Abstract
Maintaining a regular and nutritious diet has recently become a significant concern due to its impact on various health conditions. Despite following a normal diet, the presence of inflammation and oxidative stress can have negative consequences, especially in IBD (Inflammatory Bowel Disease) patients. The use of beneficial agents such as probiotics in their inactive form, known as paraprobiotics, can help counteract these adverse effects by exerting antioxidant and anti-inflammatory properties. This study aimed to evaluate and compare the antioxidant and anti-inflammatory properties of native probiotic strains and their inactive derivatives, known as paraprobiotics, in mitigating the harmful effects of DSS-induced colitis. Twenty male wild-type C57BL/6 mice were treated with native probiotic strains, including Lactobacillus reuteri RP100, Lactobacillus plantarum RP42, Lactobacillus plantarum RP119, Lactobacillus plantarum RP155, Bifidobacterium bifidum RP1001, and Bifidobacterium longum RP1044, as well as the derived paraprobiotics. The mice were divided into four experimental groups: normal diet (ND) + PBS, ND + DSS (Dextran Sodium Sulfate), ND + DSS + 109 cfu/ml of probiotic strains, and ND + DSS + 109 cfu/mL of paraprobiotic. Colitis indices, evaluation of oxidant/antioxidant enzymes, anti/pro inflammatory cytokines, and expression of NF-kB and Nrf2 pathways genes were assessed. A significant difference was noted among the groups exposed to DSS, where mice treated with probiotics and paraprobiotics in addition to DSS showed a decrease in the harmful effects caused by DSS, both in terms of enzymatic assessments and molecular markers like Nrf2 and NF-kB related genes, with similar outcomes between our native probiotic and paraprobiotic. The strong antioxidant and anti-inflammatory characteristics of our native probiotics and paraprobiotics at molecular and phenotypic levels suggest that these agents, especially paraprobiotics as non-living entities, could be valuable supplementary treatment options to improve the quality of life for individuals with IBD.
Keywords: Normal diet, Probiotic, Paraprobiotic, Oxidative stress, Inflammation
Introduction
Inflammatory Bowel Disease (IBD), which includes diseases such as Crohn’s disease and ulcerative colitis, is characterized by chronic intestinal inflammation, that is characterized by periods of relapses and remissions. While the exact etiology of IBD remains elusive, genetic predisposition, gut microbiota composition, immune responses, and environmental factors are implicated in its pathogenesis [1]. A key feature in the development and progression of IBD is oxidative stress, resulting from an imbalance between reactive oxygen species (ROS) production and antioxidant defense mechanisms. This imbalance can lead to significant cellular and molecular damage, contributing to tissue injury and perpetuating the inflammatory cycle [2]. Therefore, strategies aimed at mitigating oxidative stress and inflammation are crucial for managing IBD.
A widely used experimental model to study IBD is dextran sulfate sodium (DSS)-induced colitis. Administration of DSS to mice leads to inflammation and ulceration of the colon, mimicking many aspects IBD in humans, including increased oxidative stress and production of inflammatory cytokine [3, 4]. DSS compromises the integrity of the intestinal epithelial barrier, facilitating the entry of luminal antigens and pathogens into the underlying tissues. This breach initiates a series of pro-inflammatory responses driven by cytokines, including IL-6, TNF-α, and IL-1β [5]. This model provides a valuable tool for investigating the efficacy of potential therapeutic interventions.
Two specific abnormalities associated with IBD are oxidative stress and intestinal inflammation [6]. According to recent data, an excessive intake of calories and certain macronutrients characteristic of the Western dietary pattern heightens gut inflammation [7]. Inflammation is a key factor in the pathophysiology of IBD. Significant inflammatory pathways involved include the NF-κB signaling pathway, which shows heightened activity in the immune cells of individuals with IBD, along with cytokines such as interferon-γ (IFNγ) and TNF-like ligand 1 A (TL1A), which influence immune responses and changes in blood vessels. This is corroborated by research indicating that NF-κB is essential in the inflammatory response by enhancing the production of pro-inflammatory cytokines such as TNFα and IL-6 in patients with IBD [8].
Alongside inflammation, oxidative stress represents another significant process in IBD [9]. Oxidative stress plays a crucial role in the body, to the extent that Redox homeostasis is often described as"the perfect balance for a healthy life" [10]. Oxidant sources are categorized into endogenous (e.g., cellular enzymes producing H2O2 and superoxide anion radicals) and exogenous sources (e.g., cigarette smoke, pollution, radiation, and nutrition) [11]. Oxidative stress could related to various diseases, including cardiovascular diseases (CVDs), chronic obstructive pulmonary disease, chronic kidney disease, neurodegenerative diseases, cancer, and IBD [12, 13].
