Establishment and application of a dual real-time PCR assay for differential detection of PiAdV-1 and PiAdV-2 among pigeons in China in 2022–2023

Lu Chen; Jingjing Wang; Yufeng Liu; Yuteng Chen; Haiming Wang; Jinping Li; Wenming Jiang; Xiaohui Yu; Hualei Liu

doi:10.1371/journal.pone.0330417

. 2025 Sep 19;20(9):e0330417. doi: 10.1371/journal.pone.0330417

Establishment and application of a dual real-time PCR assay for differential detection of PiAdV-1 and PiAdV-2 among pigeons in China in 2022–2023

Lu Chen ^1,^☯, Jingjing Wang ^1,^☯, Yufeng Liu ^1,², Yuteng Chen ^1,³, Haiming Wang ^1,⁴, Jinping Li ¹, Wenming Jiang ¹, Xiaohui Yu ^1,^*, Hualei Liu ^1,^*

Editor: Ahmed Eisa Elhag⁵

PMCID: PMC12448338 PMID: 40971390

Abstract

Pigeon virus diarrhea is very common in the clinic, which has caused great damage to the pigeon industry. Pigeon adenovirus constitutes a significant pathogen responsible for pigeon viral diarrhea. Among them, Pigeon adenovirus 1 (PiAdV-1) and Pigeon adenovirus 2 (PiAdV-2) are the most common adenoviruses discovered in pigeon diseases in recent years. Infection with these viruses is common in clinical settings, which makes differential diagnosis more difficult. At present, real-time PCR is one of the most widely used techniques for the identification and detection of pathogens. This study presents the development of a dual real-time PCR assay designed specifically for the detection of PiAdV-1 and PiAdV-2. The dual real-time PCR assay developed in this study demonstrated satisfactory specificity, sensitivity, repeatability, and reproducibility, while showing no cross-reactivity with unrelated pathogens. The limit of detection (LOD) for PiAdV-1 is 94.8 copies/µL, and the LOD for PiAdV-2 is 88.4 copies/µL. This method was then used to analyze 20 liver tissue samples collected from dead pigeons, and the results were verified by genome sequencing. To understand the current epidemic status of pigeon adenovirus in China, the dual real-time PCR method established in this study was used to detect 500 pigeon swab samples collected from 10 provinces in China from 2022 to 2023. The results showed that the positive rates of PiAdV detected by the real-time PCR was 27.00% (135/500). PiAdV-1 single infection was detected in 8 cases (1.6%), PiAdV-2 single infection in 123 cases (24.6%), and PiAdV-1 and PiAdV-2 co-infection in 4 cases (0.8%). This study established a valuable tool for differentiating between PiAdV-1 and PiAdV-2 in practical applications and provided significant insights into the prevalence of these viruses in China.

Introduction

Adenovirus infection is a common infectious disease in poultry and other farm animals. Adenoviridae viruses are non-enveloped, and the diameter of their icosahedral capsid is approximately 90 nanometers. Their genomes are composed of linear double-stranded DNA and are approximately 25–48 kb in size [1]. The capsid proteins mainly consist of Hexon protein, Penton protein and Fiber protein [2,3], which contains specific antigenic determinants of type, group,and subgroup. According to the latest report of the International Committee on Taxonomy of Viruses (ICTV), the Aviadenovirus genus can be divided into 16 species, including Aviadenovirus leucophthalmi, Fowl adenovirus A-E, Duck adenovirus B, Pigeon adenovirus 1, Pigeon adenovirus 2 [4], Goose adenovirus A, Turkey adenovirus B-D, Psittacine aviadenovirus B-C, and Falcon adenovirus A [5]. Pigeon Adenovirus is a dual-stranded DNA virus lacking a viral envelope [6].

In pigeons, adenoviruses are known to cause two primary disease syndromes. The first is a severe form marked by lethargy and sudden death, with postmortem examination revealing hepatic necrosis. The second presents as a milder condition, commonly associated with young pigeon diseasey, characterized by symptoms such as anorexia, weight loss, diarrhea, and regurgitation [1]. In 1945, a classical PiAdV-1 was first detected in pigeons in Belgium and since then it has subsequently been identified in many parts of the world. Although pigeons of any age can be infected, young pigeons under one year old are more severely affected by PiAdV-1, presenting with vomiting, anorexia and acute watery diarrhoea. The feed intake of sick pigeons decreased significantly, which seriously affected the performance of racing pigeons [7–9]. Between 1990 and 1996, the positive rate for PiAdV-1 was 2.3% in pigeons submitted for etiological testing at Gent University [8]. The PiAdV-2 was detected until 1992 and the first case also occurred in Belgium [10]. PiAdV-2 affects pigeons of all ages and is characterized by sudden death and severe liver necrosis [7,11]. The distribution of the PiAdV-2 was investigated in fecal samples of healthy or young pigeon disease syndrome (YPDS) affected pigeons collected from different lofts between 2008 and 2015. Independent of health status, approximately 20% of young birds and 13% of adult pigeons contained the PiAdV-2 in their feces [5].

The diagnosis of pigeon adenovirus infection mainly relies on laboratory testing. Virus isolation and identification are the most definitive methods for confirming viral pathogenicity, while virus isolation for pigeon adenovirus is very difficult. Conventional PCR detection technology are common detection methods in laboratory diagnosis, while this method is more time-consuming and lower sensitivity compared with real-time PCR assays. The molecular detection methods such as conventional PCR assays and real-time PCR assays are currently the major methods used for the detection of pigeon adenovirus infection. PiAdV-1 and PiAdV-2 are two different species of viruses, with only 54.9% nucleotide sequence homology [5], and the clinical symptoms caused by PiAdV-1 and PiAdV-2 are also different. In order to accurately determine the pathogen, it is necessary to establish a high-throughput detection method that can distinguish the detection of PiAdV-1 and PiAdV-2, so as to facilitate rapid clinical diagnosis, achieve early detection, early isolation and early treatment of pigeon flocks, thereby reducing the losses of pigeon flocks, and on this basis, grasp the epidemic situation of PiAdVs in pigeon flocks in China.

In this study, a dual real-time fluorescent PCR assay for PiAdV-1 and PiAdV-2 with high specificity and sensitivity was established to provide technical support for the rapid clinical diagnosis of PiAdV-1 and PiAdV-2. Using this method, we conducted an epidemiological survey of two species of pigeon adenovirus on pigeon samples from a total of 10 provinces in China in 2022−2023 to understand the prevalence and distribution of PiAdV-1 and PiAdV-2 in China. At the same time, the representative positive samples were sequenced and the genetic evolutionary relationship was analyzed in order to provide reference for the comprehensive prevention and control of pigeon adenovirus.

Materials and methods

Ethics statement

This study was conducted according to the animal welfare guidelines of the World Organization for Animal Health and approved by the Animal Welfare Committee of the China Animal Health and Epidemiology Center. The approval number was DWFL-2023-07.

Primers and probes

For PiAdV-1 and PiAdV-2, we downloaded at least 19 genome sequences from NCBI for comparative analysis. Primers and probes were designed using Primer Premier 5 software, targeting the most conserved regions of these viruses. The PiAdV-1 probe is labeled with FAM at the 5’ end, and BHQ-1 is used as the 3’ terminal quencher. The PiAdV-2 probe is labeled with CY5 at the 5’ end and the 3’ quencher of BHQ-2 (Table 1). All of the primers and probes were synthesized by Sangon Biotech Corporation (Shanghai, China).

Table 1. Primers and probes used in this study.

Primer/probes	Sequences (5′—3′)	Genes	Amplicons
PiAdV-1-F1	GAGGACCTCCAGCAGTTCATC	Hexon
PiAdV-1-R1	TACGCGTTGGTGGTGTCATC		133 bp
PiAdV-1-P1	CAGCTACTTCGAGTTGCGCAACAAG
PiAdV-2-F1	TGGGHGAGCTSACYGATCTG	Hexon
PiAdV-2-R1	AAGCCATGGACAACACRTTC		174 bp
PiAdV-2-P1	CATGTATACGAACAACTCGCACAGCAT

Open in a new tab

Virus and samples collection

DNA samples of PiAdV-1 and PiAdV-2, Pigeon circovirus (PiCV), Pigeon herpesvirus (PiHV), along with RNA samples of Avian influenza virus (AIV), Newcastle disease virus (NDV), and Pigeon rotavirus A (RVA), were stored at −20°C in the Avian Disease Surveillance Laboratory at the China Animal Health and Epidemiology Center.

Liver tissue was dissected from 20 pigeons that showed clinical signs such as vomiting and diarrhea from ten pigeon farms in Shandong Province. All samples were homogenized in 1.5 mL of phosphate-buffered saline (PBS) supplemented with antibiotics, using a tissue-to-PBS ratio of 1:3. The homogenized samples were then centrifuged at 4°C and 12,000 rpm for 5 minutes to obtain the supernatant.

