Reagents and tools table
| Reagent/resource | Reference or source | Identifier or catalog number |
|---|---|---|
| Experimental models | ||
| Human: HeLa Kyoto | Prof. Shuh Narumiya (Kyoto University) | RRID:CVCL_1922 |
| Human: U2OS | N/A | RRID:CVCL_0042 |
| Human: ARPE19 | ATCC | CRL-2302; RRID:CVCL_0145 |
| Human: HeLa ATXN3 KO | This paper | N/A |
| Human: U2OS ATXN3dTAG | This paper | N/A |
| Human: HeLa LAMP1-BFP | This paper | N/A |
| HeLa TMEM192-mKeima | Shima et al, 2023 | N/A |
| Bacteria: Escherichia coli BL21 (DE3) | New England Biolabs | C2527I |
| Bacteria: Escherichia coli XL1-Blue Competent Cells | Agilent | 200249 |
| Recombinant DNA | ||
| pcDNA5FRT/TO-Ataxin-3-Strep-HA | Hulsmann et al, 2018 | Addgene #113496 |
| pEGFP-N1-ATXN3 | This Paper | N/A |
| pmCherry-N1-ATXN3 | This Paper | N/A |
| pEGFP-N1-ATXN3-C14A | This Paper | N/A |
| pBlueScript-SK(+)-ATXN3 Homology Arms | This Paper | N/A |
| pCRIS-PITChv2-Puro-dTAG-BRD4 | Nabet et al, 201810.1038/s41589-018-0021-8 | Addgene #91793 |
| pBlueScript-SK(+)-ATXN3 Homology Arms-PuroR-P2A-HA-dTAG | This Paper | N/A |
| GFP-C1-PLCdelta-PH | Stauffer et al, 199810.1016/s0960-9822(98)70135-6 | Addgene #21179 |
| pcDNA3-Puro-LAMP1-eBFP2 | This Paper | N/A |
| pEGFP-N1-LAMP2 | This Paper | N/A |
| pmCherry-C2-TECPR1 | This Paper | N/A |
| pECMV-flag-STK38 | Devroe et al, 200410.1074/jbc.M401999200 | N/A |
| Antibodies | ||
| anti-ALIX | BioLegend | 634501 |
| anti-Ataxin-3 | BioLegend | 650402 |
| anti-FLAG | Sigma | F3165 |
| anti-Ataxin-3 CoraLite Plus 488-conjugated | Proteintech | CL488-67057 |
| anti-Galectin-3 | Santa Cruz Biotechnology | sc-23938 |
| anti-LAMP1 | Santa Cruz Biotechnology | sc-20011 |
| anti-LAMP1 | Cell Signaling | D2D11 |
| anti-LC3 | MBL | PM036 |
| anti-LAMP2 | Santa Cruz Biotechnology | sc-18822 |
| anti-CNN2 | Thermo Fisher Scientific | PA5-61878 |
| anti-p62/SQSTM1 | Abnova | H00008878-M01 |
| anti-GFP | Santa Cruz Biotechnology | sc-9996 |
| anti-GFP | Roche | 11814460001 |
| anti-IST1 | Proteintech | #51002-1-AP |
| anti-IST1 | Proteintech | #66989 |
| anti-Tubulin | Sigma | T-5168 |
| anti-P4D1 | Cell Signaling Technology |
3936; RRID:AB_331292 |
| anti-GAPDH | Sigma | G8795 |
| horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (WB, 1:10000) | Bio-Rad |
170-6515; RRID:AB_11125142 |
| horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (WB, 1:10000) | Bio-Rad |
1706516; RRID:AB_11125547 |
| Alexa Fluor-conjugated goat anti-rabbit, Alexa Fluor™ 568 (IF, 1:500) | Invitrogen |
A11011; RRID:AB_143157 |
| Alexa Fluor-conjugated goat anti-rabbit, Alexa Fluor™ 488 (IF, 1:500) | Life Technologies |
A11034; RRID:AB_2576217 |
| Alexa Fluor-conjugated goat anti-rabbit, Alexa Fluor™ 633 (IF, 1:500) | Thermo Fisher Scientific |
A21071; RRID:AB_2535732 |
| Alexa Fluor-conjugated goat anti-mouse, Alexa Fluor™ 488 (IF, 1:500) | Thermo Fisher Scientific | 10696113 |
| Alexa Fluor-conjugated goat anti-mouse, Alexa Fluor™ 594 (IF, 1:500) | Thermo Fisher Scientific |
A-11032; RRID:AB_2534091 |
| Alexa Fluor-conjugated goat anti-mouse, Alexa Fluor™ 633 (IF, 1:500) | Thermo Fisher Scientific | 10246252 |
| Alexa Fluor-conjugated goat anti-rat, Alexa Fluor™ 488 (IF, 1:500) | Thermo Fisher Scientific |
A-11006; RRID:AB_2534074 |
| Alexa Fluor-conjugated goat anti-rat, Alexa Fluor™ 568 (IF, 1:500) | Thermo Fisher Scientific |
A-11077; RRID:AB_2534121 |
| Alexa Fluor-conjugated goat anti-rat, Alexa Fluor™ 633 (IF, 1:500) | Thermo Fisher Scientific |
A-21094; RRID:AB_2535749 |
| NbSL3.3Q Nanobody | Lange et al, 2024 | n.a. |
| Oligonucleotides and other sequence-based reagents | ||
| sgRNA ATXN3dTAG (ACTCACTTTCTCGTGGAAGA) | This study, Microsynth | - |
| Ataxin-3 Double Nickase Plasmid | Santa Cruz | sc-417498-NIC |
