of motile sperm, (m) the percentage of progressive sperm, (n) the percentage of static sperm, (o) the VAP, (p) the VCL, (q) the VSL, (r) the ALH, (s) the BCF, (t) the LIN, and (u) the STR in the cauda epididymis from mice tubular injection with AAV9-shCtrl and AAV9-shAr. Results are expressed as mean ± standard error of the mean. *P < 0.05 and ***P < 0.001 (Student’s t-test). HA: hemagglutinin; Ar: androgen receptor; VAP: average path velocity; VCL: curvilinear velocity; VSL: straight-line velocity; ALH: amplitude of lateral head; BCF: beat cross frequency; LIN: linearity; STR: straightness; AAV: adeno-associated virus; H&E: hematoxylin and eosin; shRNA: short hairpin RNA; qPCR: quantitative real-time polymerase chain reaction; NS: not significant.
DISCUSSION
Investigations into the roles of specific genes in Sertoli and Leydig cells have garnered significant attention within the field of reproductive research, but there remains a considerable number of genes whose functions require further elucidation.1,2,42 Currently, the Cre/loxP system is widely used to investigate the functions of specific genes, offering precisely controlled gene editing that is capable of selectively eliminating target genes in specific tissues or cells, including Sertoli and Leydig cells.45 Nevertheless, Cre/loxP-based methods entail the establishment of specific transgenic animal models, which typically involve intricate genetic manipulation, high cost, and an extended experimental period. In vivo gene editing mediated through local injection of an AAV vector has rapid effects in the body, achieving prompt genomic modification and significantly shortening the length of experiments.46,47 The diversity of AAV serotypes enables the precise transduction of specific tissues and cell types, with both dividing and quiescent cells showing susceptibility.48,49,50 AAVs are being increasingly used for their simple operation, high cost-effectiveness, and short experimental cycle, but the delivery capacity of an AAV vector is restricted to 4.7 kb, thereby limiting its application in certain large gene editing tools. By contrast, the Cre/loxP system has no major limitation on delivery size. Each individual system has its own merits, and the selection of which method depends on the researcher’s own purposes and requirements. Furthermore, researchers have recently begun to combine the two, using AAV vectors to deliver Cre recombinase into target cells. This allows for precise manipulation and control of genes within target cells, thereby expediting the establishment of disease models for gene function studies. The research shown here was specifically designed to investigate this methodology.
Previous studies have demonstrated that AAV serotypes 1, 8, and 9 are capable of infecting various cell types within the spermatogenic tubule, including spermatogonia and Sertoli cells.28 However, the large cytoplasmic volume and irregular shape of Sertoli cells51 make it challenging to accurately determine which cells are infected by AAV. To tackle this problem, we used tubular injection to introduce AAVs vectors that encode fluorescent proteins with a nuclear localization signal into the testes. We revealed that the AAVs specifically infected Sertoli cells but not spermatogonia, enabling the development of an AAV-based gene silencing technology targeted at Sertoli cells.28 Consistent with previous studies, we also confirmed that AAV1, AAV8, and AAV9 delivered via interstitial injection specifically transduced Leydig cells.12,29
Among the tools available for genetic manipulation, the CRISPR/Cas9 genome editing system is extensively employed in biotechnology and medicine, with widespread applications.52,53,54 In this study, we explored the feasibility of using AAV as a carrier for the delivery of Cas9 into Sertoli and Leydig cells. We initially considered using SaCas9 from Staphylococcus aureus instead of the fairly large SpCas9 (1368 amino acids, approximately 4.2 kb)23 from Streptococcus pyogenes, which exceeds the 4.7 kb packaging capacity of the AAV vector.55 By contrast, SaCas9 (1053 amino acids, approximately 3.1 kb)56 is more suitable for co-construction with an sgRNA on the same plasmid, facilitating the delivery of genome editing components to somatic tissues.57 However, we found that SaCas9 delivered through AAV was successfully expressed in hypothalamic tissue but not in testicular Sertoli or Leydig cells. Previous studies have suggested that promoters play a crucial role in determining gene expression levels within specific tissues, with promoter activity also exhibiting tissue preference.58 Interestingly, the CMV promoter sequence in plasmid pAAV-CMV-SaCas9-HA-U6-sgRNA is 22 nucleotides shorter than that in plasmid pAAV-H1-shRLuc-CMV-NLS-tdTomato, which is known to be expressed in Sertoli and Leydig cells. In a future investigation, we plan to explore whether this truncated promoter is responsible for the lack of SaCas9 expression in Sertoli and Leydig cells.