500 swabs (oropharyngeal swab and cloacal swab of one pigeon mixed in one tube) were randomly collected from apparently healthy pigeons at live bird markets (LBMs) across 10 provinces in China during an active national surveillance program conducted from 2022 to 2023 (Table 5). All samples were homogenized in 1.5 mL of PBS supplemented with antibiotics, followed by centrifugation at 4°C and 12,000 rpm for 5 minutes. The supernatants from these samples were then used for RNA/DNA extraction using the Fine Pure Virus DNA/RNA Column Extraction Kit (centrifugal column type) provided by JIFAN BIOTECH (Beijing, China).

Table 5. PiAdV-1 and PiAdV-2 dual real-time fluorescence PCR vs conventional PCR assay comparison of results.

Clinical sample	Dual PCR	Conventional PCR
Clinical sample	Positive sample (rate)	Positive sample (rate)
PiAdV-1	2(10%)	1(5%)
PiAdV-2	13(65%)	8(40%)

Open in a new tab

Condition optimization

The concentrations of the primers and probes were optimized. Following this optimization, the real-time PCR reaction was conducted in a total volume of 25 µL, comprising: 12.5 µL of 2 × Probe qPCR Mix MultiPlus, 2 µL of DNA templates, 0.7 µL of each primer (PiAdV-1-F1/R1) at a concentration of 10 µM, 0.9 μL of each primer (PiAdV-2-F1/R1) also at 10 µM, 0.8 µL of each probe (PiAdV-1-P1 and PiAdV-2-P1) at 10 µM, with the remaining volume made up by ddH₂O to reach a total of 5.7 µL. Amplification was carried out on the Applied Biosystems QuantStudio 5 platform (Thermo Fisher Scientific, USA), under the following conditions: an initial denaturation at 95°C for 20 seconds, followed by 45 cycles of 95°C for 1 second and 60°C for 20 seconds. The fluorescent signal was measured at the end of the extension phase in each cycle.

Standard curve generation

Amplified fragments generated with the primer pairs PiAdV-1 F1/R1 and PiAdV-2 F1/R1 were synthesized and subsequently cloned into the pEASY-T5 vector. Using the NanoDrop 2000 spectrophotometer, the concentration of the recombinant plasmid was quantified, and the copy number was calculated as follows: y(copies/μL) = (6.02 × 10²³) × (ng/µL × 10⁻⁹)/ (DNAlength×660). Serial dilutions of the standard plasmid, in 10-fold increments, were then prepared and used as templates to construct the standard curve for the real-time PCR assay.

Specificity, sensitivity and repeatability

To assess the specificity of the established dual real-time PCR assay, RNA samples from AIV, NDV, and RVA, as well as DNA samples from PiCV and PiHV were utilized. The sensitivity and LOD of the dual real time PCR were determined using 10-fold serial dilutions of standard plasmids.

The repeatability experiment was conducted in triplicate under optimized reaction conditions. It involved three serial 10-fold dilutions for PiAdV-1, ranging from 1.0 × 10⁹ to 1.0 × 10⁷ copies/µL, and for PiAdV-2, from 1.0 × 10⁶ to 1.0 × 10⁴ copies/µL. For each assay, the intra- and inter-group coefficients of variation (CV) were calculated.

Clinical sample detection

The PiAdV-1 and PiAdV-2 dual real-time PCR assay established in this study was used to detect 20 pigeon clinical samples. The results were compared and analyzed with those of the conventional PCR [5,12] (Table 2) methods and sequencing results commonly used in the clinic.

Table 2. Primers used in this study.

Primes	Sequence (5’-3’)	Genes	Amplicons
PiAdV-1-F2	ATCAACTACGACAACGAAGGC	Fiber-2	967 bp
PiAdV-1-R2	CGGTAGAGTTACGGGGAAATT	Fiber-2	967 bp
PiAdV-2-F2	GTAACATGAGCGTGCTGTTTG	Hexon	643 bp
PiAdV-2-R2	CTGAGAAACGAAACCCGAATTG	Hexon	643 bp

Open in a new tab

Epidemiological surveillance of PiAdV-1 and PiAdV-2 in China from 2022 to 2023

The dual fluorescence quantitative PCR method established in this study was used to detect 500 swab samples collected randomly at LBMs in 10 provinces of China from 2022 to 2023 with Probe qPCR Mix MultiPlus kit. The distribution and positive rate of PiAdV-1 and PiAdV-2 were analyzed.

Sequencing and phylogenetic analysis

Fifteen pigeon adenovirus strains isolated from different provinces were selected for sequencing and phylogenetic analysis. The Hexon gene of pigeon adenovirus was amplified by conventional PCR [5], and the PCR products were analyzed by 1% agarose gel electrophoresis. The amplified products were then sequenced by Qingdao Ruibo Biotechnology Co., Ltd. Reference strains with different host origins and genotypes were downloaded from the GenBank database (Table 3). Phylogenetic analysis was performed using MEGA 6 software, and the neighbor-joining method was employed to construct the genomic evolutionary tree with 1,000 bootstrap replicates for validation. Additionally, MegAlign software was used for genomic homology analysis.

Table 3. Adenoviruses representative strain information.

Strain name	Nation	Host	Year	GenBank
PAV/FJ2017	China	Pigeon	2017	MF576429
M144	Hungary	Pigeon	2011	KX673408
AH712	China	Chicken	2016	KY436522
CH/AHBZ/2015	China	Chicken	2015	KU569295
GDMZ	China	Chicken	2016	MG856954
AG234-CORR	Mexico	Chicken	1995	MK572849
08-17832	French	Chicken	2008	MK572857
TNI1	---	Turkey	---	NC022612
340	Irish	Chicken	1970	KC493646
JM1/1	Japan	Chicken	2000	MF168407
FAdV-1	China	Fowl	2017	MK050972
1277BT	---	Turkey	---	NC022613
P29	Hungary	Goose	---	JF510462
P29	Hungary	Goose	---	NC017979
AHAQ13	China	Duck	2017	MH777396
PL-pigeon-63/2023	Polish	Pigeon	2023	PP999622
PL-pigeon-4a/2023	Polish	Pigeon	2023	PP999623
CH-GD-12–2014	China	Duck	2014	KR135164
P18-05523–6	Australia	Pigeon	2018	MW286325

Open in a new tab

Results

Standard curve of the dual real-time PCR

The dual real-time PCR assay were generated using the concentrations ranged from 9.48 × 10⁹ to 9.48 × 10⁵ copies/μL for PiAdV-1 and from 8.84 × 10⁷ to 8.84 × 10³ copies/μL for PiAdV-2. The standard equations are as follows (Fig 1): PiAdV-1:Y = −2.815X + 37.073, R² = 0.998, PiAdV-2:Y = −3.570X + 38.625, R² = 0.997. The results demonstrate the high efficiency and reliability of the newly developed dual real-time PCR assays.

Specificity, sensitivity and repeatability

The ampliﬁcation curves showed that only corresponding FAM and CY5 signals for PiAdV-1 and PiAdV-2, and negative for the AIV, RVA, NDV, PiCV, PiHV and ddH₂O (Fig 2). The above results indicated that the established assay had high speciﬁcity.

The sensitivity of the dual real-time PCR assay was assessed using 10-fold serial dilutions of standard plasmids, with concentrations ranging from 9.48 × 10⁵ to 9.48 × 10⁰ copies/μL for PiAdV-1 and from 8.84 × 10⁵ to 8.84 × 10⁰ copies/μL for PiAdV-2. Distilled water (ddH₂O) served as the negative control. The results indicated that the LOD for the assay was 9.48 × 10¹ copies/μL for PiAdV-1 and 8.84 × 10¹ copies/μL for PiAdV-2. (Fig 3).

Fig 3 — Labels 0–5 indicate different concentrations of plasmids, ranging from 9.48 × 10⁵ to 9.48 × 10⁰ copies/μL for PiAdV-1 and from 8.84 × 10⁵ to 8.84 × 10⁰ copies/μL for PiAdV-2, respectively.

The repeatability and reproducibility of the dual real-time PCR assay were evaluated using different concentrations of the corresponding standard plasmids. The intra-assay coefficient of variation (CV) was less than 0.02%, and the inter-assay CV was less than 0.03%, demonstrating that the dual real-time PCR assay offers high repeatability and reproducibility (Table 4).

Table 4. Intra-repeatability and inter-reproducibility of the dual real-time PCR assay.