Probiotics have attracted interest as possible therapeutic options for IBD because of their capacity to influence the composition of gut microbiota and strengthen mucosal immunity [14]. Recent research has shown that probiotic strains such as Lactobacillus acidophilus KLDS 1.0901, Lactobacillus plantarum KLDS 1.0318 and Lactobacillus helveticus KLDS 1.8701 can alleviate DSS-induced colitis by restoring the expression of TJs, including E-cadherin, ZO-1, occludin and claudin-1 in mice with colitis, thus improving the integrity of the epithelial barrier [15, 16]. In addition to live probiotics, more recently, paraprobiotics (non-viable microbial cells or cell components) have garnered attention as an alternative to live probiotic. For example, paraprobiotics derived from Lactobacillus plantarum MGEL20154 and Lactobacillus reuteri MGEL21001 showed a marked improvement in their ability to repair tight junctions, stimulate mucin production, and decrease inflammation in colonic lesion tissues [17]. While probiotics may offer benefits, the presence of live bacteria is seen as a drawback for immunocompromised individuals. In contrast, paraprobiotics, as non-living bacteria, are a suitable option for such patients [18]. Studies have demonstrated that paraprobiotics can exert immunomodulatory effects, similar to their live counterparts, suggesting their potential in managing inflammatory conditions [19].
Although there is an increasing interest in the use of probiotics and paraprobiotics for the management of IBD, the relative effectiveness of these two strategies in reducing oxidative stress and inflammation is not well established. This study intends to assess the antioxidant properties of a native probiotic and its related paraprobiotic derivative using a murine model of colitis induced by DSS. Our objective is to evaluate how each method influences oxidative stress indicators and inflammatory responses in the colon, as well as to explore any differences in exerting antioxidant and anti-inflammatory effects.
Materials and methods
Selecting probiotic isolates and preparation of paraprobiotic
In the current investigation, a total of 88 probiotic strains previously identified in our prior studies [20, 21] were examined for their antioxidant properties utilizing various biochemical methodologies such as DPPH, ABTS, Superoxide anion, Hydroxyl Radical Scavenging, Reducing Power, and Lipid Peroxidation inhibition assays. Subsequently, six specific probiotic strains were selected, namely Lactobacillus reuteri RP100, Lactobacillus plantarum RP42, Lactobacillus plantarum RP119, Lactobacillus plantarum RP155, Bifidobacterium bifidum RP1001, and Bifidobacterium longum RP1044. The procedures for bacterial cultivation and paraprobiotic preparation have been detailed, previously [22]. Briefly, for the preparation of paraprobiotics, the bacterial suspensions were centrifuged, washed with PBS and heated at 100 °C for 10 min to inactivate the cells. The inactivated cells were sonicated in an ice-water bath and centrifuged again. The resulting precipitate was used as paraprobiotic material. A paraprobiotic cocktail was prepared by mixing the six selected strains and using the same procedure.
In vivo procedures
All animal experiments were accomplished in accordance with the ARRIVE guidelines [23]. Twenty C57BL/6 mice according to G*Power [24], aged 4–6 weeks and weighing 16 g, sourced from the Pasteur Institute of Iran, were utilized for conducting the in-vivo experiments. These mice were accommodated in cages designed for five individuals each (temperature of 22 °C, a humidity level of 50%, 12-h light/dark cycle while). Throughout this period, the mice were provided with both water and food. No exclusion criteria had been applied. Subsequent to an acclimation phase, the mice were segregated into four distinct groups: 1) mice receiving a diet consisting of 200 μl PBS and normal diet (ND) (Envigo Teklad 2918) including a balanced mixture of protein, carbohydrates, fats, vitamins, and minerals. Specifically, it contained approximately 18–25% protein, 40–60% carbohydrates, and 5–10% fat (it should be noted that mice had ad libitum access to food and water throughout the study period to ensure they received adequate nutrition, considered as negative control group, 2) mice consuming ND along with single dose of 200 μl DSS 2% (To prepare a 2% DSS solution, 2 g of DSS powder was weighed out and then dissolved this in 100 mL of sterile distilled water to achieve the desired concentration. The solution was stirred continuously until the DSS was completely dissolved, resulting in a clear solution), considered as positive control group, 3) mice exposed to 109 CFU of native probiotic strains in addition to 200 μl DSS 2%, and 4) mice fed with 109 native paraprobiotics along with 200 μl DSS 2%. During the establishment of the model and the intervention period, no significant mortality was observed among the mice. All these treatments were performed using oral gavage over a period of 28 days. The experimental protocols were established following the Declaration of Helsinki and approved by the ethics committee of Pasteur Institute of Iran (IR.PII.REC1400.061).
Evaluation the in-vivo colitis parameters
The assessment of Disease Activity Index (DAI) involved the scoring of parameters such as body weight loss, stool consistency, mouse activity characteristics, occult/gross rectal bleeding, and the condition of the mouse coat. A comparison was made among the four groups of mice based on these evaluations [25]. Furthermore, the histological scores were assessed, encompassing crypt architecture, extent of inflammatory cell infiltration, muscle thickening, goblet cell depletion, and colon length, in accordance with previous descriptions [22].