Our use of SpCas9 for targeted gene editing of the testes of Rosa26-LSL-Cas9 mice yielded mixed results, with the Cre/loxP system functioning in Leydig cells, but not in Sertoli cells. Expression of AAV-derived Cre recombinase in Leydig cells led to the removal of the STOP cassette in Rosa26-LSL-Cas9, allowing for normal expression of the Cas9-EGFP fusion gene, which then enabled gene editing guided by sgRNA via Cas9.41 By contrast, although Cre recombinase was typically expressed in Sertoli cells, it exhibited limited efficacy in removing the STOP sequence, leading to a failure to express Cas9-EGFP. We postulate that the Rosa26-LSL-Cas9 sequence within Sertoli cells is located within a region of heterochromatin, which might block its accessibility to binding and efficient cleavage by Cre recombinase, consequently suppressing Cas9-EGFP expression. Further validation is necessary to substantiate this hypothesis.
The SpCas9 system was employed to perform gene editing of the Star and Lhcgr genes in the Leydig cells of Rosa26-LSL-Cas9 mice. StAR is a pivotal protein that regulates acute steroidogenesis in the gonads and adrenal glands.42 It plays an essential role in facilitating cholesterol transfer from the outer mitochondrial membrane to the inner mitochondrial membrane, which represents the initial and rate-limiting step in steroid hormone biosynthesis.42 LHCGR is indispensable for steroidogenesis, gamete generation, and male sexual differentiation.43 Mutation of these genes can result in reproductive disorders.43 In line with previous research, this study employed AAV-mediated delivery of sgRNA and Cre to specifically target Star and Lhcgr within the Leydig cells of Rosa26-LSL-Cas9 mice, which induced the corresponding infertility phenotypes. Therefore, we have demonstrated the feasibility of AAV-mediated delivery of sgRNA and Cre to achieve targeted gene silencing in Leydig cells of Rosa26-LSL-Cas9 mice.
AAV-derived shRNA was chosen for gene silencing in Sertoli cells because of the ineffectiveness of the CRISPR/Cas9 system in this cell type. The demonstrated impact of AR on the function of Sertoli cells in supporting and nurturing germ cells made it an ideal gene target.59 The Sertoli cell-specific knockdown of Ar leads to stagnation of spermatogenesis at the premeiotic double-line primary spermatocyte stage, prior to completion of the first meiotic division.44 The injection of AAV-shAr particles into the seminiferous tubules led to the selective transduction of Sertoli cells within these tubules; Leydig cells located outside the tubule were not expected to be transduced because of the limited capacity of AAV to traverse the blood–testis barrier. Furthermore, our results demonstrated that Ar was silenced exclusively in Sertoli cells, but not in Leydig cells, following AAV-shAr injection into the seminiferous tubules. Moreover, this silencing of Ar in Sertoli cells resulted in the manifestation of the corresponding infertility phenotypes, demonstrating the achievement of Sertoli cell-specific gene suppression via AAV-mediated shRNA interference.
Our use of AAV as a delivery tool to suppress gene expression in Sertoli and Leydig cells indicated that AAV serotypes 1, 8, and 9 exhibit high infectivity in testicular cells. Notably, we observed that all three AAV serotypes specifically targeted Sertoli cells when administered through tubular injection while selectively targeting Leydig cells via interstitial injection. By using AAV9-sgRNA-mediated gene editing in Rosa26-LSL-Cas9 mice, we successfully knocked out both Star and Lhcgr in Leydig cells. Furthermore, we achieved downregulation of Ar expression in Sertoli cells via tubular injection of AAV9-shRNA against Ar. Collectively, our findings offer valuable technical strategies for investigating gene functionality in both Sertoli and Leydig cells using AAV9-mediated gene silencing.
Star and Lhcgr are indispensable for Leydig cell steroidogenesis and spermatogenesis, and the deletion of these genes can result in male infertility. Similarly, Ar plays a crucial role in mediating androgen function in Sertoli cells, and its mutation can result in significant impairment of spermatogenesis. In this study, we demonstrated the successful silencing of Star, Lhcgr, and Ar in Leydig cells or Sertoli cells of the mouse testis using AAV-mediated gene manipulation techniques. The resulting transgenic mice will be useful to investigate the intricate molecular mechanisms through which Star, Lhcgr, and Ar exert their influence on spermatogenesis, thereby facilitating advancements in the treatment of patients with male infertility.