Virus	Standard (μL)	CT	Intra-Reproductivity			CT	Inter-Reproductivity
Virus	Standard (μL)	CT	Mean	SD	CV/%	CT	Mean	SD	CV/%
PiAdV-1	1 × 10⁹	11.153	11.043	0.10	0.01	11.588	11.161	0.37	0.03
		10.979				10.892
		10.998				11.002
	1 × 10⁸	13.625	13.621	0.08	0.01	12.983	13.168	0.19	0.01
		13.544				13.154
		13.694				13.368
	1 × 10⁷	16.143	16.164	0.09	0.01	16.089	16.176	0.08	0.00
		16.084				16.237
		16.265				16.203
PiAdV-2	1 × 10⁶	17.301	17.330	0.07	0.00	17.529	17.532	0.06	0.00
		17.279				17.477
		17.411				17.589
	1 × 10⁵	21.101	21.007	0.09	0.00	21.225	21.210	0.10	0.00
		20.994				21.301
		20.927				21.103
	1 × 10⁴	23.570	24.122	0.49	0.02	23.984	24.205	0.24	0.01
		24.493				24.177
		24.303				24.454

Open in a new tab

Clinical sample detection

The PiAdV-1 and PiAdV-2 dual real-time PCR method developed in this study was used to detect 20 samples with clinical suspicion of pigeon adenovirus infection. The results showed that two PiAdV-1 positive samples (10%), and thirteen PiAdV-2 positive samples (65%) were detected, followed by sequencing confirmed that 15 positive products were all pigeon adenovirus gene fragments. However, only one positive sample of PiAdV-1 and eight positive samples of PiAdV-2 were detected by conventional PCR using Table 2 primers (Table 5). The concordance rate between the two methods was 70.00%, with a Kappa value of 0.67.

Epidemiological surveillance of PiAdV-1 and PiAdV-2 in China from 2022 to 2023

Oropharyngeal and cloacal swabs (n = 500) were collected from symptomless pigeons at LBMs in 10 provinces of China from 2022 to 2023. A total of 135 Pigeon adenovirus positive samples were detected by the dual real-time PCR assay in the 10 surveyed provinces of Hunan, Henan, Jiangsu, Sichuan, Anhui, Guangxi, Guizhou, Hubei, Guangdong, and Jiangxi. The total positive rate of Pigeon adenovirus was 27.00% (135/500) (Table 6). The positivity rates of PiAdV-1 and PiAdV-2 were 2.4% (12/500) and 25.4% (127/500), respectively. There were 8 positive samples with single PiAdV-1 (1.6%), 123 positive samples with single PiAdV-2 (24.6%), and 4 positive samples with PiAdV-1 and PiAdV-2 together (0.8%). The positive rate in Guizhou was the highest (51.43%) and the positive rate in Anhui was the lowest (8.51%).

Table 6. Positive annual rates of Pigeon adenovirus detection in 2022-2023.

Provinces	number of samples	single PiAdV-1	single PiAdV-2	PiAdV-1 + PiAdV-2	Positive rate (%) (95%CI)
Guangdong	40	0	9	0	22.50(9.56-35.44)
Hubei	47	1	4	0	8.51(0.53-16.49)
Jiangxi	70	1	27	2	41.43(29.89-52.97)
Anhui	48	2	2	0	8.33(0.51-16.15)
Guangxi	70	3	14	1	25.71(15.47-35.95)
Guizhou	35	0	18	0	51.43(34.87-67.99)
Jiangsu	79	0	12	0	15.19(7.28-23.10)
Sichuan	15	0	2	0	13.33(3.87-30.53)
Hunan	28	0	9	0	32.14(14.84-49.44)
Henan	68	1	26	1	41.18(29.48-52.88)
Total	500	8	123	4	26.60(22.73-30.47)

Open in a new tab

Sequencing and phylogenetic analysis

Fifteen representative viral strains from different regions were sequenced, and the phylogenetic tree of pigeon adenovirus Hexon gene was analysed. The results of phylogenetic analysis showed that 10 samples belonged to the PiAdV-2 subtype and 5 samples belonged to the PiAdV-1 subtype (Fig 4). The pigeon adenovirus positive samples of C2182, A2023, J2477, E2459, Q2428, X2236 and K2457 in this study all belong to the variant B subbranch of PiAdV-2, which is the closest relative to the PAV/F2017 [11] strain detected in China in 2018, with nucleotide homology ranging from 99.5% to 99.7%. The G2567, S2569 and H2021 belonged to the variant A subbranch of PiAdV-2, and were closely related to YPDS-Y-V1 and M144 strains detected in China, with nucleotide homology ranging from 87.6% to 99.7%. The positive samples of H2374, X2296, A2452, S2227 and E2334 all belonged to the PiAdV-1, and were closely related to P18-05523–6 strains detected in 2021, with nucleotide homology of 99.5%.

Fig 4 — Samples indicated by “●●” represent the positive samples tested in this study.

Discussion

In recent years, the pigeon raising industry in China has gradually developed in industrialization and scale. The number of pigeons raised has increased year by year in China, and people have paid more and more attention to the disease in pigeon flocks. PiAdV-1 and PiAdV-2 are common pathogens in pigeons. The pigeons infected with PiAdV-1 and PiAdV-2 mainly show vomiting and digestive stagnation [13], followed by dehydration, temperature rise, weight loss, green water excretion or other phenomena [14,15]. The effects of PiAdV-1 infection on pigeons are strikingly similar to YPDS in that it primarily affects young pigeons and manifests with diarrhea, vomiting and weight loss for about a week [9,11]. PiAdV-2 affects pigeons of all ages and is characterized by sudden death and extensive liver lesions. Immunocompromised pigeons inoculated with dexamethasone treated liver homogenate supernatant of natural infection cases could reproduce the disease [7]. When PiAdV-1 or PiAdV-2 infected pigeons alone, the mortality rate was low. However when PiAdV-1 or PiAdV-2 infected pigeons with other pathogens, the mortality rate of pigeons increased significantly, which caused serious economic losses to the pigeon industry. Kalpana [16] reported a case of sudden death in 28 pigeons in 2018, which showed that all 28 pigeons died from a combination of PiAdV-1 and pigeon torque teno virus (PTTV). Chen et al [4] showed that the prevalence of PiAdV-2 was 37.14% in YPDS racing pigeons and 20.93% in healthy racing pigeons.

Early diagnosis of pathogens is a key factor in prevention and control of PiAdV [17]. In 2002, Raue et al.[12] developed a conventional PCR using the PiAdV-1 fiber. In 2024, Chen et al. [4] developed a TaqMan-qPCR assay using the PiAdV-2 fiber-2 gene by designing specific primers and probes. Łukaszuk et al.[1] developed a TaqMan qPCR assay targeting a 135 bp fragment of the PiAdV-2 protease-coding gene. At present, there are only separate nucleic acid detection methods based on PiAdV-1 and PiAdV-2. Therefore, it is urgent to establish a sensitive and specific high-throughput rapid detection method for PiAdV-1 and PiAdV-2, providing technical reserves for the rapid clinical diagnosis of PiAdV-1 and PiAdV-2 [11], to achieve early detection, early isolation and early treatment of pigeon flock, thereby reducing the loss of pigeon flocks. In this study, specific primers and probes were designed based on the conserved Hexon gene sequences of PiAdV-1 and PiAdV-2 in pigeons, and the reaction system and reaction conditions were optimized to establish a dual real-time fluorescent PCR method for detection of PiAdV-1 and PiAdV-2. The detection method has strong specificity, high sensitivity and good repeatability. Only the nucleic acid of PiAdV-1 and PiAdV-2 showed a specific amplification curve. The lowest detection limits were 94.8 copies/µL and 88.4 copies/µL, respectively. The coefficient of variation of PiAdV-1 and PiAdV-2 was less than 0.03%, which showed good repeatability. The pigeon adenovirus dual real-time fluorescent PCR method established in this study and the conventional PCR method were used to detect the etiology of 20 clinically suspected PiAdV infection samples. The results showed that two PiAdV-1 positive samples and thirteen PiAdV-2 positive sample were detected. Meanwhile, all positive samples were confirmed by sequencing. However, only one positive sample of PiAdV-1 and eight positive samples of PiAdV-2 were detected by conventional PCR. It is suggested that the pigeon adenovirus dual real-time fluorescent PCR method established in this study has higher sensitivity and good clinical diagnostic performance than the conventional PCR method. In summary, this study established a rapid, sensitive, specific and accurate dual real-time fluorescent PCR detection method for PiAdV-1 and PiAdV-2, providing necessary technical support for the early diagnosis and comprehensive prevention and control of PiAdV-1 and PiAdV-2.

In order to understand the epidemiologic state of PiAdV-1 and PiAdV-2 in pigeon flocks in China, a total of 500 oropharyngeal and cloacal swabs were collected from LBMs in 10 provinces in China from 2022 to 2023, and the dual fluorescent PCR established in this study was used to detect PiAdV-1 and PiAdV-2. The result showed that 135 positive samples were detected, in surveyed 10 provinces with a positive rate of 27.00%, and the highest positive rate was 51.43% in Guangzhou Province. Overall, PiAdvs showed a relatively high epidemic trend in China. PiAdV-1 single infection was detected in 8 cases (1.6%), PiAdV-2 single infection in 123 cases (24.6%), and PiAdV-1 and PiAdV-2 co-infection was detected in 4 cases (0.8%), which showed that the PiAdV-2 was the dominant virus in Chinese pigeons. At the same time, there was a phenomenon of PiAdV-1 and PiAdV-2 co-infection in the pigeons, but the infection rate is not high. In the clinical detection of diseased pigeon samples in our lab, we also detected PiAdV-1 single infections, PiAdV-2 single infections, and mixed infections of PiAdV-1 and PiAdV-2. The clinical detect results showed that PiAdV-2 was detected more frequently than PiAdV-1, which is basically consistent with the results of our epidemiological investigation. Overall, the prevalence of PiAdV-2 is much higher than that of PiAdV-1 and it is the dominant strain in pigeon flocks in China. While we were unsuccessful in isolating the virus, we cannot conduct animal regression tests to determine their pathogenicity. In 1993−1994, Herdt et al.[7] found that 151 pigeons out of 988 were infected with PiAdV-2 among the Belgian pigeon population. Mónika [18] conducted a 4-year survey of healthy and sick pigeons in 27 lofts in Hungary and showed that the pigeon adenovirus positivity rate was as high as 50%. These indicated that pigeon adenovirus was widespread in pigeons all over the world.

