Table 2. Evaluation data of resistance and tolerance.

Cultivar	Disease resistance				Lodging resistance (culm breaking)e	Pre-harvest sprouting tolerance		Qsd1 typeg	Qsd2 typeh
	BaYMV (types I–III)a	JSBWMVb	Powdery mildewc	Scabd		Judgmente	Germination rate (%)f
Fukumi Fiber	R	R	M	M	R	S	73.5 ai	D	D
Ichibanboshi	R	R	M	M	MR	R	5.8 b	D	D
Daishimochi	Mj	n.tl	MSj	Mj	R	R	5.8 b	n.t.	n.t.
Kirari-mochi	RRk	n.t.	RRk	MRk	R	S	80.8 a	D	D

RR: highly resistant, R: resistant, MR: moderately resistant, M: moderate, MS: moderately susceptible, S: susceptible, SS: highly susceptible.

^a Estimated in 2014–2017 growing years, tested in Tsukuba and Tsukubamirai, Ibaraki; Otsu, Kumamoto; and Tochigi, Tochigi.

^b Estimated in 2015–2016 growing years, tested in Tsukubamirai, Ibaraki.

^c Estimated in 2014, 2016, and 2017 growing years, tested in Tsukuba, Ibaraki.

^d Estimated in 2014–2017 growing years, tested in Tsukuba, Ibaraki; Tikugo and Tikushino, Fukuoka.

^e Estimated in 2012–2017 growing years, tested in Zuntsuji, Kagawa.

^f Means of 2012–2017 growing years. Germination ratio of 100 seeds of 18℃ on the 7th day of incubation, tested in Zuntsuji, Kagawa.

^g Determined using a marker based on the SNP in Exon 9 reported by Sato et al. (2016), with marker primers dCAPS-QSD1E9-TaqI-F: CCGTACAATCTTAGCGAGGATGGTGATTGGGGGCTTGAGATTTTGGAAGT and dCAPS-QSD1E9-TaqI-R: CTTTCCGACAAAATTCTACTATCTCCTCCT and restriction enzyme TaqI. D: dormancy allele.

^h Determined using a marker based on the SNP in Exon 7 reported by Nakamura et al. (2016), with marker primers CAPS-QSD2E7-2733RsaI-F: TGCATGAGGCAAGACACCTA and CAPS-QSD2E7-3158RsaI-R: TCACCTGCAGCATGAGATTG and restriction enzyme RsaI. D: dormancy allele.

ⁱ The same letters in the same column are not significantly different (P < 0.05), as revealed by Tukey’s test.

^j Doi et al. 1999

^k Yanagisawa et al. 2011

^l n.t.: Not tested.