This study has two main limitations. First, our strategy for gene editing using pAAV-U6-sgRNA-Cre-HA to activate Cas9-EGFP expression in Sertoli cells of Rosa26-LSL-Cas9 mice was not successful. Second, we were unable to successfully express SaCas9 or SpCas9 in Sertoli and Leydig cells of wild-type mice, thus gene editing through the CRISPR/Cas9 system has not yet been achieved in these cell types. Further efforts are required to overcome these technical limitations in future studies.
In conclusion, we demonstrated the significant application potential of a precise gene silencing strategy for research on gene function, the construction of animal disease models, and the development of future treatments for male infertility. As biotechnology progresses, we anticipate that this strategy will bring about even more revolutionary biomedical innovations.
AUTHOR CONTRIBUTIONS
JXL and YL conceived the study and designed the experiments. JP and MXX performed the experiments and analyzed the data. XYW, XF, YMD, XYZ, YQC, and WY performed the experiments. JXL, JP, and MXX wrote the manuscript. All authors read, commented on, and approved the final manuscript.
COMPETING INTERESTS
All authors declare no competing interests.
Graphical abstract of this study.
Exploration of AAV-mediated gene editing in Sertoli and Leydig cells. (a) Schematic representation of the two plasmids for SpCas9 gene editing system. (b) Co-staining of HA-tag in testes at 3 weeks post-injection of AAV9-SpCas9. Scale bars = 20 µm. (c) Schematic representation of AAV injection into the hypothalamus and corresponding stereofluorescence microscopy image of the hypothalamus at 3 weeks post-injection. Scale bars = 500 µm. (d) Immunostaining of the hypothalamus for HA-tag 3 weeks post-stereotaxic injection of AAV9-SpCas9. Scale bars = 20 µm. (e) Schematic representation of the AAV-SaCas9 plasmid. (f) Schematic representation of AAV injection into the hypothalamus. (g) Immunostaining of the hypothalamus section for HA-tag 3 weeks post-stereotaxic injection of AAV9-SaCas9. Scale bars = 20 µm. (h) Immunostaining of HA-tag in testes sections at 3 weeks post-injection of AAV9-SaCas9. Scale bars = 20 µm. (i) Schematic representation of the AAV-sgRNA-Cre-HA plasmid. (j) Schematic representation of stereotaxic injection of AAV-sgRNA-Cre-HA into the hypothalamus. (k) The fluorescence image of hypothalamus section 3 weeks after stereotaxic injection of AAV-sgRNA-Cre-HA in Rosa26-LSL-Cas9 mice. Scale bars = 20 µm. (l) Immunostaining for HA in testes 3 weeks after interstitial injection of AAV-sgRNA-Cre-HA in Rosa26-LSL-Cas9 mice. Scale bars = 20 µm. (m) Immunostaining for HA in testes 3 weeks after tubular injection of AAV-sgRNA-Cre-HA in Rosa26-LSL-Cas9 mice. Scale bars = 20 µm. DAPI: 4’,6-diamidino-2-phenylindole; ITR: inverted terminal repeat; CMV: cytomegalovirus; HA: hemagglutinin; sgRNA: single guide RNA; Cre: cyclization recombination enzyme; AAV: adeno-associated virus.