For 15 representative positive virus strains from different provinces detected by dual real-time PCR that were sequenced by using the primers specific. The phylogenetic analysis revealed that 10 strains were PiAdV-2 and 5 strains were PiAdV-1. Among the 10 PiAdV-2 strains, the homology of 7 strains with the Chinese PAV/F2017 strain was 99.5% − 99.7%, forming conformed clusters (variation B), suggesting the existence of epidemiological associations. The other three strains of PiAdV-2 (variant A) have a genetic diversity of 87.6–99.7% compared with the domestic reference sequence, indicating that there are variations in their evolution. All five PiAdV-1 strains and the reference sequence showed high conservation (99.5%), which might reflect a slower evolution. These findings demonstrate the genetic diversity of PiAdV in pigeon flocks in our country, which also indicates the difficulty in the prevention and control of PiAdV in China.

In summary, a dual real-time PCR assay for differential detection of PiAdV-1 and PiAdV-2 was successfully established in this study, which showed good specificity, sensitivity, repeatability, and feasibility. In addition, the prevalence of PiAdV-1 and PiAdV-2 infection in pigeon flocks in China was first evaluated using this established method, and the results showed that pigeon adenovirus was widely distributed and has a high positive rate in pigeon flocks in China. Therefore, continued surveillance studies and the PiAdV-1 and PiAdV-2 vaccine development should be carried out to control PiAdV-1 and PiAdV-2 infection in pigeons in China.

Acknowledgments

This study was funded by the National Key Research & Development Program (2022YFD1800600).The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Data Availability

All relevant data are within the paper.

Funding Statement

References

1.Łukaszuk E, Dziewulska D, Prątnicka A, Custer JM, Kraberger S, Varsani A, et al. Characterization, phylogeny and prevalence of the coding-complete genomes of aviadenoviruses and siadenovirus in young racing pigeons. Virology. 2025;603:110400. doi: 10.1016/j.virol.2025.110400 [DOI] [PubMed] [Google Scholar]
2.Benk M, Harrach B. Molecular evolution of adenoviruses. Current Topics in Microbiology and Immunology. 2003;272:3–35. [DOI] [PubMed] [Google Scholar]
3.Niczyporuk JS, Kozdruń W, Czekaj H, Styś-Fijoł N, Piekarska K. Detection of fowl adenovirus D strains in wild birds in Poland by Loop-Mediated Isothermal Amplification (LAMP) [J]. BMC veterinary research, 2020, 16(1): 58. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Chen C, Zhu C, Chen Z, Cai G, Lin L, Zhang S, et al. Rapid detection of pigeon adenovirus 2 using a TaqMan real-time PCR assay. Poult Sci. 2024;103(7):103848. doi: 10.1016/j.psj.2024.103848 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Teske L, Rubbenstroth D, Meixner M, Liere K, Bartels H, Rautenschlein S. Identification of a novel aviadenovirus, designated pigeon adenovirus 2 in domestic pigeons (Columba livia). Virus research. 2017;227:15–22. [DOI] [PubMed] [Google Scholar]
6.Zhang X, Zhong Y, Zhou Z, Liu Y, Zhang H, Chen F, et al. Molecular characterization, phylogeny analysis and pathogenicity of a Muscovy duck adenovirus strain isolated in China in 2014. Virology. 2016;493:12–21. doi: 10.1016/j.virol.2016.03.004 [DOI] [PubMed] [Google Scholar]
7.De Herdt P, Ducatelle R, Lepoudre C, Charlier G, Nauwynck H. An epidemic of fatal hepatic necrosis of viral origin in racing pigeons (Columba livia). Avian Pathol. 1995;24(3):475–83. doi: 10.1080/03079459508419087 [DOI] [PubMed] [Google Scholar]
8.Wada Y, Kondo H, Nakazawa M, Kubo M. Natural infection with attaching and effacing Escherichia coli and adenovirus in the intestine of a pigeon with diarrhea. J Vet Med Sci. 1995;57(3):531–3. doi: 10.1292/jvms.57.531 [DOI] [PubMed] [Google Scholar]
9.Freick M, Müller H, Raue R. Rapid detection of pigeon herpesvirus, fowl adenovirus and pigeon circovirus in young racing pigeons by multiplex PCR. J Virol Methods. 2008;148(1–2):226–31. doi: 10.1016/j.jviromet.2007.11.003 [DOI] [PubMed] [Google Scholar]
10.Schachner A, Matos M, Grafl B, Hess M. Fowl adenovirus-induced diseases and strategies for their control - a review on the current global situation. Avian Pathol. 2018;47(2):111–26. doi: 10.1080/03079457.2017.1385724 [DOI] [PubMed] [Google Scholar]
11.Vereecken M, de Herdt P, Ducatelle R. Adenovirus infections in pigeons: A review. Avian Pathol. 1998;27(4):333–8. doi: 10.1080/03079459808419348 [DOI] [PubMed] [Google Scholar]
12.Raue R, Hafez HM, Hess M. A fiber gene-based polymerase chain reaction for specific detection of pigeon adenovirus. Avian Pathol. 2002;31(1):95–9. doi: 10.1080/03079450120106660 [DOI] [PubMed] [Google Scholar]
13.Goryo M, Ueda Y, Umemura T, Haruna A, Itakura C. Inclusion body hepatitis due to adenovirus in pigeons. Avian Pathol. 1988;17(2):391–401. doi: 10.1080/03079458808436457 [DOI] [PubMed] [Google Scholar]
14.Wan C, Chen C, Cheng L, Fu G, Shi S, Liu R, et al. A TaqMan-based real-time PCR for detection and quantification of newly identified novel pigeon adenovirus. J Virol Methods. 2018;261:6–9. doi: 10.1016/j.jviromet.2018.07.017 [DOI] [PubMed] [Google Scholar]
15.Hess M, Prusas C, Monreal G. Growth analysis of adenoviruses isolated from pigeons in chicken cells and serological characterization of the isolates. Avian Pathol. 1998;27(2):196–9. doi: 10.1080/03079459808419323 [DOI] [PubMed] [Google Scholar]
16.Agnihotri K, Smith C, Oakey J, Storie G. Pigeon adenovirus and pigeon torque teno virus associated with acute multifocal hepatic necrosis in pigeons in Queensland, Australia. Arch Virol. 2021;166(5):1469–75. doi: 10.1007/s00705-021-05033-x [DOI] [PubMed] [Google Scholar]
17.Wang CH, Chang CM. Pathogenicity and gene analysis of adenovirus from pigeons with inclusion body hepatitis. J Vet Med Sci. 2000;62(9):989–93. doi: 10.1292/jvms.62.989 [DOI] [PubMed] [Google Scholar]
18.Ballmann MZ, Harrach B. Detection and partial genetic characterisation of novel avi- and siadenoviruses in racing and fancy pigeons (Columba livia domestica). Acta Vet Hung. 2016;64(4):514–28. doi: 10.1556/004.2016.047 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0330417.r001

Decision Letter 0

Ahmed Eisa Elhag

29 Jan 2025

Dear Dr. Chen,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

ACADEMIC EDITOR:

Dear Dr Chen,

Your manuscript, "Establishment and application of a dual real-time PCR assay for differential detection of PiAdV-A and PiAdV-B among pigeons in China in 2022-2023", has now been assessed.

We invite you to revise your paper, carefully addressing the comments from the reviewers. Please ensure the results are accurately reported, any overstated conclusions are rewritten and the limitations of the work fully explained. When your revision is ready, please submit the updated manuscript and a point-by-point response. This will help us move to a swift decision.

==============================

Please submit your revised manuscript by Mar 15 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Ahmed Eisa Elhag

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for submitting your work to PLOS ONE. We note that you have not mentioned the source of tissue samples from pigeons used in this study. Before we can continue with your submission, kindly mention the details in the Method section. Thank you for your attention to this request. We look forward to hearing from you.

3. We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed:

https://www.mdpi.com/1999-4915/15/6/1238

https://onlinelibrary.wiley.com/doi/10.1111/tbed.14464

In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed.

4. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

5. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.

6. We note that Figure 4 in your submission contain [map/satellite] images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

a. You may seek permission from the original copyright holder of Figure 4 to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an ""Other"" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

==============================

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously? -->?>

Reviewer #1: N/A

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available??>

The PLOS Data policy

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English??>

Reviewer #1: Yes

Reviewer #2: Yes

**********

Reviewer #1 : 1. The ICTV information provided for Adenovirus in the introduction is not up to date. It would be appropriate to change this information to its current state.