The evaluation of phenotypic outcomes, including oxidative stress biomarkers and cytokines
In the current study, the level of antioxidant biomarkers, including Malondialdehyde (MDA), glutathione (GSH), catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GPX) in both serum and segments of the distal intestinal tissue were examined based on the protocols outlined by the manufacturer (Navand Salamat, Iran). Also, for the assessment the anti-inflammatory effects of our native probiotic and paraprobiotic, the concentration of cytokines was evaluated. By following the guidelines provided by the manufacturer (Karmania Pars Gene, Iran), the concentrations of IL-1β and TNF-α, known as proinflammatory cytokines, and IL-4 and IL-10, which serve as anti-inflammatory cytokines, were evaluated.
The evaluation of molecular consequences, Nrf2 and NF-kB pathways, via RT-qPCR
The extraction of RNA from the colon of mice (the tissue samples from the colon of mice were collected at the end of the experimental period, immediately after euthanasia) was performed through the application of a specialized kit manufactured by Favorgen Biotech Corp located in Taiwan. Subsequently, for the purpose of reversing the transcribed RNA into complementary DNA (cDNA), a specific kit developed by Yekta Tajhiz Azma Co based in Iran was employed. The subsequent step involved the execution of quantitative Polymerase Chain Reaction (PCR) utilizing ABI Prism, in conjunction with the utilization of 2 × SYBR-Green dye, notably sourced from a kit produced by Amplicon A/S situated in Denmark. Detailed information regarding all primer sequences utilized in this study can be referenced in Table 1. The housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (gapdh), was utilized as a reference for normalization purposes in the gene expression analysis. The quantification of gene expression levels was performed utilizing the 2−ΔΔCt method, a widely recognized approach within the scientific community for such analyses.
Table 1.
The primers used in the current study
| Genes | Primer Sequence (5'> 3') | Product size |
|---|---|---|
| Nrf2MF | TAGATGACCATGAGTCGCTTGC | 153 bp |
| Nrf2MR | GCCAAACTTGCTCCATGTCC | |
| Keap1 MF | TCGAAGGCATCCACCCTAAG | 135 bp |
| Keap1MR | CTCGAACCACGCTGTCAATCT | |
| NQO1MF | AGGATGGGAGGTACTCGAATC | 127 bp |
| NQO1MR | TGCTAGAGATGACTCGGAAGG | |
| HO-1MF | GGTGATGGCTTCCTTGTACC | 155 bp |
| HO-1MR | AGTGAGGCCCATACCAGAAG | |
| Trx-1MF | CTTTTGCCCGTCTCTCAATCA | 181 bp |
| Trx-1MR | AGGGTATTTCACACTTAGGTCCT | |
| SOD2MF | CAGACCTGCCTTACGACTATGG | 113 bp |
| SOD2MR | CTCGGTGGCGTTGAGATTGTT | |
| CATMF | GGAGGCGGGAACCCAATAG | 102 bp |
| CATMR | GTGTGCCATCTCGTCAGTGAA | |
| Gpx1MF | CCACCGTGTATGCCTTCTCC | 105 bp |
| Gpx1MR | AGAGAGACGCGACATTCTCAAT | |
| COX-2(PTGS2) MF | TGCACTATGGTTACAAAAGCTGG | 271 bp |
| COX-2(PTGS2) MR | TCAGGAAGCTCCTTATTTCCCTT | |
| NF-kBp65(Rela) MF | TGACCCCTGTCCTCTCACATCCG | 94 bp |
| NF-kBp65(Rela) MR | CAGCTCCCAGAGTTCCGGTT | |
| NF-KBIA(IkBa)MF | TGAAGGACGAGGAGTACGAGC | 127 bp |
| NF-KBIA(IkBa)MR | TGCAGGAACGAGTCTCCGT | |
| Ikka (Chuk)MF | GAGAGCGATGGTGCCATGAA | 136 bp |
| Ikka (Chuk)MR | CCAGAACAGTACTCCATTGCCAGA | |
| Ikkb (IKBKB)MF | AAGTACACCGTGACCGTTGAC | 91 bp |
| Ikkb (IKBKB)MR | GCTGCCAGTTAGGGAGGAA | |
| GAPDHMF | TGGCCTTCCGTGTTCCTAC | 178 bp |
| GAPDHMR | GAGTTGCTGTTGAAGTCGCA |
Statistical analysis
GraphPad Prism 8.0 software, devised by GraphPad Software Inc, located in CA, USA was used for statistical assessment. The one-way analysis of variance (ANOVA) was conducted, followed by the Tukey’s post hoc test, in the context of handling data demonstrating a normal distribution. In contrast, the Kruskal–Wallis test was employed for datasets deviating from a normal distribution. The findings were reported in terms of the mean value along with the standard error. To establish statistical significance, a P-value below 0.05 was considered significant. The analysis lacks any exclusion criteria.