AAV-mediated Lhcgr gene editing in Leydig cells. (a) Schematic representation of Lhcgr sgRNA targets genomic locations. (b) Sanger sequencing chromatogram of the genomic targeting site for Lhcgr sgRNA in TM3 cell lines. (c) Evaluation of gene editing efficacies at the Lhcgr locus by T7EI nuclease assay for five distinct Lhcgr sgRNAs in TM3 cell lines. (d) The testis was interstitial injected with AAV9-sgCtrl and AAV9-sgLhcgr, respectively, and after 8 weeks, the appearance of the testis was photographed by stereofluorescence microscopy. Scale bars = 500 µm. (e) Immunostaining of Leydig cell-specific marker StAR in Leydig cells isolated from mouse testes at 8 weeks following interstitial injection of AAV9-sgCtrl and AAV9-sgLhcgr. Scale bars = 20 µm. (f) Agarose gel electrophoresis results displaying the T7EI-specific digestion products of genomic DNA isolated from Leydig cells after interstitial injection with AAV9-sgCtrl and AAV9-sgLhcgr. DNA (200 ng) was loaded per well. (g) Sanger sequencing chromatograms of genomic DNA isolated from Leydig cells after interstitial injection with AAV9-sgLhcgr. (h) H&E staining of testes and epididymides from mice after interstitial injection with AAV9-sgCtrl and AAV9-sgLhcgr. Scale bars = 20 µm. (i) The total count of free sperm, (j) the percentage of motile sperm, (k) the percentage of progressive sperm, (l) the percentage of static sperm, (m) the VAP, (n) the VCL, (o) the VSL, (p) the ALH, (q) the BCF, (r) the LIN, and (s) the STR in the cauda epididymis from mice tubular injection with AAV9-shCtrl and AAV9-shAr. Results are expressed as mean ± standard error of the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (Student’s t-test). HA: hemagglutinin; Lhcgr: luteinizing hormone/human chorionic gonadotropin receptor; StAR: steroidogenic acute regulatory protein; VAP: average path velocity; VCL: curvilinear velocity; VSL: straight-line velocity; ALH: amplitude of lateral head, BCF: beat cross frequency; LIN: linearity; STR: straightness; AAV: adeno-associated virus; H&E: hematoxylin and eosin; Cre: cyclization recombination enzyme; sgRNA: single guide RNA; NS: not significant.
ACKNOWLEDGMENTS
We thank the laboratory members for their help and support. We also thank the Professor Bin Shen of Nanjing Medical University (Nanjing, China) for providing the Rosa26-LSL-Cas9 strain. This work was supported by the National Natural Science Foundation of China (No. 82070872 and No. 82370854 to JXL); Innovative and Entrepreneurial Team of Jiangsu Province (No. JSSCTD2021 to JXL); China Postdoctoral Science Foundation (2023M741790 to JP); and Jiangsu Funding Program for Excellent Postdoctoral Talent (2023ZB558 to JP).
Supplementary Information is linked to the online version of the paper on the Asian Journal of Andrology website.
REFERENCES
- 1.Zhou R, Wu J, Liu B, Jiang Y, Chen W, et al. The roles and mechanisms of Leydig cells and myoid cells in regulating spermatogenesis. Cell Mol Life Sci. 2019;76:2681–95. doi: 10.1007/s00018-019-03101-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Makela JA, Koskenniemi JJ, Virtanen HE, Toppari J. Testis development. Endocr Rev. 2019;40:857–905. doi: 10.1210/er.2018-00140. [DOI] [PubMed] [Google Scholar]
- 3.Nishimura H, L’Hernault SW. Spermatogenesis. Curr Biol. 2017;27:R988–94. doi: 10.1016/j.cub.2017.07.067. [DOI] [PubMed] [Google Scholar]
- 4.Griswold MD. The central role of sertoli cells in spermatogenesis. Semin Cell Dev Biol. 1998;9:411–6. doi: 10.1006/scdb.1998.0203. [DOI] [PubMed] [Google Scholar]
- 5.Mruk DD, Cheng CY. Sertoli-sertoli and sertoli-germ cell interactions and their significance in germ cell movement in the seminiferous epithelium during spermatogenesis. Endocr Rev. 2004;25:747–806. doi: 10.1210/er.2003-0022. [DOI] [PubMed] [Google Scholar]
- 6.Smith LB, Walker WH. The regulation of spermatogenesis by androgens. Semin Cell Dev Biol. 2014;30:2–13. doi: 10.1016/j.semcdb.2014.02.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Ge RS, Li X, Wang Y. Leydig cell and spermatogenesis. Adv Exp Med Biol. 2021;1288:111–29. doi: 10.1007/978-3-030-77779-1_6. [DOI] [PubMed] [Google Scholar]