2. The distinction between RNA and DNA viruses presented under the heading "2.5 Specificity and Sensitivity" was made incorrectly. In addition, the same abbreviation was used for both coronavirus and circovirus. It would be appropriate to correct these errors.

3. The data presented in Table 3 and Table 5 are a bit confusing. (Example: Do PiAdV-A and PiAdV-B have the same virus dilution copies? It would be more appropriate to write the positive rate separately in Table 5.)

Reviewer #2 : This manuscript aimed to validate a reliable analytical method for direct and dual detection of PiAdV-A and PiAdV -B genome by real-time PCR in pigeon samples. The authors claim that their validated PCR assay provide accurate and reliable screening to detect and differentiate PiAdV-A and PiAdV-B, and provide valuable information on the prevalence of PiAdV in China. They report that their method could be a useful tool in practice for detection of PiAdV and to provide information on epidemiologic surveillance of PiAdV. Indeed, in the literature, few studies are available on PiAdV detection methods and little is known about PiAdV prevalence in China. The study provides a detection method for PiAdV genome direct detection by PCR, even though the LOD should be determined more precisely. The study also provide data about PiAdV prevalence in China. A number of clarifications are required.

Major comments:

The exact usefulness of the differentiation of PiAdV-A and B is not clear in the introduction and the discussion. Aside from the epidemiological surveillance, how useful is the dual detection in routine farm diagnosis? Line 64-65, the authors mentioned that distinction between PiAdV-A and B is mandatory for “rapid clinical diagnosis”. Why the detection of total PiAdV is not sufficient to contain epidemics in breeding farms and what will the dual detection change in the management of epidemics in a breeding farm? The PiAdV-A prevalence appears to be very low compare to type B. Why is it relevant to differentiate between the two types in routine diagnosis?

The authors should develop these points in the introduction and discussion.

Most papers about PiAdV talk about PiAdV type 1 or 2 and not variant A and B (Teske et al. 2017; Chen et al. 2024).

Line 36. Ref 2 about “Falcon adenovirus B” refer to a paper that identified PiAdV type 2, with variant A and B that belong to the PiAdV-2. This is very confusing. The authors speak about PiAdV-1 and 2 or A and B belonging to PiAdV-2? In the phylogenetic tree of the present study (figure 5), types identified are 1 and 2 and not A and B. This is very confusing. Please revised the nomenclature.

The comments below retain the original A and B nomenclature of the manuscript under revision.

Lines 52-54. Confusing. How it can be clear that the disease has been prevalent in China? Line 63, the authors mentioned that the prevalence is not clear in China. If the prevalence is not known, so are the economic losses, and studies are needed to assess prevalence in China and the associated economic losses. Please revise this point.

Lines 55-59. The authors mentioned that the virus isolation is the more reliable detection method. Is it a general comment or specific to PiAdV detection? Has virus isolation been used for PiAdV diagnosis? Is there some studies showing better PiAdV detection with virus isolation than PCR? Real-time PCR is usually highly sensitive.

Lines 57-60. Serum neutralizing antibody technology is not a common method for viral detection in laboratory, but useful for specific studies about protection of an individual or a population against a virus (seroprevalence). Seroprevalence of PiAdV neutralizing antibodies could be an interesting tool to determine the circulation of PiAdV in pigeons and for epidemiological surveillance. The added-value of seroprevalence and serum neutralizing antibody technology may be broach in the discussion and not the introduction.

Line 121. Please specify if testing for a single dilution was performed from one tube or from three different samples (for example three different samples of 9.48x10^9 copies of PiAdV-A). The guidelines from World Organisation for Animal Health (WOAH - “PRINCIPLES AND METHODS OF VALIDATION OF DIAGNOSTIC ASSAYS FOR INFECTIOUS DISEASES” p11) specify that “It is not acceptable to prepare a final working dilution of a sample in a single tube from which diluted aliquots are pipetted into reaction vessels, or to create replicates from one extraction of nucleic acid rather than to extract each replicate before dilution into the reaction vessels. Such ‘samples’ do not constitute valid replicates for repeatability studies”.

Line 131. About the conventional PCR. Reference 12 refer to a panadenovirus nested-PCR, and reference 13 to a PCR detecting specifically total PiAdV. Have these two methods been performed and shown the same results? Please clarify which conventional PCR has been performed in the present study. Specify the LOD of the conventional PCR assay if known.

Table 4. Indicate more clearly in the table which one is the conventional PCR and which one is the dual.

Line 147. How many negative sample (ddH2O) were tested?

Lines 153-156. How many times each point of the 10-fold serially diluted standard plasmids have been tested to determine the LOD for PiAdV-A and B genome? It is frequent to see 3 to 5 testing for each dilution of the standard, to ensure the 100% positive detection for the last point. A single test for each dilution is not robust enough. Did the authors test additional dilution beyond 94.8 or 88.4 copies/µL and 0 copy /µL?

“With a 10-fold serially diluted standard plasmids, the last dilution showing 100% response may be accepted as a conservative estimate of the lower limit of detection. A more accurate estimate may be obtained by a second stage experiment using narrower intervals in the dilution scheme focusing on the region between 100% and 0%” (i.e. in this study, between 94.8 or 88.4 and 0 copy/µL in this study) (ref WOAH- “PRINCIPLES AND METHODS OF VALIDATION OF DIAGNOSTIC ASSAYS FOR INFECTIOUS DISEASES”)

Discussion.

The authors claim that the method developed for dual detection is satisfactory, but the limit of detection is higher than the LOD of 34 copies /µL for PiAdV-2 PCR developed by Chen et al. 2024. This point should be discussed, in addition to the added value of the dual real-time PCR developed by the authors in comparison with the results of Chen et al. 2024.

Line 194-196. The authors mentioned that the co-infection between PiAdV and other pathogens increase the mortality rate of pigeons. Information about co-infection with PTTV appear later, line 231. This is confusing. Is there a point to discuss about co-infection with other pathogens and PiADV-A and –B infection?

Could the type of PiAdV affect the mortality rate during such co-infection? Is it important to develop a multiplex PCR detecting those pathogens and PiAdV rather than differentiating PiAdV-A and B?

The authors should clarify their point about co-infection with other pathogens and their results.

Minor comments:

The authors mentioned a limit of detection of 10^1 copies/µL for PiAdV-A and B in the abstract, but 94.8 copies for PiAdV-A and 88.4 for PiAdV-B are mentioned in the results and discussion. Indicate the exact LOD for each PiAdV type in the abstract and homogenise in the results. No need for 101, the entire number is more comprehensible.

Line 55. Can the authors specify if the diagnosis of total PiAdV by PCR is routinely used in breeding farms, in case of pigeon diarrhoea or death?

Line 92. Please specify what type of tissue samples (n=20) from pigeons were tested.

Lines 220-221. Is it known if a high morbidity or mortality rate of pigeons in the breeding farm of the regions with the higher PiAdV prevalence was observed?

Improve English phrasing: e.g.:

Line 23. The dual fluorescence PCR method established in this study was used to test 500 pigeon swab samples.

Line 37. The virion has icosahedral symmetry […] the capsid proteins mainly consist of […].

Line 56. “has long detection cycle”, did the authors mean “is time-consuming” ?

Lines 58-59. but these need to the more higher viral load of the sample. This need to be reworded.

Line 138. Delete parenthesis

Line 195. Correct pegions.

References

Chen C, Zhu C, Chen Z, Cai G, Lin L, Zhang S, Jiang B, Miao Z, Fu G, Huang Y, Wan C. Rapid detection of pigeon adenovirus 2 using a TaqMan real-time PCR assay. Poult Sci. 2024 Jul;103(7):103848. doi: 10.1016/j.psj.2024.103848. Epub 2024 May 16. PMID: 38843610; PMCID: PMC11216009.

Teske L, Rubbenstroth D, Meixner M, Liere K, Bartels H, Rautenschlein S. Identification of a novel aviadenovirus, designated pigeon adenovirus 2 in domestic pigeons (Columba livia). Virus Res. 2017 Jan 2;227:15-22. doi: 10.1016/j.virusres.2016.09.024. Epub 2016 Sep 30. PMID: 27697452.

**********

what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy

Reviewer #1: Yes: HARUN ALBAYRAK

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org . Please note that Supporting Information files do not need this step.

PLoS One. 2025 Sep 19;20(9):e0330417. doi: 10.1371/journal.pone.0330417.r002

Author response to Decision Letter 1

3 Apr 2025

To Journal Requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

Answer: The paper format and submission documents have been revised and submitted in accordance with the journal's requirements.

2.Thank you for submitting your work to PLOS ONE. We note that you have not mentioned the source of tissue samples from pigeons used in this study. Before we can continue with your submission, kindly mention the details in the Method section. Thank you for your attention to this request. We look forward to hearing from you.

Answer: The source information of pigeon tissue samples has been added in the manuscript

3.We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed: https://www.mdpi.com/1999-4915/15/6/1238 https://onlinelibrary.wiley.com/doi/10.1111/tbed.14464.