Results
Our native probiotic strains and paraprobiotics have the potential to alleviate the negative consequences of DSS
Based on our findings in colitis, depicted in Fig. 1, our probiotic strains and paraprobiotic exhibited significant anti-inflammatory properties. Utilizing a standard diet over a span of two weeks resulted in a weight gain of approximately 2 g, whereas administering DSS to mice following the ND regimen led to a weight loss of nearly 6 g. Furthermore, in terms of colon length, DAI, and histological scores, the introduction of DSS caused a considerable reduction in colon length and an increase in both DAI and histological score, indicating the substantial inflammatory effect of DSS compared to the negative control group (p < 0.0001). on the other hand, the outcomes of our native probiotic strains and paraprobiotic demonstrated noteworthy effects across all parameters, such as weight gain, colon length, DAI, and histological scores. These native agents were able to uphold weight levels, even in the presence of DSS, while also increasing colon length and decreasing DAI and histological scores, as opposed to the positive control group (p < 0.0001). It is essential to highlight that the impacts of our probiotic strains and paraprobiotic were similar, displaying no significant differentiation between them (Refer to Fig. 1).
Fig. 1.
Effects of probiotics and postbiotics mixture on disease severity in DSS-induced colitis mice. A Body weight changes, B DAI score, C Colon length, D H&E staining of colon section of mice (a: crypts architecture, b: inflammation, c muscle thickness, d goblet cells depletion, and e: crypts abscesses, the scale bar is 100 pixels. E histopathological score. Data are presented as the mean ± SD, N = 5 per group. Statistical significance was determined using the following symbols: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001 (ND + PBS vs. Other groups),
, p < 0.05;
, p < 0.01;
, p < 0.001;
, p < 0.0001 (ND + DSS vs. Other groups). It should be noted that p-values were corrected for multiple comparison using Tukey’s post hoc test. Note: Each group had five mice, and the circular graph representation may result in overlapping data points due to repeated values among certain mice within the same group, which can give the appearance of fewer data points
Our native probiotic and paraprobiotic elevated the concentration of antioxidant markers and anti-inflammatory cytokines, concurrently diminishing the quantity of inflammatory cytokines
In accordance with the illustrations presented in Figs. 2, 3, and. 4, it is evident that our native agents exhibit promising potential in terms of their anti-inflammatory and antioxidant capabilities. Our findings indicate that the induction of DSS leads to the exacerbation of inflammatory conditions by upregulating the expression of inflammatory cytokines, as well as triggering oxidative stress through the reduction of antioxidant markers in both serum and gut, in comparison to the negative control group (p < 0.0001). On the other hand, our native probiotic strains and paraprobiotic agents demonstrate their beneficial effects by enhancing the levels of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPX), and glutathione (GSH), while reducing malondialdehyde (MDA) (Figs. 2 and 3). Furthermore, they elevate the concentrations of anti-inflammatory cytokines such as interleukin-4 (IL-4) and interleukin-10 (IL-10), and decrease the levels of interleukin-1β (IL-1β) and tumor necrosis factor-alpha (TNF-α) as pro-inflammatory cytokines, when compared to the positive control group that received a positive treatment (p < 0.0001) (Fig. 4). It is noteworthy that both types of our native agents yield comparable results in enhancing anti-inflammatory cytokines and reducing pro-inflammatory cytokines, with no statistically significant variance between them.
Fig. 2.
The levels of SOD, CAT, GSH, GPX (antioxidant enzymes), and MDA oxidant enzyme in serum. Statistical significance was determined using the following symbols: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001 (ND + PBS vs. Other groups),
, p < 0.05;
, p < 0.01;
, p < 0.001;
, p < 0.0001 (ND + DSS vs. Other groups).
p < 0.05,
p < 0.01;
p < 0.001;
p < 0.0001 (Probiotic vs Paraprobiotic). It should be noted that p-values were corrected for multiple comparison using Tukey’s post hoc test
Fig. 3.
The levels of SOD, CAT, GSH, GPX (antioxidant enzymes), and MDA oxidant enzyme in gut. Statistical significance was determined using the following symbols: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001 (ND + PBS vs. Other groups).
p < 0.05,
p < 0.01;
p < 0.001;
p < 0.0001 (Probiotic vs Paraprobiotic). It should be noted that p-values were corrected for multiple comparison using Tukey’s post hoc test
Fig. 4.
