Skip to main content
. 2002 May 14;99(10):6597–6602. doi: 10.1073/pnas.102577799

Table 3.

SFR1–SFR3 kinetic data

5′-TAATACGACTCACTATAGGGAGA
3′-ATTATGCTGAGTGATATCCCTCTXGCTAGGTTACGGCAGGATCGC
                 ↓ dNTP or rNTP
5′-TAATACGACTCACTATAGGGAGAN
3′-ATTATGCTGAGTGATATCCCTCTXGCTAGGTTACGGCAGGATCGC
X Single incorporation of correct dNTP kcat/KM, min−1⋅M−1 Single incorporation of correct rNTPkcat/KM, min−1⋅M−1
SF dT 2.77  × 105 8.3
dG 4.42  × 106 1.2  × 103
dC 3.03  × 106 1.5  × 103
dA 8.5  × 105 8.0
SFR1 dT 6.1  × 104 1.4  × 105
dG 2.8  × 105 7.0  × 105
dC 2.4  × 105 6.7  × 105
dA 1.5  × 105 1.0  × 105
SFR2 dT 3.1  × 104 7.9  × 104
dG 2.5  × 105 5.7  × 105
dC 1.7  × 105 3.8  × 105
dA 1.0  × 105 5.9  × 104
SFR3 dT 4.6  × 104 1.4  × 105
dG 5.0  × 105 1.3  × 106
dC 6.7  × 105 1.3  × 106
dA 1.6  × 105 9.7  × 104

Assay conditions: 40 nM template-primer, 0.11–1.34 nM SF, 20 mM Tris (pH 8.0), 10 mM MgCl2, 1 mM DTT, 50 μg/mL BSA. Reactions were initiated by adding the DNA-SF mixture to an equal volume (5 μl) of a 2 × NTP stock solution, incubated at 50 °C, and quenched by the addition of 20 μl 95% formamide, 20 mM EDTA. The reaction mixture (5 μl) was analyzed by 15% PAGE containing 8 M urea. Data shown are the average of three independent determinations.