- 8.Chen Y, Liu X, Zhang L, Zhu F, Yan L, et al. Deciphering the molecular characteristics of human idiopathic nonobstructive azoospermia from the perspective of germ cells. Adv Sci (Weinh) 2023;10:e2206852. doi: 10.1002/advs.202206852. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Firestein R, Nagy PL, Daly M, Huie P, Conti M, et al. Male infertility, impaired spermatogenesis, and azoospermia in mice deficient for the pseudophosphatase Sbf1. J Clin Invest. 2002;109:1165–72. doi: 10.1172/JCI12589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Fouchecourt S, Livera G, Messiaen S, Fumel B, Parent AS, et al. Apoptosis of sertoli cells after conditional ablation of murine double minute 2 (Mdm2) gene is p53-dependent and results in male sterility. Cell Death Differ. 2016;23:521–30. doi: 10.1038/cdd.2015.120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Nie X, Munyoki SK, Sukhwani M, Schmid N, Missel A, et al. Single-cell analysis of human testis aging and correlation with elevated body mass index. Dev Cell. 2022;57:1160–76.e5. doi: 10.1016/j.devcel.2022.04.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Xia K, Wang F, Lai X, Dong L, Luo P, et al. AAV-mediated gene therapy produces fertile offspring in the Lhcgr-deficient mouse model of leydig cell failure. Cell Rep Med. 2022;3:100792. doi: 10.1016/j.xcrm.2022.100792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Alfano M, Tascini AS, Pederzoli F, Locatelli I, Nebuloni M, et al. Aging, inflammation and DNA damage in the somatic testicular niche with idiopathic germ cell aplasia. Nat Commun. 2021;12:5205. doi: 10.1038/s41467-021-25544-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Dai P, Ma C, Chen C, Liang M, Dong S, et al. Unlocking genetic mysteries during the epic sperm journey toward fertilization:further expanding Cre mouse lines. Biomolecules. 2024;14:529. doi: 10.3390/biom14050529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Larney C, Bailey TL, Koopman P. Switching on sex:transcriptional regulation of the testis-determining gene Sry. Development. 2014;141:2195–205. doi: 10.1242/dev.107052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Akiyama H, Kim JE, Nakashima K, Balmes G, Iwai N, et al. Osteo-chondroprogenitor cells are derived from Sox9 expressing precursors. Proc Natl Acad Sci U S A. 2005;102:14665–70. doi: 10.1073/pnas.0504750102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Smith L. Good planning and serendipity:exploiting the Cre/Lox system in the testis. Reproduction. 2011;141:151–61. doi: 10.1530/REP-10-0404. [DOI] [PubMed] [Google Scholar]
- 18.Ueki K, Nishida Y, Aoyama S, Uzawa H, Kanai A, et al. Establishment of pancreatic beta-cell-specific gene knockout system based on CRISPR-Cas9 technology with AAV8-mediated gRNA delivery. Diabetes. 2023;72:1609–20. doi: 10.2337/db23-0445. [DOI] [PubMed] [Google Scholar]
- 19.Wang D, Tai PW, Gao G. Adeno-associated virus vector as a platform for gene therapy delivery. Nat Rev Drug Discov. 2019;18:358–78. doi: 10.1038/s41573-019-0012-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kotterman MA, Schaffer DV. Engineering adeno-associated viruses for clinical gene therapy. Nat Rev Genet. 2014;15:445–51. doi: 10.1038/nrg3742. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Challis RC, Ravindra Kumar S, Chan KY, Challis C, Beadle K, et al. Systemic AAV vectors for widespread and targeted gene delivery in rodents. Nat Protoc. 2019;14:379–414. doi: 10.1038/s41596-018-0097-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Davis JR, Banskota S, Levy JM, Newby GA, Wang X, et al. Efficient prime editing in mouse brain, liver and heart with dual AAVs. Nat Biotechnol. 2024;42:253–64. doi: 10.1038/s41587-023-01758-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Ran FA, Cong L, Yan WX, Scott DA, Gootenberg JS, et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015;520:186–91. doi: 10.1038/nature14299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Gao Z, Ravendran S, Mikkelsen NS, Haldrup J, Cai H, et al. A truncated reverse transcriptase enhances prime editing by split AAV vectors. Mol Ther. 2022;30:2942–51. doi: 10.1016/j.ymthe.2022.