The Levels of IL-1β, TNF-α (Inflammatory cytokines) and, IL-4, IL-10 (anti-inflammatory cytokines), in serum. Data are presented as the mean ± SD. Data are presented as the mean ± SD, N = 5 per group. Statistical significance was determined using the following symbols: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001 (ND + PBS vs. Other groups),
, p < 0.05;
, p < 0.01;
, p < 0.001;
, p < 0.0001 (ND + DSS vs. Other groups). It should be noted that p-values were corrected for multiple comparison using Tukey’s post hoc test
Our native probiotic and paraprobiotic could exert anti-inflammatory and antioxidant molecular capabilities via affecting Nrf2 and NF-kB signaling pathways
The native strains of probiotics and paraprobiotic have exhibited remarkable antioxidant and anti-inflammatory properties through their influence on the Nrf2 and NF-kB signaling pathways, as illustrated in Figs. 5 and 6. In relation to the antioxidative capabilities of our native probiotic strains and paraprobiotics by modulating the Nrf2 signaling pathway, the administration of DSS led to a notable decrease in the expression levels of all genes, in compared to negative control group (p < 0.0001). Nevertheless, our native probiotic strains and paraprobiotics demonstrated the ability to significantly enhance the expression levels (p < 0.0001) when compared to the positive control group. Regarding the NF-kB genes associated with the anti-inflammatory effects exerted by our agents, the introduction of DSS resulted in a substantial elevation in gene expression levels (p < 0.0001). However, it is important to note that our native probiotic strains along with paraprobiotics have demonstrated a significant ability to reduce the magnitude of gene expression, (p < 0.0001). Furthermore, it is worth mentioning that our native probiotic strains and paraprobiotics again have shown similar levels of efficacy in terms of their anti-inflammatory and antioxidant properties.
Fig. 5.
Relative gene expression [mean fold change] of antioxidants and Nrf2 related pathway genes expression in the different groups of treatments. Data were normalized with gapdh. Data are presented as the mean ± SD, N = 5 per group. Statistical significance was determined using the following symbols: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001 (ND + PBS vs. Other groups),
, p < 0.05;
, p < 0.01;
, p < 0.001;
, p < 0.0001 (ND + DSS vs. Other groups). It should be noted that p-values were corrected for multiple comparison using Tukey’s post hoc test
Fig. 6.
Relative gene expression [mean fold change] of NF-kB related pathway genes expression in the different groups of treatments. Data were normalized with gapdh. Data are presented as the mean ± SD, N = 5 per group. Statistical significance was determined using the following symbols: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001 (ND + PBS vs. Other groups),
, p < 0.05;
, p < 0.01;
, p < 0.001;
, p < 0.0001 (ND + DSS vs. Other groups). It should be noted that p-values were corrected for multiple comparison using Tukey’s post hoc test
Discussion
Inflammatory Bowel Disease (IBD) is a disorder with various etiological factors. The characteristics of IBD include heightened activity and expression of key inflammatory mediators such as NF-κB, cytokines TNF-α and IL-1β, as well as STAT3 and IL-17, which collectively contribute to the dysregulated immune response and chronic inflammation observed in the disease [26, 27]. Various noteworthy factors observed in the etiology of IBD encompass shifts in lifestyle, such as the adoption of automated work, exposure to industrial settings, and consumption of low-fiber diets [28]. IBD, is a type of disease with an unknown cause, often referred to as idiopathic. Despite some patients adhering to their regular and healthy dietary habits, it is important to note that IBD has the potential to initiate and advance within individuals. Hence, it is of utmost importance to consider the utilization of probiotics and their derivatives in the treatment of patients suffering from IBD. This is particularly crucial due to the fact that dysbiosis, an imbalance in the gut microbiota, plays a significant and influential part in the development and progression of IBD. The incorporation of probiotics into the patient’s regimen has the potential to positively impact and ameliorate this dysbiotic state, thereby potentially alleviating the symptoms and severity of IBD [29, 30]. Moreover, the potential impact of antioxidants that probiotics may have is another way in which these beneficial agents can improve the negative effects of IBD [31]. Here, our aim was to demonstrate the advantageous antioxidant properties of our native probiotic strains and paraprobiotic. Additionally, we aimed to compare the efficacy of these two agents in mice fed a normal diet, highlighting the positive impact of our native agents under regular diet.
The ongoing study uncovered significant effects of our native probiotic and paraprobiotic on countering the negative impacts of DSS as an inflammatory trigger. The phenotypic and molecular effects of our native probiotics and paraprobiotic are illustrated in Fig. 7. Based on our findings, our native agents were able to successfully alleviate inflammation and oxidative stress symptoms by influencing colitis markers, as well as antioxidant and anti-inflammatory characteristics at both phenotypic and molecular levels. Indeed, our native agents have the ability to produce a result that is somewhat similar to the negative control group (See Fig. 7). These data are in accordance with other reports. According to Liu et al., the derivatives from probiotic Limosilactobacillus fermentum could successfully protect against weight loss and reduction in colon length [32]. Garcia et al. also presented significant findings on the antioxidant capabilities of probiotic Lactobacillus rhamnosus GG, both in its live bacteria form and in its beneficial derivatives, paraprobiotic. These components effectively counteract oxidative stress induced by diet by modulating the levels of SOD, CAT, GPX, as well as impacting inflammatory cytokines such as IL-1β and TNF-α [33]. The data presented by Lorio et al. once again demonstrates that derivatives from probiotics may exhibit impressive antioxidant properties. Their study showed that the lysate of Lactobacillus sakei can enhance GSH levels and boost the activities of antioxidant enzymes. Furthermore, their findings suggest that these effects might be linked to the modulation of the Nrf2 signaling pathway [34]. Therefore, it seems that according to various studies probiotics and paraprobiotics are beneficial appropriate agents to control the adverse effects of inflammation and also exerting antioxidant capacities.