Answer: We cited relevant literature and rephrased duplicate texts in the manuscript

4.We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

Answer: The information in the funding section was confirmed.

5.Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.

Answer: We have removed the other parts of the ethics statement.

6.We note that Figure 4 in your submission contain [map/satellite] images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth).

Answer: Figure 4 has been removed and the relevant content was presented as text in the manuscript.

To Reviewer #1:

1.The ICTV information provided for Adenovirus in the introduction is not up to date. It would be appropriate to change this information to its current state.

Answer: Thanks for your comment. The relevant content has been modified according to the latest ICTV adenovirus information in the manuscript.

Answer: Thanks for your advice. The distinction between RNA and DNA viruses presented have been modified. The abbreviations for coronaviruses and circoviruses have been amended in the manuscript

The author,s answer: Thanks for your suggestion, and the contents of Tables 3 and 5 have been modified as suggested.

To Reviewer #2:

1.The exact usefulness of the differentiation of PiAdV-A and B is not clear in the introduction and the discussion. Aside from the epidemiological surveillance, how useful is the dual detection in routine farm diagnosis? Line 64-65, the authors mentioned that distinction between PiAdV-A and B is mandatory for “rapid clinical diagnosis”. Why the detection of total PiAdV is not sufficient to contain epidemics in breeding farms and what will the dual detection change in the management of epidemics in a breeding farm? The PiAdV-A prevalence appears to be very low compare to type B. Why is it relevant to differentiate between the two types in routine diagnosis?

The authors should develop these points in the introduction and discussion.

The author,s answer: Thanks for your comment. The explanation of the need to distinguish between PIADVA and B has been further elaborated in the introduction and discussion.

2.Most papers about PiAdV talk about PiAdV type 1 or 2 and not variant A and B (Teske et al. 2017; Chen et al. 2024).

The author,s answer: We have changed the nomenclature of PiAdV-A and PiAdV-B as suggested.

3.Lines 52-54. Confusing. How it can be clear that the disease has been prevalent in China?

Line 63, the authors mentioned that the prevalence is not clear in China. If the prevalence is not known, so are the economic losses, and studies are needed to assess prevalence in China and the associated economic losses. Please revise this point.

The author,s answer: Thanks for your suggestion. The confusing description has been revised

4.Lines 55-59. The authors mentioned that the virus isolation is the more reliable detection method. Is it a general comment or specific to PiAdV detection? Has virus isolation been used for PiAdV diagnosis? Is there some studies showing better PiAdV detection with virus isolation than PCR? Real-time PCR is usually highly sensitive.

The author,s answer: Thanks for your comment. This description that the virus isolation is the more reliable detection method refers to a generic description of all viruses. At present, the isolation of pigeon adenovirus in our laboratory is not go well. For this puzzling, the relevant content has been redescribed in the manuscript.

5.Lines 57-60. Serum neutralizing antibody technology is not a common method for viral detection in laboratory, but useful for specific studies about protection of an individual or a population against a virus (seroprevalence). Seroprevalence of PiAdV neutralizing antibodies could be an interesting tool to determine the circulation of PiAdV in pigeons and for epidemiological surveillance. The added-value of seroprevalence and serum neutralizing antibody technology may be broach in the discussion and not the introduction.

The author,s answer:Thanks for your advice. Changes have been made as your suggestion.

6.Line 121. Please specify if testing for a single dilution was performed from one tube or from three different samples (for example three different samples of 9.48x10^9 copies of PiAdV-A). The guidelines from World Organisation for Animal Health (WOAH - “PRINCIPLES AND METHODS OF VALIDATION OF DIAGNOSTIC ASSAYS FOR INFECTIOUS DISEASES” p11) specify that “It is not acceptable to prepare a final working dilution of a sample in a single tube from which diluted aliquots are pipetted into reaction vessels, or to create replicates from one extraction of nucleic acid rather than to extract each replicate before dilution into the reaction vessels. Such ‘samples’ do not constitute valid replicates for repeatability studies”.

The author,s answer: Due to a mistake in my language description, which led to the reviewer's doubt, some of the language in Line 126-130 (formerly Line 121) has now been revised.

7.Line 131. About the conventional PCR. Reference 12 refer to a panadenovirus nested-PCR, and reference 13 to a PCR detecting specifically total PiAdV. Have these two methods been performed and shown the same results? Please clarify which conventional PCR has been performed in the present study. Specify the LOD of the conventional PCR assay if known.

Table 4. Indicate more clearly in the table which one is the conventional PCR and which one is the dual.

The author,s answer: Primers used for conventional PCR have been shown in Table 2 and more clearer description is added to Table 4.

8.Line 147. How many negative sample (ddH2O) were tested?

The author,s answer: The negative samples included 3 AIV, 1 RVA, 1 NDV, 1 PiCV, 1PiHV and 1 negative control ddH2O. The relevant content is redescribed in the manuscript.

9.Lines 153-156. How many times each point of the 10-fold serially diluted standard plasmids have been tested to determine the LOD for PiAdV-A and B genome? It is frequent to see 3 to 5 testing for each dilution of the standard, to ensure the 100% positive detection for the last point. A single test for each dilution is not robust enough. Did the authors test additional dilution beyond 94.8 or 88.4 copies/µL and 0 copy /µL?

The author,s answer: Thanks for your comment. In performing the sensitivity test, three assays were performed for each dilution of the 10-fold diluted standard, and the the relevant content has been added to the manuscript. According to instructions of WOAH-“PRINCIPLES AND METHODS OF VALIDATION OF DIAGNOSTIC ASSAYS FOR INFECTIOUS DISEASES”, a 2-fold dilution experiment below the minimum detection limit was carried out, the results showed that Piadv-1 was detected 6 times and Piadv-2 4 times out of 10 replicates performed, so the detection limits for this test remains 94.8 and 88.4 copies/µL.

10. The authors claim that the method developed for dual detection is satisfactory, but the limit of detection is higher than the LOD of 34.6 copies /µL for PiAdV-2 PCR developed by Chen et al. 2024. This point should be discussed, in addition to the added value of the dual real-time PCR developed by the authors in comparison with the results of Chen et al. 2024.

The author,s answer: The LOD of Chen’s article and the LOD of our experiment both belong to the 101 copies/µL level, and there is no obvious difference. Chen's article focuses on the issue of YPDS and PiAdV-2, which is discussed in the discussion section of the manuscript.

11. Line 194-196. The authors mentioned that the co-infection between PiAdV and other pathogens increase the mortality rate of pigeons. Information about co-infection with PTTV appear later, line 231. This is confusing. Is there a point to discuss about co-infection with other pathogens and PiADV-A and–B infection?

Could the type of PiAdV affect the mortality rate during such co-infection? Is it important to develop a multiplex PCR detecting those pathogens and PiAdV rather than differentiating PiAdV-A and B?

The authors should clarify their point about co-infection with other pathogens and their results.

The author,s answer: Thanks for your comment. The Information about co-infection between PiAdV and other pathogens and co-infection with PTTV has been consolidated in the manuscript. In clinical tests, PiAdV-2 was detected more frequently in dead pigeons than PiAdV-1, but we did not isolate the virus successfully, so we did not conduct animal regression tests to determine their pathogenicity. It is very important to develop a multiplex PCR detecting those pathogens and PiAdV, and we will carry out this work in the next experiment.

12.The authors mentioned a limit of detection of 101 copies/µL for PiAdV-A and B in the abstract, but 94.8 copies for PiAdV-A and 88.4 for PiAdV-B are mentioned in the results and discussion. Indicate the exact LOD for each PiAdV type in the abstract and homogenise in the results. No need for 101, the entire number is more comprehensible.

The author,s answer: Thanks for your advice. The data in the summary and results have been harmonized.

13.Line 55. Can the authors specify if the diagnosis of total PiAdV by PCR is routinely used in breeding farms, in case of pigeon diarrhoea or death?

The author,s answer: In China, pigeon farms usually do not have their own laboratories, and when pigeons suffer from diarrhea or die, the disease material is usually sent to a laboratory that conducts pegion disease research for testing. As for PiAdV-1 or 2 or total PiAdV, it is generally carried out according to the existing detection methods in the laboratory.

14.Line 92. Please specify what type of tissue samples (n=20) from pigeons were tested.

The author,s answer: Thanks for your comment.The type of tissue samples (n=20) from pigeons has been supplemented in the manuscript.

15.Lines 220-221. Is it known if a high morbidity or mortality rate of pigeons in the breeding farm of the regions with the higher PiAdV prevalence was observed?

The author,s answer: The detection rate of PiAdV was high in the dead pigeons from the breeding farm tested by our laboratory. It can be seen that the high mortality or mortality rate of pigeons is correlated with the high prevalence of PiAdV. The relevant description has been added to the manuscript.

16.Line 23. The dual fluorescence PCR method established in this study was used to test 500 pigeon swab samples.

Line 37. The virion has icosahedral symmetry […] the capsid proteins mainly consist of […].

Line 56. “has long detection cycle”, did the authors mean “is time-consuming” ?