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Amador C, Shah R, Ghiam S, Kramerov AA, Ljubimov AV. Gene therapy in the anterior eye segment. Curr Gene Ther. 2022;22:104–31. doi: 10.2174/1566523221666210423084233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Rajasekaran S, Thatte J, Periasamy J, Javali A, Jayaram M, et al. Infectivity of adeno-associated virus serotypes in mouse testis. BMC Biotechnol. 2018;18:70. doi: 10.1186/s12896-018-0479-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Darbey A, Rebourcet D, Curley M, Kilcoyne K, Jeffery N, et al. A comparison of in vivo viral targeting systems identifies adeno-associated virus serotype 9 (AAV9) as an effective vector for genetic manipulation of leydig cells in adult mice. Andrology. 2021;9:460–73. doi: 10.1111/andr.12915. [DOI] [PubMed] [Google Scholar]
- 28.Watanabe S, Kanatsu-Shinohara M, Ogonuki N, Matoba S, Ogura A, et al. In vivo genetic manipulation of spermatogonial stem cells and their microenvironment by adeno-associated viruses. Stem Cell Reports. 2018;10:1551–64. doi: 10.1016/j.stemcr.2018.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Gannon AL, Darbey AL, Chensee G, Lawrence BM, O’Donnell L, et al. A novel model using AAV9-Cre to knockout adult leydig cell gene expression reveals a physiological role of glucocorticoid receptor signalling in leydig cell function. Int J Mol Sci. 2022;23:15015. doi: 10.3390/ijms232315015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Stocco DM. StAR protein and the regulation of steroid hormone biosynthesis. Annu Rev Physiol. 2001;63:193–213. doi: 10.1146/annurev.physiol.63.1.193. [DOI] [PubMed] [Google Scholar]
- 31.Christenson LK, Strauss JF., 3rd Steroidogenic acute regulatory protein:an update on its regulation and mechanism of action. Arch Med Res. 2001;32:576–86. doi: 10.1016/s0188-4409(01)00338-1. [DOI] [PubMed] [Google Scholar]
- 32.Su Y, Wu Y, Ye M, Zhao C, Li L, et al. Star1 gene mutation reveals the essentiality of 11-ketotestosterone and glucocorticoids for male fertility in Nile tilapia (Oreochromis niloticus) Comp Biochem Physiol B Biochem Mol Biol. 2024;273:110985. doi: 10.1016/j.cbpb.2024.110985. [DOI] [PubMed] [Google Scholar]
- 33.Li L, Wu Y, Zhao C, Miao Y, Cai J, et al. The role of StAR2 gene in testicular differentiation and spermatogenesis in Nile tilapia (Oreochromis niloticus) J Steroid Biochem Mol Biol. 2021;214:105974. doi: 10.1016/j.jsbmb.2021.105974. [DOI] [PubMed] [Google Scholar]
- 34.Rahman NA, Rao CV. Recent progress in luteinizing hormone/human chorionic gonadotrophin hormone research. Mol Hum Reprod. 2009;15:703–11. doi: 10.1093/molehr/gap067. [DOI] [PubMed] [Google Scholar]
- 35.Lei ZM, Mishra S, Zou W, Xu B, Foltz M, et al. Targeted disruption of luteinizing hormone/human chorionic gonadotropin receptor gene. Mol Endocrinol. 2001;15:184–200. doi: 10.1210/mend.15.1.0586. [DOI] [PubMed] [Google Scholar]
- 36.Zhang FP, Pakarainen T, Zhu F, Poutanen M, Huhtaniemi I. Molecular characterization of postnatal development of testicular steroidogenesis in luteinizing hormone receptor knockout mice. Endocrinology. 2004;145:1453–63. doi: 10.1210/en.2003-1049. [DOI] [PubMed] [Google Scholar]
- 37.Wang RS, Yeh S, Tzeng CR, Chang C. Androgen receptor roles in spermatogenesis and fertility:lessons from testicular cell-specific androgen receptor knockout mice. Endocr Rev. 2009;30:119–32. doi: 10.1210/er.2008-0025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Chang C, Chen YT, Yeh SD, Xu Q, Wang RS, et al. Infertility with defective spermatogenesis and hypotestosteronemia in male mice lacking the androgen receptor in sertoli cells. Proc Natl Acad Sci U S A. 2004;101:6876–81. doi: 10.1073/pnas.0307306101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Concordet JP, Haeussler M. CRISPOR:intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res. 2018;46:W242–5. doi: 10.1093/nar/gky354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Issa SS, Shaimardanova AA, Solovyeva VV, Rizvanov AA. Various AAV serotypes and their applications in gene therapy:an overview. Cells. 2023;12:785. doi: 10.3390/cells12050785. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Wang H, Yang H, Shivalila CS, Dawlaty MM, Cheng AW, et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 2013;153:910–8. doi: 10.1016/j.cell.2013.04.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.O'Donnell L, Smith LB, Rebourcet D. Sertoli cells as key drivers of testis function. Semin Cell Dev Biol. 2022;121:2–9. doi: 10.1016/j.semcdb.2021.06.016. [DOI] [PubMed] [Google Scholar]