Fig. 7.
The general trend of A) enzymatic and B) Molecular efficacy of our native probiotic and paraprobiotic
The present research also brought attention to two other important points. First, based on our findings, both our native agents, probiotic and paraprobiotic, demonstrated beneficial qualities in reducing inflammation and acting as antioxidants, with no significant variance between these two aspects. Nevertheless, utilizing paraprobiotics might offer more benefits compared to probiotics, especially when considering the broader context of safety and practicality, as they inherently carry lower risks due to their non-viable nature. As mentioned earlier, paraprobiotics are described as probiotics that are either dead or inactive, which gives them certain advantages over probiotics due to their nature. Firstly, administering live bacteria probiotics can pose a challenge for individuals with weakened immune systems [35]. Furthermore, the utilization of paraprobiotics may decrease the chances of sepsis and antibiotic resistance, while also offering technological advantages such as extended shelf life. These characteristics further allow for their use in less developed areas [18]. Making comparision between these agents has been performed in other studies and their results showed difference between probiotics and paraprobiotics. For example, Lee et al., reported that live Bifidobacterium bifidum BGN4, heat-killed B. bifidum BGN4, and lysozyme-treated B. bifidum BGN4 (as paraprobiotics) had different affects. The paraprobiotic groups had less body weight loss and colon length shortening than the DSS or live groups. The lysozyme group exhibited better preserved intestinal barrier integrity than the live group by upregulating gap junction protein expression possibly through activating NOD-like receptor family pyrin domain containing 6/caspase-1/IL-18 signaling. The lysozyme group showed downregulated proinflammatory molecules, including p-inhibitor of kappa B proteins alpha (IκBα), cycloxygenase 2 (COX2), IL-1β, and T-bet, whereas the expression of the regulatory T cell transcription factor, forkhead box P3 expression, was increased [36]. Also, in another study conducted by Kye et al., the female BALB/C mice were treated with DSS, live Lactobacillus acidophilus PIN7, heat‐killed PIN7 or lysozyme‐treated PIN7. The results showed that female BALB/C mice treated with heat or lysozyme PIN7s howed less colitis severity and tissue damage versus the DSS group, with better disease activity scores and gut barrier proteins. Both heat and lysozyme groups had increased anti-inflammatory markers and decreased pro-inflammatory molecules, while heat notably lowered p-IκBα expression, affecting NF-κB signaling. COX-2 expression, associated with inflammation, was significantly lower in both treated groups compared to the DSS control. Moreover, paraprobiotic treatments modified gut microbiota composition, indicating a possible mechanism for their protective effects against colitis [37].
Another crucial point we noted in our research is the focus on the negative impacts of inflammatory conditions, which can persist even with a regular and normal diet. This underscores the importance of utilizing beneficial interventions, like probiotics and paraprobiotics, to counteract the harmful effects of inflammatory inducers. It should be noted that the current study has some limitations. For instance, while our current sample size is statistically reasonable, we acknowledge its limitations and plan to increase the sample size in future studies to further strengthen the validity of our conclusions, thereby addressing the potential shortcomings of this experiment.
Conclusion
Maintaining a normal diet is crucial, especially for patients with IBD, but it may not be enough to counteract the harmful effects of inflammation. Thus, the use of effective agents such as probiotics and their derivatives, known as paraprobiotics, is essential for managing oxidative stress and other factors that can impact the development and progression of IBD. The potent antioxidant and anti-inflammatory properties of our native probiotics and paraprobiotics at both molecular and phenotypic levels suggest that these agents, particularly paraprobiotics as non-living entities, could serve as complementary therapeutic options to enhance the quality of life for individuals with IBD.
Acknowledgements
The authors would like to acknowledge the staff at the Department of Bacteriology the Pasteur Institute of Iran.
Authors’ contributions
Performed the experiments: NR; AS, Data analysis: ShA, NR, EHAGKh; Writing of the manuscript: ShA; Revised manuscript: MR, MRP, MT and Conceived and designed the experiments: MR.
Funding
This work was supported by the by Pasteur Institute of Iran as Ph.D. thesis (B-9740) and Iran National Science Foundation (INSF) (Grant number: 4003890).
Data availability
The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
The experimental protocols were established following the Declaration of Helsinki and approved by the ethics committee of Pasteur Institute of Iran (IR.PII.REC1400.061).
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Niloofar Rezaie and Shadi Aghamohammad contributed as co-first authors.
References
- 1.Alemany-Cosme E, Sáez-González E, Moret I, Mateos B, Iborra M, Nos P, Sandoval J, Beltrán B. Oxidative stress in the pathogenesis of Crohn’s disease and the interconnection with immunological response, microbiota, external environmental factors, and epigenetics. Antioxidants. 2021;10(1):64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Bourgonje AR, von Martels JZ, Bulthuis ML, van Londen M, Faber KN, Dijkstra G, van Goor H. Crohn’s disease in clinical remission is marked by systemic oxidative stress. Front Physiol. 2019;10:499. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Cao H, Liu J, Shen P, Cai J, Han Y, Zhu K, Fu Y, Zhang N, Zhang Z, Cao Y. Protective effect of naringin on DSS-induced ulcerative colitis in mice. J Agric Food Chem. 2018;66(50):13133–40. [DOI] [PubMed] [Google Scholar]
- 4.Arda-Pirincci P, Aykol-Celik G. Galectin-1 reduces the severity of dextran sulfate sodium (DSS)-induced ulcerative colitis by suppressing inflammatory and oxidative stress response. Bosn J Basic Med Sci. 2020;20(3):319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Yang C, Merlin D. Unveiling colitis: a journey through the dextran sodium sulfate-induced model. Inflamm Bowel Dis. 2024;30(5):844–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Aleksandrova K, Koelman L, Rodrigues CE. Dietary patterns and biomarkers of oxidative stress and inflammation: a systematic review of observational and intervention studies. Redox Biol. 2021;42:101869. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Rosa R, Ornella R, Maria GC, Elisa S, Maria N, Chiara M, Antonio N, Tiziana M, Gian LDA, Francesco DM. The role of diet in the prevention and treatment of inflammatory bowel diseases. Acta Bio Med. 2018;89(Suppl 9):60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Papoutsopoulou S, Burkitt MD, Bergey F, England H, Hough R, Schmidt L, Spiller DG, White MH, Paszek P, Jackson DA. Macrophage-specific NF-κB activation dynamics can segregate inflammatory bowel disease patients. Front Immunol. 2019;10:2168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Muro P, Zhang L, Li S, Zhao Z, Jin T, Mao F, Mao Z. The emerging role of oxidative stress in inflammatory bowel disease. Front Endocrinol. 2024;15:1390351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sies H, Berndt C, Jones DP. Oxidative stress. Annu Rev Biochem. 2017;86:715–48. [DOI] [PubMed] [Google Scholar]
- 11.Sies H. On the history of oxidative stress: concept and some aspects of current development. Curr Opin Toxicol. 2018;7:122–6. [Google Scholar]
- 12.Liguori I, Russo G, Curcio F, Bulli G, Aran L, Della-Morte D, Gargiulo G, Testa G, Cacciatore F, Bonaduce D. Oxidative stress, aging, and diseases. Clin Interv Aging. 2018. 10.2147/CIA.S158513. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bourgonje AR, Feelisch M, Faber KN, Pasch A, Dijkstra G, van Goor H. Oxidative stress and redox-modulating therapeutics in inflammatory bowel disease. Trends Mol Med. 2020;26(11):1034–46. [DOI] [PubMed] [Google Scholar]
- 14.Nishida A, Nishino K, Sakai K, Owaki Y, Noda Y, Imaeda H. Can control of gut microbiota be a future therapeutic option for inflammatory bowel disease? World J Gastroenterol. 2021;27(23):3317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Wang Y, Xie Q, Zhang Y, Ma W, Ning K, Xiang J-Y, Cui J, Xiang H. Combination of probiotics with different functions alleviate DSS-induced colitis by regulating intestinal microbiota, IL-10, and barrier function. Appl Microbiol Biotechnol. 2020;104:335–49. [DOI] [PubMed] [Google Scholar]
- 16.Li C, Peng K, Xiao S, Long Y, Yu Q. The role of Lactobacillus in inflammatory bowel disease: from actualities to prospects. Cell Death Discov. 2023;9(1):361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kang YY, Song HJ, Park SY, Oh DN, Kim GY, Been NY, Kim DY, Lee EJ, Nam B-H, Lee JM. Comparative effects of probiotics and paraprobiotics derived from lactiplantibacillus plantarum, latilactobacillus sakei, and limosilactobacillus reuteri in a dss-induced ulcerative colitis mouse model. J Microbiol Biotechnol. 2025;35:e2411045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Siciliano RA, Reale A, Mazzeo MF, Morandi S, Silvetti T, Brasca M. Paraprobiotics: a new perspective for functional foods and nutraceuticals. Nutrients. 2021;13(4):1225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Martyniak A, Medyńska-Przęczek A, Wędrychowicz A, Skoczeń S, Tomasik PJ. Prebiotics, probiotics, synbiotics, paraprobiotics and postbiotic compounds in IBD. Biomolecules. 2021;11(12):1903. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Rohani M, Noohi N, Talebi M, Katouli M, Pourshafie MR. Highly heterogeneous probiotic Lactobacillus species in healthy Iranians with low functional activities. PLoS One. 2015;10(12):e0144467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Eshaghi M, Bibalan MH, Rohani M, Esghaei M, Douraghi M, Talebi M, Pourshafie MR. Bifidobacterium obtained from mother’s milk and their infant stool; a comparative genotyping and antibacterial analysis. Microb Pathog. 2017;111:94–8. [DOI] [PubMed] [Google Scholar]
- 22.Rezaie N, Ashrafian F, Shidvash F, Aghamohammad S, Rohani M. The effect of novel paraprobiotic cocktail on dextran sodium sulfate induced acute colitis control focusing on autophagy signaling pathway. Eur J Nutr. 2024. 10.1007/s00394-024-03376-0. [DOI] [PubMed] [Google Scholar]
- 23.Bassil F, Brown HJ, Pattabhiraman S, Iwasyk JE, Maghames CM, Meymand ES, Cox TO, Riddle DM, Zhang B, Trojanowski JQ. Amyloid-beta (Aβ) plaques promote seeding and spreading of alpha-synuclein and tau in a mouse model of Lewy body disorders with Aβ pathology. Neuron. 2020;105(2):260-275. e266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Faul F, Erdfelder E, Buchner A, Lang A-G. Statistical power analyses using G* Power 3.1: Tests for correlation and regression analyses. Behav Res Methods. 2009;41(4):1149–60. [DOI] [PubMed] [Google Scholar]
- 25.Parisa A, Roya G, Mahdi R, Shabnam R, Maryam E, Malihe T. Anti-cancer effects of Bifidobacterium species in colon cancer cells and a mouse model of carcinogenesis. PLoS One. 2020;15(5):e0232930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Lee SH. eun Kwon J, Cho M-L. Immunological pathogenesis of inflammatory bowel disease. Intest Res. 2018;16(1):26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Szatkowski P, Krzysciak W, Mach T, Owczarek D, Brzozowski B, Szczeklik K. Nuclear factor-κB - importance, induction of inflammation, and effects of pharmacological modulators in Crohn's disease. J Physiol Pharmacol. 2020;71(4):453–65. [DOI] [PubMed]
- 28.Actis GC, Pellicano R, Fagoonee S, Ribaldone DG. History of inflammatory bowel diseases. J Clin Med. 2019;8(11):1970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Nishida A, Inoue R, Inatomi O, Bamba S, Naito Y, Andoh A. Gut microbiota in the pathogenesis of inflammatory bowel disease. Clin J Gastroenterol. 2018;11:1–10. [DOI] [PubMed] [Google Scholar]
- 30.Toumi R, Samer A, Soufli I, Rafa H, Touil-Boukoffa C. Role of probiotics and their metabolites in inflammatory bowel diseases (IBDs). Gastroenterol Insights. 2021;12(1):56–66. [Google Scholar]
- 31.Alkushi AG, Abdelfattah-Hassan A, Eldoumani H, Elazab ST, Mohamed SA, Metwally AS, S. El-Shetry E, Saleh AA, ElSawy NA, Ibrahim D. Probiotics-loaded nanoparticles attenuated colon inflammation, oxidative stress, and apoptosis in colitis. Sci Rep. 2022;12(1):5116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Liu C, Qi X, Li D, Zhao L, Li Q, Mao K, Shen G, Ma Y, Wang R. Limosilactobacillus fermentum HF06-derived paraprobiotic and postbiotic alleviate intestinal barrier damage and gut microbiota disruption in mice with ulcerative colitis. J Sci Food Agric. 2024;104(3):1702–12. [DOI] [PubMed] [Google Scholar]
- 33.Arellano-García L, Trepiana J, Martínez JA, Portillo MP, Milton-Laskibar I. Beneficial effects of viable and heat-inactivated Lactobacillus rhamnosus GG administration on oxidative stress and inflammation in diet-induced NAFLD in rats. Antioxidants. 2023;12(3):717. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Iorio R, Petricca S, Luzi C, Bellio P, Cristiano L, Festuccia C, Amicosante G, Celenza G. Lactobacillus sakei pro-bio65 reduces TNF-α expression and upregulates GSH content and antioxidant enzymatic activities in human conjunctival cells. Transl Vis Sci Technol. 2021;10(6):8–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Akter S, Park J-H, Jung HK. Potential health-promoting benefits of paraprobiotics, inactivated probiotic cells. J Microbiol Biotechnol. 2020;30(4):477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Lee S-Y, Lee B-H, Park J-H, Park M-S, Ji G-E, Sung M-K. Bifidobacterium bifidum BGN4 paraprobiotic supplementation alleviates experimental colitis by maintaining gut barrier and suppressing nuclear factor kappa B activation signaling molecules. J Med Food. 2022;25(2):146–57. [DOI] [PubMed] [Google Scholar]
- 37.Kye YJ, Lee SY, Kim HR, Lee BH, Park JH, Park MS, Ji GE, Sung MK. Lactobacillus acidophilus PIN7 paraprobiotic supplementation ameliorates DSS-induced colitis through anti-inflammatory and immune regulatory effects. J Appl Microbiol. 2022;132(4):3189–200. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.