| ATXN3 gPCR1 (5’-CCCCGTCTCCCACACAATTTA-3’) | This study, Microsynth | - |
| ATXN3 gPCR2 (5’- CAGCAGGCTAGGCAGACTAC-3’) | This study, Microsynth | - |
| ATXN3 seq1 (5’-TTCACTCGCTCTTCGCTTCA-3’) | This study, Microsynth | - |
| ATXN3 seq2 (5’-AGTTCTTGCAGCTCGGTGAC-3’) | This study, Microsynth | - |
| ATXN3 seq3 (5’-ATCATCCCACCACATGCCAC-3’) | This study, Microsynth | - |
| ATXN3 seq4 (5’-AAGCGATGGAAAGTGACGGA-3’) | This study, Microsynth | - |
| siATXN3 #1 UGGCAGAAGGAGGAGUUACTT | Wang et al, 2012 | - |
| siATXN3 #2 CAGGGCUAUUCAGCUAAGUAUTT | Sacco et al, 2014 | - |
| siATXN3 #3 GCACUAAGUCGCCAAGAAATT | Ashkenazi et al, 2017 | - |
| siATXN3 #4 GCAGGGCUAUUCAGCUAAGTT | Ashkenazi et al, 2017 | - |
| Chemicals, enzymes and other reagents | ||
| DMEM | PAN-Biotech | P04-03590 |
| DMEM/F12 | PAN-Biotech | P04-41150 |
| FBS | PAN-Biotech | P30-3306 |
| DPBS | PAN-Biotech | P04-36500 |
| Penicillin/Streptomycin | PAN-Biotech | P06-07100 |
| Imaging medium | PAN-Biotech | P04-03591 |
| Trypsin-EDTA | PAN-Biotech | P10-23100 |
| Lipofectamine 2000 | Thermo Fisher Scientific | 11668019 |
| Lipofectamine RNAiMax | Thermo Fisher Scientific | 13778150 |
| dTAGVHL | Tocris | 6914 |
| CB-5083 | Selleckchem | S8101 |
| AIPcS2a | Frontier Scientific | P40632 |
| Benzonase | Merck | 70746-4 |
| HindIII-HF | New England Biolabs | R3104S |
| BamHI-HF | New England Biolabs | R3136S |
| XhoI | New England Biolabs | R0146S |
| N-Ethylmaleimide (NEM) | Sigma-Aldrich | E3876-5G |
| Puromycin | Sigma | P8833-100MG |
| L-Leucyl-L-Leucine methyl ester hydrobromide (LLOMe) | Sigma | L7393 |
| Chloroquine diphosphate salt | Merck/Sigma-Aldrich | C6628-50G |
| Bafilomycin A1 | Biomol | 110038 |
| Lysotracker Deep Red | Thermo Fisher Scientific | L12492 |
| TRIzol Reagent | Thermo Fisher Scientific | 15596026 |
| Complete EDTA-free Protease Inhibitor Cocktail | Roche | 04693132001 |
| SuperSignal West Pico Chemiluminescent substrate | Pierce | 15669364 |
| ECL Prime Western Blotting Detection Reagent | Amersham | 12994780(RPN2236) |
| IPTG (Isopropyl-β-D-thiogalactopyranosid) | VWR | A1008.0100 |
| AF 568 NHS-Ester | Lumiprobe | 24820 |
| ProLong Gold | Thermo Fisher Scientific | P36930 |
| BC Assay Protein Quantification Kit | VWR | 733-1404 |
| SuperScript II Reverse Transkriptase | Thermo Fisher Scientific | 18064014 |
| Oligo (dT) 12-18 Primer 0,5 µg/µl | Thermo Fisher Scientific | 18418012 |
| Gibson Assembly Kit | Thermo Fisher Scientific | A46627 |
| DQ-BSA | Invitrogen | D12051 |
| Bouin’s solution | Carl Roth | 6482.3 |
| NHS-activated Sepharose 4 Fast Flow | VWR | 17-0906-01 |
| Software | ||
| Fiji | NIH |
RRID:SCR_002285 |
| Adobe Photoshop | Adobe Inc. (2021) |
https://www.adobe.com/products/photoshop.html RRID:SCR_014199 |
| Adobe Illustrator | Adobe Inc. (2021) |
http://www.adobe.com/products/illustrator.html RRID:SCR_010279 |
| CellProfiler software 44 (4.2.5) | Broad Institute; Stirling et al, 2021 |
RRID:SCR_007358 |
| CellProfiler software 44 (2.1.1) | Broad Institute |
RRID:SCR_007358 |
| cyto2 model | n.a. | Cutler et al, 2022 |
| Kaluza (version 2) | Beckman Coulter | RRID: SCR_016182 |
| Leica Application Suite X | Leica Microsystems |
https://www.leica-microsystems.com/products/microscope-software/details/product/leica-las-x-ls/ RRID:SCR_013673 |
| Andor iQ | Oxford Instruments |
http://www.andor.com/scientific-software/iq-live-cell-imaging-software RRID:SCR_014461 |
| Excel (2021) | Microsoft Corporation |
https://office.microsoft.com/excel RRID: SCR_016137 |
| SoftMax Pro | Molecular Devices | RRID:SCR_014240 |
| MaxQuant (1.6.0.1) | Cox and Mann, 2008; Cox et al, 2011 | RRID:SCR_014485 |
| GraphPad Prism 9.0 | GraphPad Software (San Diego, USA) |
RRID:SCR_002798 |
| Other | ||
| - | - | - |