- 43.Narayan P. Genetic models for the study of luteinizing hormone receptor function. Front Endocrinol (Lausanne) 2015;6:152. doi: 10.3389/fendo.2015.00152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Zhou X. Roles of androgen receptor in male and female reproduction:lessons from global and cell-specific androgen receptor knockout (ARKO) mice. J Androl. 2010;31:235–43. doi: 10.2164/jandrol.109.009266. [DOI] [PubMed] [Google Scholar]
- 45.Schnutgen F, Doerflinger N, Calleja C, Wendling O, Chambon P, et al. A directional strategy for monitoring Cre-mediated recombination at the cellular level in the mouse. Nat Biotechnol. 2003;21:562–5. doi: 10.1038/nbt811. [DOI] [PubMed] [Google Scholar]
- 46.Davis JR, Wang X, Witte IP, Huang TP, Levy JM, et al. Efficient in vivo base editing via single adeno-associated viruses with size-optimized genomes encoding compact adenine base editors. Nat Biomed Eng. 2022;6:1272–83. doi: 10.1038/s41551-022-00911-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Kong X, Li T, Yang H. AAV-mediated gene therapies by miniature gene editing tools. Sci China Life Sci. 2024;67:2540–53. doi: 10.1007/s11427-023-2608-5. [DOI] [PubMed] [Google Scholar]
- 48.Bocchi R, Masserdotti G, Gotz M. Direct neuronal reprogramming:fast forward from new concepts toward therapeutic approaches. Neuron. 2022;110:366–93. doi: 10.1016/j.neuron.2021.11.023. [DOI] [PubMed] [Google Scholar]
- 49.Challis RC, Ravindra Kumar S, Chen X, Goertsen D, Coughlin GM, et al. Adeno-associated virus toolkit to target diverse brain cells. Annu Rev Neurosci. 2022;45:447–69. doi: 10.1146/annurev-neuro-111020-100834. [DOI] [PubMed] [Google Scholar]
- 50.Verdera HC, Kuranda K, Mingozzi F. AAV vector immunogenicity in humans:a long journey to successful gene transfer. Mol Ther. 2020;28:723–46. doi: 10.1016/j.ymthe.2019.12.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Lakpour MR, Aghajanpour S, Koruji M, Shahverdi A, Sadighi-Gilani MA, et al. Isolation, culture and characterization of human sertoli cells by flow cytometry:development of procedure. J Reprod Infertil. 2017;18:213–7. [PMC free article] [PubMed] [Google Scholar]
- 52.Huang X, Yang D, Zhang J, Xu J, Chen YE. Recent advances in improving gene-editing specificity through CRISPR-Cas9 nuclease engineering. Cells. 2022;11:2186. doi: 10.3390/cells11142186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Gupta D, Bhattacharjee O, Mandal D, Sen MK, Dey D, et al. CRISPR-Cas9 system:a new-fangled dawn in gene editing. Life Sci. 2019;232:116636. doi: 10.1016/j.lfs.2019.116636. [DOI] [PubMed] [Google Scholar]
- 54.Wang SW, Gao C, Zheng YM, Yi L, Lu JC, et al. Current applications and future perspective of CRISPR/Cas9 gene editing in cancer. Mol Cancer. 2022;21:57. doi: 10.1186/s12943-022-01518-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Ribeiro LF, Ribeiro LF, Barreto MQ, Ward RJ. Protein engineering strategies to expand CRISPR-Cas9 applications. Int J Genomics. 2018;2018:1652567. doi: 10.1155/2018/1652567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Friedland AE, Baral R, Singhal P, Loveluck K, Shen S, et al. Characterization of Staphylococcus aureus Cas9:a smaller Cas9 for all-in-one adeno-associated virus delivery and paired nickase applications. Genome Biol. 2015;16:257. doi: 10.1186/s13059-015-0817-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Nishimasu H, Cong L, Yan WX, Ran FA, Zetsche B, et al. Crystal structure of Staphylococcus aureus Cas9. Cell. 2015;162:1113–26. doi: 10.1016/j.cell.2015.08.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Zheng C, Baum BJ. Evaluation of promoters for use in tissue-specific gene delivery. Methods Mol Biol. 2008;434:205–19. doi: 10.1007/978-1-60327-248-3_13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.O’Hara L, Smith LB. Androgen receptor roles in spermatogenesis and infertility. Best Pract Res Clin Endocrinol Metab. 2015;29:595–605. doi: 10.1016/j.beem.2015.04.006. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Graphical abstract of this study.
Exploration of AAV-mediated gene editing in Sertoli and Leydig cells. (a) Schematic representation of the two plasmids for SpCas9 gene editing system. (b) Co-staining of HA-tag in testes at 3 weeks post-injection of AAV9-SpCas9. Scale bars = 20 µm. (c) Schematic representation of AAV injection into the hypothalamus and corresponding stereofluorescence microscopy image of the hypothalamus at 3 weeks post-injection. Scale bars = 500 µm. (d) Immunostaining of the hypothalamus for HA-tag 3 weeks post-stereotaxic injection of AAV9-SpCas9. Scale bars = 20 µm. (e) Schematic representation of the AAV-SaCas9 plasmid. (f) Schematic representation of AAV injection into the hypothalamus. (g) Immunostaining of the hypothalamus section for HA-tag 3 weeks post-stereotaxic injection of AAV9-SaCas9. Scale bars = 20 µm. (h) Immunostaining of HA-tag in testes sections at 3 weeks post-injection of AAV9-SaCas9. Scale bars = 20 µm. (i) Schematic representation of the AAV-sgRNA-Cre-HA plasmid. (j) Schematic representation of stereotaxic injection of AAV-sgRNA-Cre-HA into the hypothalamus. (k) The fluorescence image of hypothalamus section 3 weeks after stereotaxic injection of AAV-sgRNA-Cre-HA in Rosa26-LSL-Cas9 mice. Scale bars = 20 µm. (l) Immunostaining for HA in testes 3 weeks after interstitial injection of AAV-sgRNA-Cre-HA in Rosa26-LSL-Cas9 mice. Scale bars = 20 µm. (m) Immunostaining for HA in testes 3 weeks after tubular injection of AAV-sgRNA-Cre-HA in Rosa26-LSL-Cas9 mice. Scale bars = 20 µm. DAPI: 4’,6-diamidino-2-phenylindole; ITR: inverted terminal repeat; CMV: cytomegalovirus; HA: hemagglutinin; sgRNA: single guide RNA; Cre: cyclization recombination enzyme; AAV: adeno-associated virus.
AAV-mediated Lhcgr gene editing in Leydig cells. (a) Schematic representation of Lhcgr sgRNA targets genomic locations. (b) Sanger sequencing chromatogram of the genomic targeting site for Lhcgr sgRNA in TM3 cell lines. (c) Evaluation of gene editing efficacies at the Lhcgr locus by T7EI nuclease assay for five distinct Lhcgr sgRNAs in TM3 cell lines. (d) The testis was interstitial injected with AAV9-sgCtrl and AAV9-sgLhcgr, respectively, and after 8 weeks, the appearance of the testis was photographed by stereofluorescence microscopy. Scale bars = 500 µm. (e) Immunostaining of Leydig cell-specific marker StAR in Leydig cells isolated from mouse testes at 8 weeks following interstitial injection of AAV9-sgCtrl and AAV9-sgLhcgr. Scale bars = 20 µm. (f) Agarose gel electrophoresis results displaying the T7EI-specific digestion products of genomic DNA isolated from Leydig cells after interstitial injection with AAV9-sgCtrl and AAV9-sgLhcgr. DNA (200 ng) was loaded per well. (g) Sanger sequencing chromatograms of genomic DNA isolated from Leydig cells after interstitial injection with AAV9-sgLhcgr. (h) H&E staining of testes and epididymides from mice after interstitial injection with AAV9-sgCtrl and AAV9-sgLhcgr. Scale bars = 20 µm. (i) The total count of free sperm, (j) the percentage of motile sperm, (k) the percentage of progressive sperm, (l) the percentage of static sperm, (m) the VAP, (n) the VCL, (o) the VSL, (p) the ALH, (q) the BCF, (r) the LIN, and (s) the STR in the cauda epididymis from mice tubular injection with AAV9-shCtrl and AAV9-shAr. Results are expressed as mean ± standard error of the mean. *P < 0.05, **P < 0.01, and ***P < 0.001 (Student’s t-test). HA: hemagglutinin; Lhcgr: luteinizing hormone/human chorionic gonadotropin receptor; StAR: steroidogenic acute regulatory protein; VAP: average path velocity; VCL: curvilinear velocity; VSL: straight-line velocity; ALH: amplitude of lateral head, BCF: beat cross frequency; LIN: linearity; STR: straightness; AAV: adeno-associated virus; H&E: hematoxylin and eosin; Cre: cyclization recombination enzyme; sgRNA: single guide RNA; NS: not significant.