Lines 58-59. but these need to the more higher viral load of the sample. This need to be reworded.

Line 138. Delete parenthesis

Line 195. Correct pegions.

The author,s answer: Thanks for your suggestions. The above sentences has been revised in the manuscript

Attachment

Submitted filename: Response to Reviewers.docx

pone.0330417.s002.docx^{(22.4KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0330417.r003

Decision Letter 1

Ahmed Eisa Elhag

26 May 2025

Dear Dr. Chen,

Dear Dr Chen,

Thank you for submitting the revised version of your manuscript, “Establishment and application of a dual real-time PCR assay for differential detection of PiAdV-1 and PiAdV-2 among pigeons in China in 2022-2023”. The paper has now undergone a second round of evaluation.

We invite you to submit a further revision, taking care to address all reviewer comments—particularly those raised by Reviewer 3. Please ensure that the limitations of your study, as well as any additional recommendations, are clearly and thoroughly addressed in the Conclusion section. Specifically, we request that you incorporate a comparative discussion of your findings with recent studies on pigeon aviadenoviruses from China and other countries. Relevant references example:

Once your revised manuscript is ready, please submit it along with a detailed, point-by-point response to the reviewers’ comments. This will facilitate a prompt and informed final decision.

==============================

Please submit your revised manuscript by Jul 10 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Ahmed Eisa Elhag

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions??>

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

3. Has the statistical analysis been performed appropriately and rigorously? -->?>

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

4. Have the authors made all data underlying the findings in their manuscript fully available??>

The PLOS Data policy

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English??>

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

Reviewer #1: The authors have adequately addressed my comments raised in a previous round of review and I feel that this manuscript is now acceptable for publication.

Reviewer #2: The manuscript is much clearer now, and the corrections are really helpful. I spotted just two tiny little things that could be improved:

Line 238 : Correct pegions for pigeons

Figure 4 : Correct varient for variant.

Best,

Reviewer #3: The manuscript by Chen et al. concerns the methodology for screening for Pigeon-speciphic Aviadenoviruses in pigeons clinical samples. Adenovirususes are one of the important viral pathogens of domestic pigeons, and for this reason the paper is important. However, despites on corrections made according to the comments of Reviewers 1 and 2, the manuscipt still needs improvements and it can't be published in the present form.

Below is the list of major and minor corrections, that have to been made. After that the paper have to be submitted for another revision stage.

Line 17. Significance of adenoviruses in case of diarrheic diseases of pigeons. Read the latest paper from this topic, provide corrections according to it in the further parts of MS and cite it properly in the manuascript, please: doi.org/10.1016/j.virol.2025.110400.

Introduction section, and pigeon adenoviruses description: This work bases on molecular methods, so provide a brief description of PiAdV genome, please.

Line 53. Spriding of PiAdV in the loft - provide details and reference, please or delete this information.

Line 64. Not true. Virus isolation is not the most common method, but it is the best method in case of proofing the pathogenicity of the virus. Rewrite this section, please.

Line 67. "high viral loads" - What it means "high" - it is too general. Provide some examples, please.

Lines 71-74 - Does it have any practical aspect? Practical means prevention or prophylaxis programms and it's impemmentation in the pigeon flocks?

Line 100. "Pigeon Rotavirus A" (I suppose), because other rotaviruses are also prevalent in pigeons: doi.org/10.1155/tbed/4684235

Provide the strain names used in this study, please.

Line 102. What was the base of this suspicion? Describe it a little bit.

Line 107. How many of each types of the swabs were investigated?

Line 117. cDNA or DNA depending on the virus?

Line 127. Missing space.

Lines 154-158. The section "Sequencing and phylogenetic analysis" .

This section is written very scantly. Provide all sequencing details, please. Provide all details concerning the assembling the sequencing reads into contigs, sequencing errors removing and phylogenetic analysis including method for seletion nucleotide substitution algorithm. Add all information concerning software used for bioinformatic analyzes. Provide the list of accession numbers of generated under this study nucleotide sequences.

Line 195. The description of results of molecular screening for adenoviruses is too general. The statistical analysis of the prevalence of both pigeon aviadenoviruses could improve the results section. I reccomend to add statistical analylis to the methodology.

Lines 208-209. "infected samples" - The samples were positive, not infected.

Lines 2010-2011 - Those results concerns PiAdV-1, PiAdV-2, or both of them?

Table 5. Show results in the table separately for PiAdV-1 and PiAdV-2, please icluding statistical analysis, please.

Line 220. "of was" ??

Fig. 4 and phylogenetic analysis: Add PP999622 and PP999623 sequences to the analysis, please.

Line 243. This is an old data. Currently the RVA is suspected to be a causative agent of YPDS: DOI: 10.1111/tbed.13485.

Lines 250-253. There is one more method previopusly published:

doi.org/10.1016/j.virol.2025.110400 - cite those refereences correctly, please.

The discussion section: Very poor discussion. Too many repetitions of the results, too less real discussion. The results of phylogenetic analysis were not discussed at all.

**********

what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy

Reviewer #1: Yes: HARUN ALBAYRAK

Reviewer #2: No

Reviewer #3: No

**********

PLoS One. 2025 Sep 19;20(9):e0330417. doi: 10.1371/journal.pone.0330417.r004

Author response to Decision Letter 2

7 Jun 2025

Reviewer #1: The authors have adequately addressed my comments raised in a previous round of review and I feel that this manuscript is now acceptable for publication.

Answer: OK, thanks.

Reviewer #2: The manuscript is much clearer now, and the corrections are really helpful. I spotted just two tiny little things that could be improved:

Line 238 : Correct pegions for pigeons

Figure 4 : Correct varient for variant.

Answer: All corrections have been made

Reviewer #3:

Introduction section, and pigeon adenoviruses description: This work bases on molecular methods, so provide a brief description of PiAdV genome, please.

Answer: Thanks for your comment. Related contents have been added in the manuscript.

Line 53. Spriding of PiAdV in the loft - provide details and reference, please or delete this information.

Answer: Thanks for your suggestion, and this information has been deleted in the manuscript.

Line 64. Not true. Virus isolation is not the most common method, but it is the best method in case of proofing the pathogenicity of the virus. Rewrite this section, please.

Answer: Thanks for your comment. This section has been rewrited in the manuscript.

Line 67. "high viral loads" - What it means "high" - it is too general. Provide some examples, please.

Answer: Thanks for your advice. This section has been redescribed in the manuscript.

Lines 71-74 - Does it have any practical aspect? Practical means prevention or prophylaxis programms and it's impemmentation in the pigeon flocks?

Answer: Thanks for your comment. Through rapid clinical diagnosis, early detection, early isolation and early treatment can be achieved, reducing the loss of pigeon flocks. The relevant content has been added in the manuscript.

Line 100. "Pigeon Rotavirus A" (I suppose), because other rotaviruses are also prevalent in pigeons: doi.org/10.1155/tbed/4684235. Provide the strain names used in this study, please.

Answer: Thanks for your comment. I am sorry for the mistake, and the RVA strain was used in this study. Our laboratory only has RVA and no other RVs. We have made revisions in the manuscript.

Line 102. What was the base of this suspicion? Describe it a little bit.

Answer: Thanks for your comment. Liver tissue treatment was performed on 20 pigeons with clinical signs such as vomiting and diarrhea.

Line 107. How many of each types of the swabs were investigated?

Answer: Oropharyngeal swab and cloacal swab of one pigeon mixed in one tube

Line 117. cDNA or DNA depending on the virus?

Answer: The mistake has been corrected in the manuscript.

Line 127. Missing space.

Answer: All corrections have been made.

Lines 154-158. The section "Sequencing and phylogenetic analysis" .

Answer: Thanks for your comment. This content was supplemented with details in the manuscript.

Answer: Thanks for your comment. Appropriate additions has been added n the manuscript.

Lines 208-209. "infected samples" - The samples were positive, not infected.

Answer: Thanks for your comment. The mistake has been corrected in the manuscript.

Lines 2010-2011 - Those results concerns PiAdV-1, PiAdV-2, or both of them?

Answer: Thanks for your comment. The content in doubt has been revised in the manuscript.

Table 5. Show results in the table separately for PiAdV-1 and PiAdV-2, please icluding statistical analysis, please.

Answer: Thanks for your advice. The content has been revised in the manuscript.

Line 220. "of was" ??

Answer: The mistake has been revised in the manuscript.

Fig. 4 and phylogenetic analysis: Add PP999622 and PP999623 sequences to the analysis, please.

Answer: The content has been added in the manuscript.

Line 243. This is an old data. Currently the RVA is suspected to be a causative agent of YPDS: DOI: 10.1111/tbed.13485.

Answer: The content has been revised in the manuscript.

Lines 250-253. There is one more method previopusly published:

doi.org/10.1016/j.virol.2025.110400 - cite those refereences correctly, please.

Answer: Thanks for your comment. The content has been added in the manuscript.

The discussion section: Very poor discussion. Too many repetitions of the results, too less real discussion. The results of phylogenetic analysis were not discussed at all.

Answer: Thanks for your comment. We have made modifications to the discussion section , and added the phylogenetic analysis in the manuscript

Attachment

Submitted filename: Response_to_Reviewers_auresp_2.docx

pone.0330417.s003.docx^{(15.9KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0330417.r005

Decision Letter 2

Ahmed Eisa Elhag

1 Aug 2025

Establishment and application of a dual real-time PCR assay for differential detection of PiAdV-1 and PiAdV-2 among pigeons in China in 2022-2023

PONE-D-24-53219R2

Dear Dr. Chen,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. For questions related to billing, please contact billing support .

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Ahmed Eisa Elhag

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Dear Dr. Chen,

Thank you for submitting the revised version of your manuscript titled “Establishment and application of a dual real-time PCR assay for differential detection of PiAdV-1 and PiAdV-2 among pigeons in China in 2022–2023.”

We appreciate your patience and the efforts you have made to enhance the manuscript and address the reviewers’ comments after the second round of evaluation.

Before we proceed with the final acceptance, we kindly ask that the manuscript be thoroughly proofread by a native English speaker or a professional with expertise in scientific writing. There are still some language issues and typographical errors that need attention.

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0330417.r006

Acceptance letter

Ahmed Eisa Elhag

PONE-D-24-53219R2

PLOS ONE

Dear Dr. Chen,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

You will receive further instructions from the production team, including instructions on how to review your proof when it is ready. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few days to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

You will receive an invoice from PLOS for your publication fee after your manuscript has reached the completed accept phase. If you receive an email requesting payment before acceptance or for any other service, this may be a phishing scheme. Learn how to identify phishing emails and protect your accounts at https://explore.plos.org/phishing.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Ahmed Eisa Elhag

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Attachment

Submitted filename: Response to Reviewers.docx

pone.0330417.s002.docx^{(22.4KB, docx)}

Attachment

Submitted filename: Response_to_Reviewers_auresp_2.docx

pone.0330417.s003.docx^{(15.9KB, docx)}

Data Availability Statement

All relevant data are within the paper.

[pone.0330417.ref001] 1.Łukaszuk E, Dziewulska D, Prątnicka A, Custer JM, Kraberger S, Varsani A, et al. Characterization, phylogeny and prevalence of the coding-complete genomes of aviadenoviruses and siadenovirus in young racing pigeons. Virology. 2025;603:110400. doi: 10.1016/j.virol.2025.110400 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref002] 2.Benk M, Harrach B. Molecular evolution of adenoviruses. Current Topics in Microbiology and Immunology. 2003;272:3–35. [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref003] 3.Niczyporuk JS, Kozdruń W, Czekaj H, Styś-Fijoł N, Piekarska K. Detection of fowl adenovirus D strains in wild birds in Poland by Loop-Mediated Isothermal Amplification (LAMP) [J]. BMC veterinary research, 2020, 16(1): 58. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0330417.ref004] 4.Chen C, Zhu C, Chen Z, Cai G, Lin L, Zhang S, et al. Rapid detection of pigeon adenovirus 2 using a TaqMan real-time PCR assay. Poult Sci. 2024;103(7):103848. doi: 10.1016/j.psj.2024.103848 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0330417.ref005] 5.Teske L, Rubbenstroth D, Meixner M, Liere K, Bartels H, Rautenschlein S. Identification of a novel aviadenovirus, designated pigeon adenovirus 2 in domestic pigeons (Columba livia). Virus research. 2017;227:15–22. [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref006] 6.Zhang X, Zhong Y, Zhou Z, Liu Y, Zhang H, Chen F, et al. Molecular characterization, phylogeny analysis and pathogenicity of a Muscovy duck adenovirus strain isolated in China in 2014. Virology. 2016;493:12–21. doi: 10.1016/j.virol.2016.03.004 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref007] 7.De Herdt P, Ducatelle R, Lepoudre C, Charlier G, Nauwynck H. An epidemic of fatal hepatic necrosis of viral origin in racing pigeons (Columba livia). Avian Pathol. 1995;24(3):475–83. doi: 10.1080/03079459508419087 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref008] 8.Wada Y, Kondo H, Nakazawa M, Kubo M. Natural infection with attaching and effacing Escherichia coli and adenovirus in the intestine of a pigeon with diarrhea. J Vet Med Sci. 1995;57(3):531–3. doi: 10.1292/jvms.57.531 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref009] 9.Freick M, Müller H, Raue R. Rapid detection of pigeon herpesvirus, fowl adenovirus and pigeon circovirus in young racing pigeons by multiplex PCR. J Virol Methods. 2008;148(1–2):226–31. doi: 10.1016/j.jviromet.2007.11.003 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref010] 10.Schachner A, Matos M, Grafl B, Hess M. Fowl adenovirus-induced diseases and strategies for their control - a review on the current global situation. Avian Pathol. 2018;47(2):111–26. doi: 10.1080/03079457.2017.1385724 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref011] 11.Vereecken M, de Herdt P, Ducatelle R. Adenovirus infections in pigeons: A review. Avian Pathol. 1998;27(4):333–8. doi: 10.1080/03079459808419348 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref012] 12.Raue R, Hafez HM, Hess M. A fiber gene-based polymerase chain reaction for specific detection of pigeon adenovirus. Avian Pathol. 2002;31(1):95–9. doi: 10.1080/03079450120106660 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref013] 13.Goryo M, Ueda Y, Umemura T, Haruna A, Itakura C. Inclusion body hepatitis due to adenovirus in pigeons. Avian Pathol. 1988;17(2):391–401. doi: 10.1080/03079458808436457 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref014] 14.Wan C, Chen C, Cheng L, Fu G, Shi S, Liu R, et al. A TaqMan-based real-time PCR for detection and quantification of newly identified novel pigeon adenovirus. J Virol Methods. 2018;261:6–9. doi: 10.1016/j.jviromet.2018.07.017 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref015] 15.Hess M, Prusas C, Monreal G. Growth analysis of adenoviruses isolated from pigeons in chicken cells and serological characterization of the isolates. Avian Pathol. 1998;27(2):196–9. doi: 10.1080/03079459808419323 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref016] 16.Agnihotri K, Smith C, Oakey J, Storie G. Pigeon adenovirus and pigeon torque teno virus associated with acute multifocal hepatic necrosis in pigeons in Queensland, Australia. Arch Virol. 2021;166(5):1469–75. doi: 10.1007/s00705-021-05033-x [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref017] 17.Wang CH, Chang CM. Pathogenicity and gene analysis of adenovirus from pigeons with inclusion body hepatitis. J Vet Med Sci. 2000;62(9):989–93. doi: 10.1292/jvms.62.989 [DOI] [PubMed] [Google Scholar]

[pone.0330417.ref018] 18.Ballmann MZ, Harrach B. Detection and partial genetic characterisation of novel avi- and siadenoviruses in racing and fancy pigeons (Columba livia domestica). Acta Vet Hung. 2016;64(4):514–28. doi: 10.1556/004.2016.047 [DOI] [PubMed] [Google Scholar]

PERMALINK

Establishment and application of a dual real-time PCR assay for differential detection of PiAdV-1 and PiAdV-2 among pigeons in China in 2022–2023

Lu Chen

Jingjing Wang

Yufeng Liu

Yuteng Chen

Haiming Wang

Jinping Li

Wenming Jiang

Xiaohui Yu

Hualei Liu

Roles

Abstract

Introduction

Materials and methods

Ethics statement

Primers and probes

Table 1. Primers and probes used in this study.

Virus and samples collection

Table 5. PiAdV-1 and PiAdV-2 dual real-time fluorescence PCR vs conventional PCR assay comparison of results.

Condition optimization

Standard curve generation

Specificity, sensitivity and repeatability

Clinical sample detection

Table 2. Primers used in this study.

Epidemiological surveillance of PiAdV-1 and PiAdV-2 in China from 2022 to 2023

Sequencing and phylogenetic analysis

Table 3. Adenoviruses representative strain information.

Results

Standard curve of the dual real-time PCR

Fig 1. PiAdV-1 and PiAdV-2 dual real-time PCR detection standard curve.

Specificity, sensitivity and repeatability

Fig 2. Speciﬁcity test of the dual real-time PCR assay.

Fig 3. Sensitivity test of the dual real-time PCR assay.

Table 4. Intra-repeatability and inter-reproducibility of the dual real-time PCR assay.

Clinical sample detection

Epidemiological surveillance of PiAdV-1 and PiAdV-2 in China from 2022 to 2023

Table 6. Positive annual rates of Pigeon adenovirus detection in 2022-2023.

Sequencing and phylogenetic analysis

Fig 4. The phylogenetic tree was constructed based on the nucleotide sequences of the PiAdVs Hexon gene.

Discussion

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Ahmed Eisa Elhag

Roles

Author response to Decision Letter 1

Decision Letter 1

Ahmed Eisa Elhag

Roles

Author response to Decision Letter 2

Decision Letter 2

Ahmed Eisa Elhag

Roles

Acceptance letter

Ahmed Eisa Elhag

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases