Skip to main content
Nature Communications logoLink to Nature Communications
. 2025 Sep 26;16:8478. doi: 10.1038/s41467-025-63338-w

CD137L promotes immune surveillance in melanoma via HLTF regulation

Long Liang 1,2,#, Lin Zhu 1,3,#, Xin Li 2,#, Wenbin Zhou 1,3, Yanbin Zhang 2, Mien-Chie Hung 4,5, Guanxiong Zhang 1,3,, Yong Chen 6,, Xinwei Kuang 1,3,, Juan Su 1,3,, Jing Liu 2,, Xiang Chen 1,3,, Hong Liu 1,3,
PMCID: PMC12475238  PMID: 41006211

Abstract

Immune checkpoint blockers (ICBs) have demonstrated substantial efficacy across various malignancies, yet the benefits of ICBs are limited to a subset of patients. Therefore, it is essential to identify novel therapeutic targets. By integrating multi-omics data from cohorts of patients with melanoma treated with ICBs, a positive correlation is observed between tumor CD137L expression and the efficacy of PD-1 blockade. Functionally, CD137L induction in cancer cells significantly enhances anti-tumor immunity by promoting CD8+ T cell survival, both in vivo and in vitro. Mechanistically, helicase-like transcription factor (HLTF) is identified as a pivotal transcriptional regulator of CD137L, controlling its expression through phosphorylation of serine at position 398. Therapeutically, the AMPK agonist AICAR (acadesine) as an inducer of CD137L, exhibiting synergistic effects with PD-1 or CTLA-4 blockade. In summary, our findings elucidate a mechanism controlling CD137L expression and highlight a promising combination therapy to enhance the efficacy of ICBs in melanoma. One Sentence Summary: Inducing co-stimulatory immune checkpoint CD137L expression in melanoma cells enhances T cell-mediated anti-tumor immunity.

Subject terms: Tumour immunology, Cancer immunotherapy


Immune checkpoint blockade is an effective therapy in melanoma, but response is highly variable between patients. Here, the authors show that Inducing co-stimulatory immune checkpoint CD137L expression in melanoma cells enhances T cell-mediated anti-tumor immunity.

Introduction

In recent years, immunotherapy has significantly transformed cancer treatment, markedly extending patient survival1. Immunotherapies primarily activate anti-tumor immune responses by modulating the signaling pathways of immunostimulatory or immunosuppressive molecules2. Immune checkpoint inhibitors, such as anti-PD-1 and anti-CTLA-4 antibodies, have shown clinical efficacy in 30–40% of patients with advanced melanoma3. However, a substantial proportion of patients remain unresponsive to these therapies, underscoring the need to identify additional immune checkpoint molecules as therapeutic targets.

The immune checkpoint CD137 (4-1BB, TNFRSF9), a member of the tumor necrosis factor (TNF) receptor superfamily, is an inducible receptor predominantly expressed on activated T lymphocytes and natural killer (NK) cells4. Its only known natural ligand, CD137L (4-1BBL, TNFSF9), is expressed on antigen-presenting cells (APCs)5. CD137L, a type II transmembrane protein of the TNF superfamily (TNFSF), exists as a trimer in its membrane-bound form. Upon binding to receptors on T cells, it recruits specific TNF receptor-associated factors (TRAF1, TRAF2, and TRAF3) and initiators6. TRAF2 and TRAF3 then trigger downstream signaling cascades, including the NF-κB, ERK, JNK, and p38 MAPK pathways, delivering a potent co-stimulatory signal that enhances T cell activation7. Over the past few decades, CD137 has been explored as a potential second-generation immuno-oncology target to further activate tumor-specific T cells8. Agonistic antibodies targeting CD137 have been proven to effectively reduce tumor growth in mouse models of melanoma, glioblastoma, and lymphoma9. However, clinical trials with two CD137-specific monoclonal antibodies (mAbs) were halted due to intolerable hepatotoxicity (urelumab, BMS) or low efficacy (utomilumab, Pfizer)10,11. A major challenge in advancing CD137 agonists for clinical use lies in minimizing off-target toxicity while maintaining robust anti-tumor efficacy.

In addition to its role as a ligand for CD137, CD137L can also transduce signals via reverse signaling, a process that enables cells expressing CD137L to receive and transmit signals12. Consequently, CD137L plays distinct roles in different cell types13. Recent studies have revealed that while CD137L is primarily expressed in APCs, its aberrant expression in tumor cells has been observed in various cancers, where it may influence tumor progression1417. For example, CD137L promotes drug resistance in pancreatic cancer and supports metastasis in colon cancer18,19. Understanding the role of CD137-CD137L interactions in specific malignancies is essential before the clinical application of agonistic anti-CD137 antibodies or blockade of CD137-CD137L signaling. However, the function and regulation of CD137L in melanoma remain poorly understood.

This study analyzed data across multiple tumor types and revealed that high CD137/CD137L expression correlates with better immunotherapy response and prognosis. Notably, CD137L expression was lower in melanoma compared to normal pigmented nevi. Exogenous overexpression of CD137L did not influence melanoma cell proliferation in vivo or in vitro but was found to activate T cells to eliminate tumor cells. Furthermore, HLTF was identified as a key regulator of CD137L expression, which binds to the CD137L promoter and represses its expression. AMPK phosphorylates HLTF at Ser398, which activates CD137L expression. Activation of AMPK upregulates CD137L, leading to significant synergistic effects with other immune checkpoint inhibitors in vivo.

Results

CD137L expression levels were correlated with the efficacy of PD-1 mAb therapy in patients with melanoma

Immune response is co-regulated by both inhibitory and co-stimulatory checkpoints. To investigate whether co-stimulatory checkpoints correlate with their sensitivity to immunotherapy, we analyzed the correlation between the TNF superfamily of co-stimulatory checkpoints and sensitivity to anti-PD-1 therapy. We found that the expression level of ligand-receptor group CD137/CD137L (TNFRSF9/TNFSF9) was associated with better overall survival (OS) or progression-free survival (PFS) in 6 independent immunotherapy cohorts, involving melanoma, lung cancer, head and neck cancer (Fig. 1a and Supplementary Table 1). We further compared the performance of CD137L with known biomarkers (baseline levels of PD-L1 and CD8) for distinguishing non-responders and responders with immunotherapy. We observed that CD137L achieved acceptable performance in more datasets, and in most cases, outperformed CD8 and PD-L1(CD274) in the 10 independent cohorts (Fig. 1b). To investigate the relationship between tumor expressed CD137L and immunotherapy with PD-1 mAb, we analyzed the melanoma patient’s samples with immunotherapy, tumor samples from 29 patients with melanoma treated with the PD-1 antibody (Supplementary Table 2). The patient samples were divided into responders and non-responders (Fig. 1c), and the expression levels of CD137L were determined by immunofluorescence assay. The immunofluorescence showed that high-CD137L expression significantly distinguished patient responsiveness to PD-1 mAb therapy in patients (Fig. 1d). Patients with high-CD137L expression also have significantly longer PFS, which can efficiently distinguish between responders and non-responders (Fig. 1e). Our results suggest that CD137L in tumors may be a predictive indicator of the effectiveness of PD-1 antibody therapy.

Fig. 1. CD137L expression levels were correlated with the efficacy of PD-1 mAb therapy in melanoma patients.

Fig. 1

a Forest plot showing the expression level of CD137L/CD137 (TNFSF9/TNFRSF9) associated with prognosis of ICB in seven datasets. Cox regression was performed (likelihood p < 0.05). Datasets were annotated in Supplementary Table 1. b Performance of predicting immunotherapy response based on the expression levels of TNFSF9/TNFRSF9 (red), PD-L1 (CD274, green), and CD8 (average expression of CD8A and CD8B, blue). The AUC of the ROC curves were calculated. c Characterization of melanoma patients with ICB therapy in Xiangya Hospital. Each column represents an individual patient. Patients with CR, PR, and SD >3 months were classified as responders (R), while patients with SD ≤3 months, and PD were classified as non-responders (NR). d The expression of CD137L by mIHC in melanoma patients with a response or no response to ICB therapy. e Survival and comparison analysis between responder and non-responder for CD137L. f Expression level of CD137L in melanoma using single-cell transcriptomic data (GSE189889). The left panel represents the annotation of each cell cluster. We used a UMI count >0 as the threshold to distinguish between CD137L+ and CD137L melanoma cell subpopulations. The middle and the bottom right showed the gene expression of CD137L in single-cell resolution. g Differential genes between CD137L+ and CD137L melanoma cells were identified and subjected to GSEA functional enrichment analysis. The X-axis shows the average log2FC of genes in CD137L+ cells relative to CD137L cells; the Y-axis shows the density of genes at specific log2FC values. h Representative image from Immunofluorescence staining of CD137L (red) in melanoma and matched benign tissue from different cases. Image J was used to perform a semi-quantitative analysis. Scale bars, 100 µm. i Kaplan–Meier plot of overall survival for acral melanoma patients (He_SignalTransductTargetTher_2022 cohort). d, h Data represent mean ± SD. Significance was determined by the Wilcoxon rank-sum test (d, h) and log-rank test (e, i). d responder n = 14 and non-responder n  =  15, h benign n = 24 and melanoma n = 34 biologically independent samples.

The expression pattern of CD137L in melanoma was further evaluated by analyzing single-cell RNA sequencing (scRNA-seq) datasets from patients with melanoma, which allowed for the examination of CD137L expression across individual cell populations. It is noteworthy that the percentage of CD137L-positive cells within the melanoma cell population is minimal, and these cells exhibit a lower expression level compared to other cell types. (Fig. 1f). However, a subset of melanoma cells exhibited elevated CD137L expression, indicating increased tumor immunogenicity (Fig. 1lg). Further analysis of samples from 35 patients with melanoma and 24 benign cases from healthy donors revealed significantly lower CD137L expression in patients with melanoma (Fig. 1h). Higher CD137L expression levels were associated with improved overall survival (Fig. 1i), suggesting that elevated CD137L may enhance anti-tumor immunity.

Overexpression of CD137L enhanced cancer immune surveillance both in immune-competent mice and melanoma cells

To investigate the role of CD137L in melanoma, CD137L was overexpressed in A375, SK-MEL-28, and B16F10 cells. However, overexpression did not affect melanoma cell growth (Supplementary Fig. 1A, B). In vivo tumorigenic assays using immunodeficient (SCID) nude mice showed no significant impact of CD137L overexpression on tumor cell proliferation (Fig. 2a, b and Supplementary Fig. 1C). As CD137L serves as a ligand for the co-stimulatory immune checkpoint CD137, its overexpression may modulate immunity, including T cell activation. Tumorigenesis experiments in immunocompetent mice revealed that CD137L overexpression significantly suppressed tumor growth without affecting body weight, and prolonged survival (Fig. 2c–e and Supplementary Fig. 1D). Further analysis of immune cell infiltration in melanoma revealed a positive correlation between CD137L and CD8+ T cells (Fig. 2f). Flow cytometric analysis of intratumoral immune cells showed that the CD3+ and CD8+ T cell populations increased, and the proportion of GZMB+ CD8+ T cells in the CD137L overexpression group increased significantly, while other cell types did not change significantly, with activated T cells (Ki67+) increasing and macrophages decreasing (Fig. 2g–j and Supplementary Fig. 1E, F). Immunofluorescence staining of tumor tissues further confirmed a significant increase in activated CD8+ T cell infiltration in the CD137L overexpression group (Fig. 2k, l). Additionally, an in vitro T cell killing assay demonstrated that CD137L knockdown suppressed T cell cytotoxicity against tumor cells (Fig. 2m), whereas CD137L overexpression significantly enhanced T cell-mediated tumor cell killing (Fig. 2n). These results highlight the critical role of CD137L in tumor immunity in melanoma, suggesting that CD137L upregulation may offer a promising therapeutic strategy.

Fig. 2. Induction of CD137L enhanced cancer immune surveillance both in immune-competent mice and melanoma cells.

Fig. 2

a Representative images of the endpoint tumors in BALB/c nude mice. b B16F10 cells with CD137L stable expression and vector cells were injected into BALB/c nude mice on day 0, tumor volume was measured on the indicated time points. c Representative images of the endpoint tumors in C57BL/6 mice. d B16F10 cells with CD137L stable expression and vector cells were injected into C57BL/6 mice on day 0, tumor volume was measured on the indicated time points. e Kaplan–Meier survival curves for the survival of mice bearing CD137L overexpression or vector tumors. f Correlations with immune cells for CD137L. Spearman’s correlation test was performed. gj CD137L+ cells (g), CD3+ T cells (h), CD8+ T cells (i), and GZMB + CD8+ T cells (j) were analyzed in mouse tumors by flow cytometry. k, l Immunostaining of CD3+ (Cyan), CD4+ (Magenta), CD8+ (Red), GZMB+ (Green) in the B16F10 tumor mass. Scale bar, 100 μm. m A375 shNC and shCD137L knockdown cells cocultured with activated T cells for 24 h were subjected to crystal violet staining. Tumor cell to T-cell ratio, 1:2.5 or 1:5, crystal staining (left panel) and frequency (right panel), Student’s t-test. n Vector and overexpression of CD137L A375 cells cocultured with activated T cells for 48 h were subjected to crystal violet staining. Tumor cell to T-cell ratio, 1:2.5 or 1:5 crystal staining (left panel) and frequency (right panel). Data: mean ± SD (a, c, gj, ln), mean ± SEM (b, d). Significance was determined by the log-rank test (e), two-sided unpaired Student’s t-test (ad, gj, l, n) and one-way ANOVA followed by Tukey’s multiple comparisons test (m). n = 3 biologically independent samples per group, representative of three independent experiments with similar results in (kn). n  =  6 mice per group in (ad, gj). n  =   5 mice per group in (e). Consistent in vivo results were observed in at least two independent experiments, with at least five mice per condition.

HLTF functioned as a negative regulator controlling CD137L transcription

The results above indicate that CD137L expression is low in melanoma, and its upregulation could represent a promising therapeutic strategy. To investigate the regulatory mechanism underlying CD137L expression in melanoma, this study first assessed the methylation status of the CD137L gene promoter in melanoma versus adjacent non-tumor tissue but found no significant difference (Supplementary Fig. 2A). Then, a DNA pull-down assay was performed to identify proteins that bind to the CD137L promoter region (Supplementary Fig. 2B). Specific protein bands were detected in the CD137L promoter group using coomassie staining, and these proteins were subsequently identified by mass spectrometry (Fig. 3a). A total of 179 proteins were identified in the two bands (Supplementary Dataset 1). Further analysis of TCGA data revealed that HLTF was the most significantly negatively correlated transcription factor with CD137L expression in both the TCGA-SKCM and Xiangya cohorts among the 179 candidates (Fig. 3b, c and Supplementary Fig. 2C, D). This negative correlation was also observed across nearly all cancer types in the TCGA database (Fig. 3d). Experimental validation confirmed that HLTF directly binds to the CD137L promoter in melanoma cell lines (Fig. 3e). Luciferase reporter assays showed that HLTF overexpression inhibited CD137L promoter-driven dual-luciferase expression in a dose-dependent manner (Fig. 3f). Moreover, ChIP assays confirmed endogenous binding of HLTF to the CD137L promoter (Fig. 3g, h). Overexpression of HLTF in melanoma cells resulted in decreased CD137L mRNA and protein levels, as well as reduced membrane-bound CD137L content. Conversely, knockdown or knockout of HLTF in melanoma cells significantly upregulated CD137L expression and increased membrane-associated CD137L levels (Fig. 3i–l, Supplementary Fig. 2E). To further explore the role of HLTF in regulating CD137L-mediated tumor immunity, the relationship between HLTF expression and tumor immune cell infiltration was analyzed. A significant decrease in CD8+ T cell levels was observed in the presence of both HLTF and CD137L, other immune cell populations remained unaffected, suggesting that HLTF may play a negative regulatory role in CD8+ T cell activation (Fig. 3m and Supplementary Fig. 2F).

Fig. 3. HLTF functioned as a negative regulator controlling CD137L transcription.

Fig. 3

a Eluted proteins analyzed by SDS-PAGE/silver staining; differential bands (red triangles) subjected to mass spectrometry. b Correlation between CD137L and potential regulators (TCGA-SKCM cohort). c Spearman’s correlation of CD137L and HLTF (Xiangya cohort, scatter plot). d CD137L-HLTF correlation across 33 TCGA cancer types (red/blue: significant positive/negative; Spearman’s test). e CD137L promoter pull-down assay in A375/SK-MEL-28 cells detecting HLTF (WB). f Dual-luciferase assay: CD137L promoter activity with graded HLTF overexpression. g Schematic of HLTF binding to CD137L promoter core region; primers #1-#3 target amplified segments. h ChIP-qPCR (primers #1-#3) confirming HLTF binding to CD137L promoter. i qPCR: HLTF and CD137L mRNA levels with graded HLTF overexpression (A375). j qPCR: HLTF and CD137L mRNA after shRNA-mediated HLTF knockdown (A375). k The protein levels of HLTF and CD137L in A375 cells with HLTF overexpression or shRNA-mediated HLTF knockdown. GAPDH serves as the loading control. l Flow cytometry: Membrane CD137L expression after HLTF modulation. m CD8+ T-cell infiltration in groups stratified by HLTF/CD137L expression (boxplots; Wilcoxon test). no Crystal violet staining: Tumor cell (A375) viability after 24 h coculture with activated T cells (1:2.5 ratio). n shHLTF vs. shNC; o HLTF-OE vs. vector. p Tumor growth kinetics in C57BL/6 mice injected with HLTF-KO vs. sgNC B16F10 cells. q Endpoint tumor images (HLTF-KO vs. sgNC). r Endpoint tumor weights. s Survival analysis of mice bearing HLTF-KO vs. sgNC tumors (log-rank test). t Flow cytometry: CD45CD137L+ cells, CD3+CD8+ T cells, and CD8+GZMB+ T cells in xenografts. u Immunofluorescence: CD3+ (cyan), CD4+ (magenta), CD8+ (red), GZMB+ (green) cells in xenografts. Data: mean ± SD (f, hj, lo, r, t, u) and mean ± SEM (p). Significance was determined by the two-sided unpaired Student’s t-test (h, o), log-rank test (s), and one-way ANOVA followed by Tukey’s multiple comparisons test (f, i, j, m, n, r, t, u). In vitro: n = 3 biological replicates; representative of three experiments (a, el, n, o, u). In vivo: n = 6 mice/group (p, q, r). n = 5 mice/group (s, t). Consistent in vivo results were observed in at least two independent experiments, with at least five mice per condition.

To further investigate the regulatory role of HLTF in tumor immunity, in vitro T cell killing assays were conducted. HLTF knockdown significantly enhanced T cell-mediated cytotoxicity against tumor cells, while HLTF overexpression protected tumor cells from T cell-induced killing (Fig. 3n, o). In vivo tumorigenesis assays in immunocompetent mice revealed that knockdown or knockout of HLTF in the B16F10 cell line significantly inhibited tumor growth without affecting body weight and prolonged the survival of mice (Fig. 3p–s and Supplementary Fig. 3A–H). Flow cytometry analysis demonstrated that CD137L expression was upregulated in both the HLTF knockdown and knockout groups (Fig. 3t and Supplementary Fig. 3i). Additionally, CD8+ T cell infiltration in tumors was significantly increased in the HLTF knockdown group, and the proportion of GZMB+ activated T cells was notably higher (Fig. 3t and Supplementary Fig. 3J). Immunofluorescence analysis further revealed significantly enhanced infiltration of CD3+, CD4+, CD8+, and GZMB+ T cells in the HLTF knockout group (Fig. 3u). These results suggest that HLTF acts as a negative regulator of CD137L expression, and its reduction leads to upregulation of CD137L, thereby enhancing anti-tumor immunity and inhibiting melanoma growth.

HLTF regulates CD137L expression via phosphorylation of serine at position 398

To further explore the mechanisms underlying HLTF regulation of CD137L expression, this study analyzed public mass spectrometry data from the PhosphoSitePlus database (https://www.phosphosite.org/) and identified several phosphorylation sites on HLTF, which were predicted to be regulated by different kinases (Fig. 4a, PhosphoNET, http://www.phosphonet.ca/). Subsequently, these kinases were targeted with specific agonists and inhibitors. AMPK kinase agonists, GSK621 and AICAR (5-Aminoimidazole-4-carboxamide ribonucleoside), significantly increased CD137L expression, while the AMPK inhibitor dorsomorphin downregulated CD137L levels of membrane location (Fig. 4b). To determine whether HLTF phosphorylation is regulated by AMPK, immunoprecipitation assays were performed, confirming that phosphorylated AMPK interacts with HLTF (Fig. 4c, d). Further analysis showed that AMPK binds to HLTF at the SNF2-N and ZFC domains (Fig. 4e). Immunofluorescence microscopy revealed co-localization of HLTF and AMPK in the nucleus, and treatment with AICAR enhanced this co-localization (Fig. 4f). Moreover, the binding of phosphorylated AMPK to HLTF was strengthened upon AICAR treatment (Fig. 4g), and HLTF phosphorylation levels were elevated after AICAR administration (Fig. 4h). To pinpoint the phosphorylation site of HLTF by AMPK, serine residues at positions 397, 398, 397/398, 400, 421, and 635 were mutated to alanine to mimic the dephosphorylated state. Notably, mutation of serine at position 398 significantly inhibited AICAR-induced phosphorylation of HLTF (Fig. 4i). Furthermore, DNA pull-down and ChIP assays revealed reduced binding of HLTF to the CD137L promoter following AICAR treatment (Fig. 4j, k). These results suggest that AMPK upregulates CD137L expression by phosphorylating HLTF, thereby diminishing its inhibitory binding to the CD137L promoter.

Fig. 4. HLTF regulated CD137L expression via phosphorylation of serine at position 398.

Fig. 4

a HLTF phosphorylation sites (PhosphoSitePlus) and kinase predictions (PhosphoNET; dots = sites). b Flow diagram: Melanoma cells treated with kinase inhibitors/agonists for membrane CD137L detection (left: compounds; right: targeted kinases). c Exogenous immunoprecipitation: HLTF-Flag IP (anti-Flag) to perform WB to detect the p-AMPK (Thr172) in A375/SK-MEL-28. d Endogenous immunoprecipitation: HLTF IP (anti-HLTF) to perform WB to detect the p-AMPK (Thr172) in A375/SK-MEL-28. e Exogenous expression of different GFP-tagged fragments of HLTF is shown in the left schematic image with HA-tagged AMPK and Immunoprecipitation of GFP by using anti-GFP beads in A375 cells. Western blotting to detect the HA and GFP-tagged proteins. f Immunofluorescence: HLTF/p-AMPK co-localization with or without AICAR (0.5 mM, 24 h; A375). Red: HLTF, Green: p-AMPK, Blue: DAPI. g HLTF IP in AICAR-treated (0.5 mM, 24 h) A375 to perform WB for p-AMPK (Thr172)-HLTF interaction. h HLTF IP in AICAR-treated (0.5 mM, 24 h) A375 to perform WB with pan-pSer/Thr antibody. i HLTF Ser to Ala mutants (S397A/S398A/S400A/S421A/S635A) with or without AICAR to perform WB with pan-pSer/Thr. j CD137L promoter pull-down with or without AICAR (0.5/1 mM, 24 h; A375) to perform WB for HLTF binding. k ChIP-qPCR: HLTF binding to CD137L promoter with or without AICAR (0.5 mM). l RNA-seq: Immune checkpoint expression with or without AICAR (0.5 mM; heatmap and log2FC bar plot). m WB: CD137L/p-AMPK/AMPK in A375/SK-MEL-28 with or without AICAR gradient (0–1.5 mM, 24 h; GAPDH control). n qPCR: CD137L mRNA with or without AICAR gradient (0–1.5 mM, 24 h; A375/SK-MEL-28). o Flow cytometry: Membrane CD137L with or without AICAR gradient (0–1.5 μM, 24 h; HaCaT/A375/SK-MEL-28). p In vivo: Tumor growth (CD137L-KO vs. Ctrl) with or without AICAR. q Endpoint tumor weights. r Flow cytometry: Tumor-infiltrating CD8+/CD3+ T cells and CD8+GZMB+ cells. s Crystal violet: shCD137L vs. shNC with or without AICAR (0.5 mM) cocultured with T cells (ratios 1:2.5/1:5). t Crystal violet: HLTF WT/S398A/S398D with or without AICAR (0.5 mM) cocultured with T cells (ratio 1:2.5). Data: mean ± SD (k, n, o, qt) and mean ± SEM (p). Significance was determined by one-way ANOVA followed by Tukey’s multiple comparisons test. In vitro: n = 3 biological replicates. representative of three experiments (bk, mo, s, t). In vivo: n = 5 mice/group (pr). Consistent in vivo results were observed in at least two independent experiments, with at least five mice per condition.

Given AMPK’s regulation of multiple substrates and its close link to immunity, its action through CD137L and HLTF was further investigated. Melanoma cells were treated with AICAR, and transcriptomic analysis revealed increased activation of AMPK-related pathways, including MAPK and cAMP signaling (Supplementary Fig. 4A, B). Analysis of immune checkpoint expression revealed CD137L as the most significantly upregulated checkpoint (Fig. 4l and Supplementary Dataset 2). Treatment of melanoma cell lines with varying concentrations of AICAR showed a dose-dependent increase in CD137L expression at both the protein and mRNA levels, as well as enhanced membrane localization of CD137L, with no effect on the immortalized keratinocyte HaCaT cell line (Fig. 4m–o). Other AMPK agonists, Metformin, and GSK621 also increased CD137L protein of membrane levels (Supplementary Fig. 4C–E). Different concentrations of AICAR-treated immunocompetent tumor-bearing mice significantly inhibited tumor growth and promoted T cell infiltration and activation, while having no significant effect on the content of other cells in the tumor (NK, B, DC, M2 macrophage cells) (Supplementary Fig. 4F–J). Furthermore, T-cell killing assays demonstrated that AICAR significantly enhanced T cell-mediated cytotoxicity (Supplementary Fig. 4K). To further elucidate the function of CD137L in the mechanism of AICAR, CD137L knockout mouse cell lines were utilized to generate tumors and were treated with or without AICAR. The results demonstrated that tumor growth accelerated in the absence of CD137L, the anti-tumor effect of AICAR was ablated in the CD137L knockout group (Fig. 4p, q), and the infiltration and activation of T cells in the tumor diminished in the CD137L knockout group with or without AICAR (Fig. 4r and supplementary Fig. 4L–O). Concurrently, the content of CD137L in B cells, M2 macrophages, and dendritic cells remained largely unaltered following AICAR treatment (Supplementary Fig. 4P). In vitro experimentation yielded analogous outcomes. Pretreatment with AICAR following CD137L knockdown abolished the ability of AICAR to enhance T-cell cytotoxicity (Fig. 4s). Furthermore, HLTF overexpression followed by AICAR treatment revealed that both wild-type HLTF and the S398A mutant inhibited AICAR-enhanced T-cell killing of tumor cells. In contrast, the S398D mutation, where serine 398 was substituted with aspartate to mimic HLTF phosphorylation, restored the ability of AICAR to enhance T cell cytotoxicity, similar to the effect of AICAR treatment alone (Fig. 4t). These results suggest that AMPK-mediated phosphorylation of HLTF plays a pivotal role in alleviating HLTF’s inhibitory effect on CD137L expression.

Synergistic effect of CD137L inducer and PD-1 mAb or CTLA-4 mAb therapy in melanoma preclinical mouse models

The application of CTLA-4 and PD-1 monoclonal antibodies has marked significant progress in tumor immunotherapy, however, there remains potential for further enhancing therapeutic efficacy. Combining different therapeutic agents is a promising strategy to enhance treatment outcomes. As a co-stimulatory checkpoint independent of both the CTLA-4 and PD-1 pathways, CD137L emerges as a potential target for combination therapy. AICAR, a specific AMPK agonist, is currently in clinical use for the treatment and protection against cardiac ischemic injury. To assess the potential of AICAR in melanoma immunotherapy, a low dose of AICAR was combined with clinically approved immune checkpoint inhibitors, anti-CTLA-4 and anti-PD-1 monoclonal antibodies. Results demonstrated that AICAR alone suppressed tumor growth, and, notably, when combined with the anti-CTLA-4 and anti-PD-1 antibodies, tumor growth was significantly more inhibited than with the single-agent treatments in immunocompetent mice (Fig. 5a–c). Histological analysis of major organs (heart, liver, spleen, lung, kidney, and skin) and liver, kidney function, and blood cell counts showed no obvious toxic side effects in the combination treatment group (Supplementary Fig. 5). No significant differences in body weight were observed (Supplementary Fig. 6A). Tumor volume was also markedly reduced in the combination treatment group (Fig. 5d), and the survival of mice was prolonged compared to those receiving single-agent therapies (Fig. 5e). Additionally, immunofluorescence analysis revealed a significant increase in CD3+, CD4+, CD8+ T cells and GZMB+ CD8+ T cells within the tumor microenvironment in the combination therapy group (Fig. 5f, g). Flow cytometry also showed that CD3+, CD4+, CD8+ T cells and active GZMB+ CD8+ T cells were significantly increased in the combination of AICAR with CTLA-4 mAb or PD-1 mAb (Fig. 5h). We also tested other types of T cells and other immune cells, and the results showed that M2 macrophages, Treg cells, and exhausted T cells decreased when used in combination, while proliferating T cells increased (Ki67+), and there was no significant change in NK cells (Supplementary Fig. 6B–L). These results indicate that AICAR, when combined with CTLA-4 and PD-1 blockade, enhances melanoma inhibition.

Fig. 5. Synergistic effect of CD137L inducer and PD-1 mAb or CTLA-4 mAb therapy in melanoma preclinical mouse models.

Fig. 5

a The model diagram shows that B16F10 cells were injected into C57BL/6 mice on day -6, the administration method of the combination of AICAR and CLTA-4 antibody in mice, AICAR 300 mg/kg, intraperitoneally administered every day, CTLA-4 antibody with an initial dose of 200 µg/mouse, followed by 100 µg/mouse once every three days. b The model diagram shows the administration method of the combination of AICAR and PD-1 monoclonal antibody in mice, AICAR 300 mg/kg, intraperitoneally administered every day, PD-1 monoclonal antibody with an initial dose of 200 µg/mouse, followed by 100 µg/mouse once every 3 days. c Tumor volumes were measured at the indicated time points and treated with the control group, AICAR group, anti-CTLA-4 group, anti-PD-1 group, or the combination of the above groups, with five mice in each experimental group and three mice in each IgG2a and IgG2b control group. d Endpoint tumor weights. e Kaplan–Meier survival curves for the survival of mice bearing tumors treated with control, AICAR, anti-CTLA-4, and anti-PD-1 or the combination. Significance was determined by the log-rank test. (f, g) Representative immunofluorescence staining for different treatments (f) and frequency (g) of CD3+ (Cyan), CD4+ (Magenta), CD8+ (Red), GZMB+ (Green) cells in tumor xenograft of indicated groups. For details on visualization, statistics and reproducibility, see Methods. h Representative frequency of CD3+/CD45+ T cells, CD4+/ CD8 + T cells, CD8+/ CD3+ T cells and GZMB+CD8+ T cells in tumor xenograft of indicated groups. Data represent mean ± SD (d, g, h). Significance was determined by the one-way ANOVA followed by Tukey’s multiple comparisons test (d, g, h) and log-rank test (e). n = 3 biologically independent samples per group, representative of three independent experiments with similar results in (f, g). n  =  5 mice per group in (ce, h). Consistent in vivo results were observed in at least two independent experiments, with at least five mice per condition.

Discussion

CD137L, primarily expressed on APCs, co-stimulates T-cell activation through binding to CD137. While it has been identified in tumor cells and plays varying roles across different cancer types, its function in melanoma remains unclear. In this study, activated AMPK can phosphorylate HLTF to enhance CD137L expression, thereby activating T cells to eliminate melanoma cells (Fig. 6). The combination of the AMPK agonist AICAR with CTLA-4 or PD-1 immune checkpoint-blocking antibodies significantly inhibited melanoma growth in immunocompetent mice. Furthermore, CD137L expression signatures may serve as predictive biomarkers for patient responsiveness to anti-PD-1 therapy.

Fig. 6. HLTF binding at the CD137L promoter inhibits CD137L expression in melanoma.

Fig. 6

The AMPK agonist, AICAR, activates AMPK binding to HLTF and leads to its phosphorylation at the Ser398 position, which in turn releases HLTF from the CD137L promoter and induces CD137L expression, transforming tumor cells from mediating the immunosuppressive type to stimulating the immune activation type. Created by Biorender.

Human CD137 and CD137L expression extends beyond immune cells; some tumors exploit the CD137-CD137L pathway to promote tumor progression1619. In certain cancers, such as hepatocellular carcinoma, CD137L activates reverse signaling in tumor cells, inducing IL-8 production upon binding to CD13720. In acute myeloid leukemia, CD137L signaling stimulates the release of the immunosuppressive cytokine IL-1021. Additionally, in cutaneous T-cell lymphoma, leukemia, Hodgkin lymphoma, and colon cancer, CD137L expression promotes tumor cell proliferation through reverse signaling initiated by the CD137-CD137L interaction17,19,21,22. These findings suggest that CD137L may have a dual role in tumor progression: it can promote tumor development in high-CD137L-expressing tumors while having a different functional impact in tumors with low CD137L expression. In our melanoma model, CD137L expression was lower in melanoma cells compared to nevus cells, and overexpression of CD137L did not impact melanoma growth in vitro or in immunodeficient mice. Interestingly, however, overexpression of CD137L in melanoma cells significantly inhibited tumor growth and activated T cells in immunocompetent mice. Additionally, elevated CD137L levels enhanced T-cell-mediated tumor cell killing in vitro. These results suggest that the low expression of CD137L in melanoma cells contributes to immune escape. In contrast to other tumor types, the reverse signaling pathway mediated by CD137L does not appear to play a significant role in melanoma. Thus, boosting CD137L expression in melanoma cells represents a promising therapeutic strategy. However, this approach may not be universally beneficial across all cancers, and the dual nature of CD137L signaling, particularly its immune-related effects, should be carefully considered in therapeutic strategies.

HLTF, a member of the SWItch/Sucrose Non-Fermenting (SWI/SNF) family, plays a critical role in chromatin remodeling23. It has been implicated in gene transcription, DNA repair, and the maintenance of genome stability, all of which support its tumor suppressor function23. Identified as transcription factors due to their ability to bind specific DNA sequences, HLTF target genes in humans typically harbor a conserved cis-element: (A/G)G(T/C)(G/T)G and (C/A)C(T/A)TN(T/G)24,25. This conserved motif is also present in the CD137L promoter. Across species, HLTF exhibits similar roles in DNA repair and chromatin remodeling, with its deletion severely impairing post-replication and double-stranded DNA repair mechanisms. Such disruptions in genomic stability trigger apoptosis2630, further validating HLTF as a tumor suppressor gene. Hypermethylation of HLTF is frequently observed in cancers such as colorectal cancer, gastric cancer, and non-small cell lung cancer. However, its role varies across tumor types. In hypopharyngeal squamous cell carcinoma and hepatocellular carcinoma, elevated HLTF expression correlates with poorer prognosis. Despite these insights, its function in tumors within the context of immune system involvement, particularly in melanoma, remains unexplored. In this study, HLTF was found to bind the CD137L promoter, suppressing its expression. Knockdown or knockout of HLTF resulted in increased CD137L expression and enhanced T-cell activation. These findings suggest that elevated HLTF expression may contribute to immune evasion in melanoma, indicating that HLTF does not function as a tumor suppressor in this context.

Previous studies have shown that HLTF can be regulated by ubiquitination31, but its phosphorylation regulation remains unexplored. Our data identified multiple phosphorylation sites in HLTF, with Ser398 being specifically regulated by AMPK. Phosphorylation of HLTF by AMPK releases the inhibition of CD137L expression, while AMPK agonists also significantly upregulate CD137L and synergize with CTLA-4 or PD-1 blocking antibodies. AMPK, a key regulator of energy metabolism and immunity32,33, has been implicated in tumor immunity. For instance, metformin, a non-specific AMPK agonist, has been recognized as an immune stimulator that enhances the efficacy of immune checkpoint blockade through multiple mechanisms34. AMPK activation by metformin induces phosphorylation and abnormal glycosylation of PD-L1, promoting its endoplasmic reticulum-associated degradation (ERAD) and reducing membrane localization35,36, thereby boosting cytotoxic T lymphocyte activity. Metformin can also promote CD8 T cell proliferation and cytokine production by altering T cell metabolism37,38. Preclinical studies demonstrate that metformin synergizes with anti-CTLA-4 and anti-PD1 antibodies, improving tumor control and survival in murine models36,3941. However, metformin has many other effects that directly affect the immunomodulatory properties in related diseases through AMPK-dependent and AMPK-independent mechanisms41,42. Therefore, whether its combination with ICB is effective in clinical practice requires further investigation. Our findings indicate that CD137L knockdown in melanoma cells, in the absence of IFNG-induced PD-L1 expression, significantly attenuates AICAR-induced T-cell cytotoxicity against tumor cells, CD137L knockout also attenuates the effect of AICAR on increasing T-cell infiltration and activation in vivo, suggesting that AICAR activates T-cell anti-tumor immunity by upregulating CD137L. AICAR, a cAMP analog, serves as a more specific AMPK agonist compared to metformin in treating cardiovascular diseases43. AICAR significantly enhances the efficacy of CTLA-4 or PD-1 antibodies, indicating its potential as a potent immunomodulator to boost anti-tumor immunity. However, activating AMPK to upregulate CD137L may not be universally applicable across all tumor types. AMPK activation or loss of function can have diverse effects on tumor progression. For instance, in melanoma, mutated B-RAF (V600E) inhibits LKB1, leading to AMPK inhibition and promoting transformation44. In breast cancer, AMPK activation phosphorylates and inactivates ACC1/2, maintaining NADPH homeostasis and promoting cell survival and progression45. AMPK phosphorylation of PDHA is essential for PDHc activation and the TCA cycle, promoting breast cancer metastasis46. Therefore, the use of AMPK activation for anti-tumor therapy must consider its broader effects on both tumor progression and the immune microenvironment.

Despite the dramatic improvement in patient survival with the clinical application of PD-1 antibodies, the overall response rate remains suboptimal, highlighting the need for reliable biomarkers to predict treatment efficacy. AICAR-induced upregulation of CD137L significantly enhances the anti-tumor effect of PD-1 antibodies, suggesting a correlation between CD137L expression and PD-1 treatment response. Tumor analysis further revealed that patients with elevated CD137L expression exhibited better prognoses after PD-1 mAb therapy. While PD-1 mAb prevents T-cell exhaustion, CD137L promotes T-cell activation and survival, potentially contributing to improved patient outcomes. However, clinical trials evaluating CD137-specific monoclonal antibodies, and first-generation agonists have been halted due to adverse effects like intolerable hepatotoxicity (urelumab) and low efficacy (utomilumab)10,11. Urelumab was discontinued due to hepatotoxicity, primarily caused by the induction of S100A4+ macrophage infiltration in the liver. Soluble S100A4 activates the Akt pathway, prolonging CD8+ T-cell survival and leading to liver damage47. Effective signaling of TNFRSF receptors typically requires ligand binding and subsequent receptor hyperaggregation. Since utomilumab inhibits the 4-1BB/4-1BBL interaction, it fails to induce 4-1BB hyperaggregation, resulting in functional inefficacy and poor monotherapy outcomes48. Nevertheless, utomilumab has shown promise when combined with other antibodies, with improved tolerability and efficacy49. The clinical development of 4-1BB agonists for cancer immunotherapy has evolved significantly. Second-generation agents, over 40 of which entered Phase 1/2 trials since 2017, employ innovative strategies to overcome these limitations. These include bispecific/trispecific formats targeting tumor antigens (e.g., HER2, PD-L1) or stromal markers (e.g., FAP) to enable localized 4-1BB activation5052, Fc-silencing to reduce systemic toxicity, and epitope optimization (e.g., non-4-1BBL-competing CRD4 binders)53,54. Some utilize conditional activation (e.g., ATP-dependent binding) or uneven binding-site ratios to enhance clustering5557. The combination of PD-1 mAb and CD137 mAb could enhance therapeutic efficacy and response rates, but it may also introduce significant side effects. A promising clinical approach could involve using low-toxicity small molecules or drugs, such as AICAR or metformin, to activate AMPK or selectively upregulate CD137L expression in tumor cells. This strategy, when combined with immune checkpoint inhibitors, may offer a viable therapeutic option for tumors by reversing CD137L signaling and counteracting AMPK inactivation.

Methods

Ethical statement

All human and animal studies were conducted in compliance with the relevant ethical guidelines and approved by the appropriate ethics committees. The study protocol (protocol number: 202103617) was approved by the Institutional Review Board of Xiangya Hospital, and all tissue samples were collected in accordance with the informed consent policy. Written informed consent was obtained from all participants, and the study was conducted in compliance with the principles outlined in the Declaration of Helsinki.

Cell culture and treatment

All cell lines obtained from ATCC (American Type Culture Collection, Manassas, VA, USA) were confirmed by STR DNA fingerprinting and mycoplasma were negative. The human melanoma cell lines A375 and SK-MEL-28 were cultured in DMEM medium supplemented with 10% FBS, 100U of penicillin and 100 μg/mL streptomycin. Mouse melanoma cell line B16F10 and human immortalized keratinocyte cell line HaCaT were cultured in RPMI1640 medium. AICAR was added to the complete medium at the indicated concentrations and time.

Regents and antibody

Anti-p-172 Thr AMPK (2535), anti-AMPK (2532) from Cell Signaling Technology. anti-HLTF (14286-1-AP) and GAPDH (60004-1-Ig) from Proteintech. Anti-Granzyme B antibody (ab4059), anti-CD8 (ab217344), anti-CD4 (ab183685), and anti-human CD137L (ab254385) from Abcam. Anti-mouse CD137L (14-9056-82) from Invitrogen. AICAR was purchased from Selleck (S1802), in vivo mAb anti-mouse CTLA-4 (BE0164), anti-PD-1(BE0146) and isotype antibody (BE0086 and BE0089) from Bioxcell.

RNA isolation and Q-PCR assay

Total RNA was isolated from cultured cells by using a standard protocol of Trizol (Invitrogen). A total of 1 µg RNA was reverse-transcribed using the SuperScript III First-Strand cDNA synthesis system (Life Technologies) according to the manufacturer’s instructions. Standard Quantitative PCR was performed using SYBRGreen and CD137L primer (F:5’CCTGAGCTACAAAGAGGACAC3’, R: 5’CAAGTGAAACGGAGCCTGA3’) or GAPDH primer. All mRNA expression levels were normalized to GAPDH and calculated using the 2−△△CT method.

Dual-luciferase reporter assay

A375 or SK-MEL-28 cells were seeded in 24-well plates and transfected with 0.5 μg/well luciferase reporter plasmids, 10 ng of pRL-CMV (Renilla luciferase) co-transfected with or without HLTF WT or mutant, after 48 h transfection, the luciferase activity was detected by using Dual-Luciferase Reporter Assay System Kit (E1910, Promega, Madison, WI, USA) according to the manufacturer’s instruction.

DNA pull-down assay

The CD137L promoter sequence was obtained from the UCSC database, 2000 bp before the translation start site (chr19:6, 529, 037-6, 531, 037), biotin-labeled double-stranded DNA probe was synthesized by PCR with biotin-labeled primers (forward primer) (F:5’CCTCCAGCAGGCCAGAGCAG3’, R:5’TGCGGGAAGACAC AGCGCGC3’). Nuclear proteins were extracted from both melanoma cell lines. The biotin-labeled CD137L promoter probe (2 μL) was added to the nuclear lysate 500 μg, 500 μL) with 20 μL streptavidin-agarose beads (S1638, Sigma, St. Louis, MO) and a control was added with the same sequence promoter without biotin labeled. After incubation overnight at 4 °C with rotation, the beads were washed three times with lysis buffer and were eluted by boiling at 100 °C for 10 min. The pull-down proteins were separated by polyacrylamide gel electrophoresis and detected by silver staining.

ChIP assay

The ChIP assay was conducted using Simple ChIP@ Enzymatic Chromatin IP kit (9003, Cell Signaling Technology) following the manufacturer’s instructions. Briefly, about 1 × 107 cells were harvested, then cross-linked by 1% formaldehyde and digested chromatin with micrococcal nuclease. Next, the break nuclear membrane is used by several ultrasonic pulses. Chromatin was immunoprecipitated by either control IgG or HLTF (2 μg), or Flag (14793, Cell Signaling Technology, 2 μg) or Myc (2267, Cell Signaling Technology, 4 μg) primary antibody. After washing and reverse cross-linking, the eluted DNAs were quantified by qPCR. The primer sequences were listed below: CD137L primer #1 (F:5’GGGAATCAGAGACAGAGAGAAAC3’, R:5’CTCCCTCTCTTTATGCATCTCTG3’); primer #2 (F:5’GCGACAGAG ATAACAGAAGCA3’, R:5’CTCTGACTCTCTCTCCCTATCT3’); primer #3 (F: 5’CAGAGGCACGCATAGACATAA3’, R:5’CCCGTTAACGTCTTTCTCTGT3’).

Western blotting

Cells were lysed with RIPA buffer (Beyotime, China) supplementary with protease and phosphatase inhibitor (Roche, Isere, France) after PBS washing. The protein concentration was determined using a Pierce BCA protein assay kit (Thermo Fisher Scientific, MA, USA). Equal amounts of proteins were loaded onto polyacrylamide gels. Whole-cell extracts were subjected to 10% sodium dodecylsulfate-polyacrylamide gel electrophoresis and transferred to a nitrocellulose(NC) membrane,followed by blocking with 5% nonfat milk in PBS and then probed with the indicated primary antibodies overnight at 4 ℃.After washing with PBS-Tween 20, the membrane was incubated with horseradish peroxidase-conjugated goat anti-mouse IgG(Jackson ImmunoResearch,cat. no.111-005-003)or goat anti-mouse IgG(Jackson ImmunoResearch, cat.no.115-005-003). Then, an enhanced chemiluminescence assay was carried out to display specific protein bands.

Mass spectrometry analysis

Protein samples were extracted from silver-stained electrophoretic bands of DNA-pull-down assays. Two biological replicates (n = 2) were analyzed, with bead control samples included. Excised gel bands were destained in 50% acetonitrile/25 mM ammonium bicarbonate, reduced with 10 mM DTT (56 °C, 30 min), alkylated with 55 mM iodoacetamide (room temperature, 20 min), and digested with sequencing-grade trypsin (Promega, 1:20 w/w, 37 °C, 16 h). Peptides were extracted with 60% acetonitrile/1% trifluoroacetic acid, lyophilized, and resuspended in 0.1% formic acid.

The lyophilized peptide fractions were resuspended in dd H2O containing 0.1% formic acid, and 2 μL aliquots of which were loaded into a nanofiber C18 (Acclaim PepMap 100, 75  μm × 2 cm) trap column. The online Chromatography separation was performed on the Easy nLC 1200 system (Thermo Fisher). The trapping and desalting procedure was carried out with a volume of 20 μL 100% solvent A (0.1% formic acid). Then, an elution gradient of 5-38% solvent B (80% acetonitrile, 0.1% formic acid) in 60 min was used on an analytical column (Acclaim PepMap RSLC, 75 μm × 25 cm C18-2 μm 100 Å). The LC/MS data were analyzed for protein identification and quantification using PEAKS Studio 8.5.

Immunofluorescence

Cells were fixed with 4% paraformaldehyde for 10 min, after three times PBS wash, the cell was permeabilized by 0.1% Triton X-100 for 10 min. After washing the slide blocked with bovine serum albumin for 1 h. The indicated primary antibodies were incubated overnight at 4 °C, followed by incubation with FITC or Cy3-conjugated secondary antibody for 1 h at RT. The nuclei were stained with DAPI (Sigma). Viewer images were visualized using a confocal microscope (Zeiss LSM 510, Germany).

Fluorescent multiplex immunohistochemistry

For mouse tumor tissues, 4 mm paraffin sections of patient samples were baked for 120 min at 60 °C and then deparaffinized. Antigen was retrieved at EDTA antigen retrieval buffer (pH 9.0) and maintained at a sub-boiling temperature for 15 min in a microwave oven. After spontaneous fluorescence quenching, the samples were blocked in 3% BSA, PBS with 0.25% Triton X-100 for 1 h at room temperature. Primary antibodies targeting (followed CD3: ab16669 1:800, CD8a: ab217344 1:800, Granzyme B: ab4059 1:400, or CD137L: ab64912) was incubated 1 h at RT in the blocking solution and the following incubated with MACH2 Rb HRP-Polymer (RHRP520H) or MACH2 M HRP-Polymer (MHRP520H) for 10 min at RT. After washing in TBST, was followed by incubation with fluorophore antibody (CD3 Opal690 1:200, CD8 Opal620 1:200, and GZMB Opal520 1:200), respectively. After extensive washing in PBS-0.25% Triton X-100, antigen was retrieved at EDTA antigen retrieval buffer (pH 9.0) and maintained at a sub-boiling temperature for 15 min in a microwave oven. Then incubate the second primary antibody, repeat until all antibodies have been incubated. Next, the slides were mounted with Prolong Diamond Antifade Mountant with DAPI (p36962, Thermo Fisher). Images were detected and captured by PhenoImager HT (Akoya Biosciences).

Immunoprecipitation

For immunoprecipitation (IP), cells were harvested and lysed in cold IP lysis buffer (P0013, Beyotime, China) supplemented with protease and phosphatase inhibitor (Roche, France), the lysis was incubated with primary antibody at 4 °C overnight then add protein A/G agarose beads (Invitrogen) for 2–4 h at 4 °C. After three washes (PBS with 0.1% Triton X-100), bound proteins were eluted by boiling with a 2×SDS loading buffer.

For Co-IP, the cells were first transfected with plasmids with tagged (Flag or GFP) protein genes. After indicated treatment, the cells were harvested and lysed. The supernatants were incubated with anti-tag-agarose beads (anti-Flag, A4596, Sigma, St. Louis, MO, USA; or anit-GFP Biolink, 20 µL,) overnight at 4 °C, then the precipitates were washed three times (PBS with 0.1% Triton X-100) and analyzed by Western blotting.

Generate knockout/knockdown or overexpression stable cells

Using pLentiCRISPRv2 to generate HLTF Knockout. The targeting sequences are as follows. HLTF KO mouse sgRNA: (#1) GACTGCGAATACTTCCAAAC, (#2) TATTCGCAGTCTGTCCAGTA.

shRNA purchased from Sigma-Aldrich, CD137L human shRNA: (#1) AGCTACAAAGAGGACACGA, (#2) TGGACAGAGTCCGAATCCT. HLTF human shRNA: (#1) CAGTTTGGACAACATATAA, (#2) CCGCTTTCTGTGTTAAGCA.

HLTF mouse shRNA : (#1) CCTATATAATGGACAACAA, (#2) TCCAAGACTTTCATACTCA.

For overexpression, CD137L (human CCDS12169.1, mouse CCDS28926.1) forms an Ensembl database, constructed onto the pCDH vector.

To package lentivirus, the overexpression or LentiCRISPR KO constructs were transfected into HEK 293T cells with two packaging plasmids (psPAX2 and the pMD2.G plasmid). The medium was changed at 16 h after transfection. The supernatant was collected at 24 and 48 h after transfection. A375, SK-MEL-28, or B16F10 cells (60% confluency) were incubated in a lentivirus-containing medium with polybrene (10 μg/mL; Selleck Chemicals). Cells were selected by using puromycin (1 μg/mL, Selleck Chemicals) after 48 h of infection for 7 days to test the efficiency.

T cell-mediated tumor cell killing assay

Human peripheral blood mononuclear cells (PBMC) were cultured in ImmunoCult™-XF T cell expansion medium (10981, STEMCELL Technologies) with IL-2 (10 ng/mL, PeproTech, Rocky Hill, NJ, USA) for 1 week before treatment the ImmunoCult™ Human CD3/CD28/CD2 T cell activator (10970, STEMCELL Technologies) add-in culture medium for 48 h. Cancer cells were allowed to adhere to the plates and treated with the indicated concentration of AICAR overnight and then incubated with activated T cells for 48 h. The ratios between cancer cells and activated cells is 1:2.5 or 1:5. T cells and cell debris were removed and washed with PBS. The living cells were then quantified by a spectrometer at OD (570 nm) followed by crystal violet staining.

Tumor immune cell profile analysis by FACS

The tumor of mice was excised and divided into two parts for histopathological analysis and flow cytometry analysis. Samples were then filtered through a 70 μm cell strainer to obtain single-cell suspensions. Cells were first blocked with TruStain FcX™ (anti-mouse CD16/32, BioLegend, 101320) and stained with Zombie Aqua™ Fixable Viability Kit (BioLegend, 423102) to exclude dead cells. For surface staining, cells were incubated with the following antibodies for 20 min at 4 °C: APC-Cy7 anti-mouse CD45 (BD Biosciences, 557659), APC anti-mouse CD3 (BioLegend, 100236), BB700 anti-mouse CD4 (BD Biosciences, 566407), PE-Cy7 anti-mouse CD8a (BD Biosciences, 552877), PE anti-mouse CD137L (BioLegend, 107105), BV421 anti-mouse CD279/PD-1 (BD Biosciences, 562584), BV785 anti-mouse CD366/TIM-3 (BioLegend, 119725), BV421 anti-mouse/human CD19 (BioLegend, 115538), BV605 anti-mouse NK1.1 (BioLegend, 108740), APC anti-mouse CD25 (BioLegend, 102012), FITC anti-mouse CD11c (BioLegend, 117306), PerCP-Cy5.5 anti-mouse I-A/I-E (BioLegend, 107626), BV605 anti-mouse/human CD11b (BioLegend, 101235), APC anti-mouse F4/80 (BioLegend, 123116), and PE-Cy7 anti-mouse CD206/MMR (BioLegend, 141720). For intracellular staining, cells were fixed and permeabilized using True-Nuclear™ Transcription Factor Buffer Set (BioLegend, 424401), followed by staining with PE anti-mouse FOXP3 (eBioscience, 12-5773-82), PE/Dazzle594 anti-human/mouse Granzyme B (BioLegend, 372216), BV605 anti-mouse/human Ki67 (BioLegend, 151215), AF488-TCF1/TCF7 (CST, 6444), and TOX antibody (eBioscience, 12-6502-82). Flow cytometry analysis was performed using FACSymphony™ A3, and data were analyzed using FlowJo software (version 10.8).

Clinical data and sample collection

Paraffin sections of tumor tissue from 29 melanoma patients treated with anti-PD-1 mAb at Xiangya Hospital between March 2018 to January 2022. All patients were followed for more than 6 months. The study protocol was approved by the Institutional Review Board of Xiangya Hospital. All tissue samples were collected in compliance with the informed consent policy. Patients were stratified into response groups based on RECIST (response evaluation criteria in solid tumors) 1.1 criteria, patients with a complete response (CR), partial response (PR), or stable disease (SD) with progression-free survival (PFS) longer than 6 months were classified as responders, while patients with SD with PFS shorter than or equal 6 months and PD were categorized as non-responders.

Mouse tumor generation and implantation

Five to six weeks female C57BL/6 mice were purchased from Hunan STA Laboratory Animal Co., LTD and quarantined for one week before use. Animal care and experiments involved in this study were performed following the Accreditation of Laboratory Animal Care International guidelines and approved by the Animal Care and Use Committee of the Xiangya Hospital of Central South University (Changsha, Hunan, China). About 5 × 105 B16F10 cells were suspended in 100 µL PBS, and inoculation of tumor cells was performed on the dorsal or lateral side of the mouse. Nearly 1 week later, mice were pooled and randomly divided into several groups. The tumor sizes were measured twice a week. Tumor volume (TV) was calculated as TV (mm3) = (length × width2)/2. Animals were sacrificed, and the tumor burden was greater than 2500 mm3 according to the Animal Care Guidelines. These mice were humanely euthanized after measurement. When a mouse needed to be euthanized immediately to terminate the experiment, we also made a record on that day. The combination therapy group was treated with AICAR (300 mg/kg, ip), anti-mouse CTLA-4 mAb (initial dose 200 µg/mouse, followed by 100 µg/mouse every 3 days), anti-mouse PD-1 mAb (initial dose 200 µg/mouse, followed by 100 µg/mouse every 3 days) combination therapy, or a single drug only. IgG isotype was given to the control group every three days for a total of four injections.

RNA-seq analysis

Tumor cell line SK-MEL-28 with or without AICAR treatment were collected and performed with polyA+ RNA sequencing. Construction of RNA libraries was generated by QuantSeq Rev 3’ mRNA-Seq Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s recommendations. Then, PCR products were purified (AMPure XP system), and library quality was assessed on an Agilent Bioanalyzer 2100 system. Finally, the library preparations were sequenced with 150 bp paired-end reads on the Novaseq 6000 platform. After FastQC, reads satisfied data quality were aligned to the human reference genome (GRCh38) using hisat258 with the default parameters. Gene expression was quantified using stringtie59 with gencode_v28 annotation. Differential analysis was performed by DESeq260.

Survival analysis

Kaplan–Meier survival analysis and multivariable cox proportional hazards regression was performed by R package survival19. The optimal cutoff point between gene expression and survival of patient was determined using Maxstat method in R package survminer. The area under the receiver operating characteristic curve (AUC) was calculated to evaluate the performance of predicting immunotherapy response based on the expression levels of TNFSF9/TNFRSF9, PD-L1(CD274) and CD8. Gene set expression levels were calculated by GSVA30. Only tumor samples collected prior to immunotherapy treatment were included.

DNA methylation analysis

Tumor and matched normal samples for 41 melanoma patients from Xiangya Hospital were collected and stored at −80 °C. The genome-wide DNA methylation was measured using the Illumina Infinium Human Methylation EPIC Bead Chip following the standard protocol provided by Illumina. The methylation data were processed using the Chip Analysis Methylation Pipeline (ChAMP) package61. After loading the raw image data from the IDAT files by ChAMP, we further filtered the probes based on the following criteria: (1) probes with a detection p value of >0.01 in at least one sample; (2) probes with a bead count of <3 in at least 5% of samples per probe; and (3) multi-hit probes. The beta values were calculated and normalized by beta mixture quantile dilation (BMIQ) method62. For comparing methylation of CD137L promoter between tumor and control samples, we first calculated the average signal of probes in the promoter, including, and then performed Wilcoxon’s rank-sum test.

Single-cell RNA-seq analysis

We perform single-cell transcriptomic analysis using the R package Seurat (4.1.1)63. Data were filtered with below criteria: cells with more than 20% reads in mitochondria or with less than 200 features. Normalization and scaling were performed with default parameters. Uniform manifold approximation and projection (UMAP) was used in scRNA-seq for dimension reduction and visualization. We annotated the cell clusters with SingleR (1.8.1) and followed by curation. Further, clusters with small cells (<50) were removed.

Quantification and statistical analysis

All quantitative data were expressed as mean ± standard deviation (SD) derived from a minimum of three independent experimental replicates (mouse tumor growth curve using data ± standard error of the mean, SEM). Statistical comparisons were performed using appropriate methods as specified in respective figure legends: Wilcoxon rank-sum test, unpaired two-tailed Student’s t-test, or one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons. Survival outcomes were assessed through Kaplan–Meier curve analysis with log-rank testing for group differences, complemented by univariate Cox regression modeling to determine hazard ratios (HR). All reported p values are explicitly annotated in the corresponding figures. Experimental designs employed three to six biological replicates (samples/animals) per group, with detailed replication schemes provided in figure legends. No datasets were excluded during analysis. To ensure objectivity, investigators were blinded during both data acquisition and analytical phases. All statistical computations and graphical representations were generated using GraphPad Prism 10.0 (GraphPad Software, Inc.) and the R programming language (v3.6.0; https://www.r-project.org).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Supplementary information

Reporting Summary (241.2KB, pdf)
41467_2025_63338_MOESM4_ESM.pdf (65.2KB, pdf)

Description of Additional Supplementary Files

Supplementary Data 1 (24.5KB, xlsx)
Supplementary Data 2 (2.9MB, xlsx)

Source data

Source Data (2.8MB, xlsx)

Acknowledgements

We thank Jieying Zhang and Jun Mi for providing the shRNAs. Chi-Chung Hui for discussions. This study was supported by grants from the National Key Research and Development Program of China (2018YFA0107800 to J.L.), the National Natural Science Foundation of China (Nos.82100137 to L.L., 82102891 to X.K.), the Natural Science Foundation of Hunan Province for Outstanding Young Scholars (no. 2024JJ4075 to L.L. no. 2022JJ20097 to X.K.), the Natural Science Foundation of Hunan Province (No. 2024JJ6684 to L.Z.), the Scientific Research Program of FuRong Laboratory (No. 2024PT5106 to X.K.), the Central South University Innovation-Driven Research Program (No. 2023CXQD025 to X.K.), the Youth Science Foundation of Xiangya Hospital (No. 2023Q20 to L.Z.), the Natural Science Foundation of Changsha (No.kq2403025 to L.Z.) and the fellowship of China Postdoctoral Science Foundation (No. 2023M743967 to L.Z.), the Central South University Scientific Research Innovation Projects (2024ZZTS0526 to X.L.).

Author contributions

L.L., Y.C., X.K., J.S., J.L., X.C., and H.L. designed the study and drafted the manuscript. L.L., X.L., L.Z., W.Z., and Y.Z. carried out the experiments. G.Z. performed the statistical and bioinformatics analysis. L.Z., X.K., and J.S. collected the patients’ specimens and information. L.L., J.L., X.C. M.-C.H. revised the manuscript. All authors read and approved the final manuscript.

Peer review

Peer review information

Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work. A peer review file is available.

Data availability

Transcriptomics data of 33 cancer types were downloaded from The Cancer Genome Atlas (TCGA) data portal (https://portal.gdc.cancer.gov/). In-house data of melanoma were available from our previous study (He_SignalTransductTargetTher_2022 and Farshidfar_NatCommun_2022 cohort)64,65. Transcriptomics data of immunotherapy cohorts were collected from multiple public databases (Supplementary Table 1). Processed single-cell transcriptome data for melanoma were retrieved from GEO under accession number GSE189889(43). The infiltrations of immune cells for TCGA were calculated by ImmuCellAI66. Source data are provided with this paper.

Code availability

All scripts used to analyze the data in the MATERIALS AND METHODS section are available via Code Ocean at https://codeocean.com/capsule/2891918/tree/v3.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Long Liang, Lin Zhu, Xin Li.

Change history

6/11/2026

In the version of this article initially published, in the Fig. 4p Source Data, a transcription error led to values for days 12–14 in the control and CD137L‑knockout groups being duplicated. The Source Data are now replaced in the HTML version of the article.

Contributor Information

Guanxiong Zhang, Email: guanxiong_zhang@csu.edu.cn.

Yong Chen, Email: chenyong@fudan.edu.cn.

Xinwei Kuang, Email: xinweikuang@csu.edu.cn.

Juan Su, Email: sujuanderm@csu.edu.cn.

Jing Liu, Email: liujing2018@csu.edu.cn.

Xiang Chen, Email: chenxiangck@126.com.

Hong Liu, Email: hongliu1014@csu.edu.cn.

Supplementary information

The online version contains supplementary material available at 10.1038/s41467-025-63338-w.

References

  • 1.Carlino, M. S., Larkin, J. & Long, G. V. Immune checkpoint inhibitors in melanoma. Lancet398, 1002–1014 (2021). [DOI] [PubMed] [Google Scholar]
  • 2.Mellman, I., Coukos, G. & Dranoff, G. Cancer immunotherapy comes of age. Nature480, 480–489 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Seidel, J. A., Otsuka, A. & Kabashima, K. Anti-PD-1 and anti-CTLA-4 therapies in cancer: mechanisms of action, efficacy, and limitations. Front. Oncol.8, 86 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Etxeberria, I., Glez-Vaz, J., Teijeira, Á & Melero, I. New emerging targets in cancer immunotherapy: CD137/4-1BB costimulatory axis. ESMO Open4, e000733 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Melero, I., Hervas-Stubbs, S., Glennie, M., Pardoll, D. M. & Chen, L. Immunostimulatory monoclonal antibodies for cancer therapy. Nat. Rev. Cancer7, 95–106 (2007). [DOI] [PubMed] [Google Scholar]
  • 6.Choi, B. K. & Lee, H. W. The murine CD137/CD137 ligand signalosome: a signal platform generating signal complexity. Front. Immunol.11, 553715 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zapata, J. M. et al. CD137 (4-1BB) signalosome: complexity is a matter of TRAFs. Front. Immunol.9, 2618 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hashimoto, K. CD137 as an attractive T cell co-stimulatory target in the TNFRSF for immuno-oncology drug development. Cancers13, 2288 (2021).
  • 9.Chu, D. T. et al. An update on anti-CD137 antibodies in immunotherapies for cncer. Int. J. Mol. Sci.20, 1822 (2019).
  • 10.Segal, N. H. et al. Results from an integrated safety analysis of urelumab, an agonist anti-CD137 monoclonal antibody. Clin. Cancer Res.23, 1929–1936 (2017). [DOI] [PubMed] [Google Scholar]
  • 11.Segal, N. H. et al. Phase I study of single-agent utomilumab (PF-05082566), a 4-1BB/CD137 agonist, in patients with advanced cancer. Clin. Cancer Res.24, 1816–1823 (2018). [DOI] [PubMed] [Google Scholar]
  • 12.Kim, H. J. et al. Reverse signaling through the costimulatory ligand CD137L in epithelial cells is essential for natural killer cell-mediated acute tissue inflammation. Proc. Natl Acad. Sci. USA109, E13–E22 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zeng, Q., Soe, Y. M., Lim, Y., Sobota, R. M. & Schwarz, H. CD137 ligand interacts with CD32a to trigger reverse CD137 ligand signaling. Cell Mol. Immunol.17, 1188–1189 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kang, S. W. et al. Anti-CD137 suppresses tumor growth by blocking reverse signaling by CD137 ligand. Cancer Res.77, 5989–6000 (2017). [DOI] [PubMed] [Google Scholar]
  • 15.Qian, Y. et al. CD137 ligand-mediated reverse signaling inhibits proliferation and induces apoptosis in non-small cell lung cancer. Med. Oncol.32, 44 (2015). [DOI] [PubMed] [Google Scholar]
  • 16.Cheng, K. et al. CD137 ligand signalling induces differentiation of primary acute myeloid leukaemia cells. Br. J. Haematol.165, 134–144 (2014). [DOI] [PubMed] [Google Scholar]
  • 17.Kamijo, H. et al. Aberrant CD137 ligand expression induced by GATA6 overexpression promotes tumor progression in cutaneous T-cell lymphoma. Blood132, 1922–1935 (2018). [DOI] [PubMed] [Google Scholar]
  • 18.Glorieux, C. & Huang, P. Regulation of CD137 expression through K-Ras signaling in pancreatic cancer cells. Cancer Commun.39, 41 (2019). [Google Scholar]
  • 19.Grimmig, T. et al. Expression of tumor-mediated CD137 ligand in human colon cancer indicates dual signaling effects. Oncoimmunology8, e1651622 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wang, Q. et al. Analysis of CD137 and CD137L expression in human primary tumor tissues. Croatian Med. J.49, 192–200 (2008). [Google Scholar]
  • 21.Baessler, T. et al. CD137 ligand mediates opposite effects in human and mouse NK cells and impairs NK-cell reactivity against human acute myeloid leukemia cells. Blood115, 3058–3069 (2010). [DOI] [PubMed] [Google Scholar]
  • 22.Ho, W. T. et al. Expression of CD137 on Hodgkin and Reed-Sternberg cells inhibits T-cell activation by eliminating CD137 ligand expression. Cancer Res.73, 652–661 (2013). [DOI] [PubMed] [Google Scholar]
  • 23.Dhont, L., Mascaux, C. & Belayew, A. The helicase-like transcription factor (HLTF) in cancer: loss of function or oncomorphic conversion of a tumor suppressor?. Cell Mol. Life Sci.73, 129–147 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ding, H. et al. Characterization of a helicase-like transcription factor involved in the expression of the human plasminogen activator inhibitor-1 gene. DNA Cell Biol.15, 429–442 (1996). [DOI] [PubMed] [Google Scholar]
  • 25.Hayward-Lester, A. et al. Cloning, characterization, and steroid-dependent posttranscriptional processing of RUSH-1 alpha and beta, two uteroglobin promoter-binding proteins. Mol. Endocrinol.10, 1335–1349 (1996). [DOI] [PubMed] [Google Scholar]
  • 26.Castro, M. et al. Multiplexed methylation profiles of tumor suppressor genes and clinical outcome in lung cancer. J. Transl. Med.8, 86 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kim, J. J. et al. Promoter methylation of helicase-like transcription factor is associated with the early stages of gastric cancer with family history. Ann. Oncol.17, 657–662 (2006). [DOI] [PubMed] [Google Scholar]
  • 28.Capouillez, A. et al. The helicase-like transcription factor is a strong predictor of recurrence in hypopharyngeal but not in laryngeal squamous cell carcinomas. Histopathology55, 77–90 (2009). [DOI] [PubMed] [Google Scholar]
  • 29.Zhang, X. et al. Loss of heterozygosity and methylation of multiple tumor suppressor genes on chromosome 3 in hepatocellular carcinoma. J. Gastroenterol.48, 132–143 (2013). [DOI] [PubMed] [Google Scholar]
  • 30.Xu, Y. et al. HLTF promotes hepatocellular carcinoma progression by enhancing SRSF1 stability and activating ERK/MAPK pathway. Oncogenesis12, 2 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Qing, P., Han, L., Bin, L., Yan, L. & Ping, W. X. USP7 regulates the stability and function of HLTF through deubiquitination. J. Cell Biochem.112, 3856–3862 (2011). [DOI] [PubMed] [Google Scholar]
  • 32.González, A., Hall, M. N., Lin, S. C. & Hardie, D. G. AMPK and TOR: The Yin and Yang of cellular nutrient sensing and growth control. Cell Metab.31, 472–492 (2020). [DOI] [PubMed] [Google Scholar]
  • 33.Herzig, S. & Shaw, R. J. AMPK: guardian of metabolism and mitochondrial homeostasis. Nat. Rev. Mol. Cell Biol.19, 121–135 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ma, R., Yi, B., Riker, A. I. & Xi, Y. Metformin and cancer immunity. Acta Pharm. Sin.41, 1403–1409 (2020). [Google Scholar]
  • 35.Cha, J. H. et al. Metformin promotes antitumor immunity via endoplasmic-reticulum-associated degradation of PD-L1. Mol. Cell71, 606–620.e607 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Dai, X. et al. Energy status dictates PD-L1 protein abundance and anti-tumor immunity to enable checkpoint blockade. Mol. Cell81, 2317–2331 e2316 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Finisguerra, V. et al. Metformin improves cancer immunotherapy by directly rescuing tumor-infiltrating CD8 T lymphocytes from hypoxia-induced immunosuppression. J. Immunother. Cancer11, e005719 (2023).
  • 38.Huang, X. et al. Metformin reprograms tryptophan metabolism to stimulate CD8+ T-cell function in colorectal cancer. Cancer Res.83, 2358–2371 (2023). [DOI] [PubMed] [Google Scholar]
  • 39.Afzal, M. Z., Mercado, R. R. & Shirai, K. Efficacy of metformin in combination with immune checkpoint inhibitors (anti-PD-1/anti-CTLA-4) in metastatic malignant melanoma. J. Immunother. Cancer6, 64 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Vazquez-Martin, A., Oliveras-Ferraros, C., Del Barco, S., Martin-Castillo, B. & Menendez, J. A. The anti-diabetic drug metformin suppresses self-renewal and proliferation of trastuzumab-resistant tumor-initiating breast cancer stem cells. Breast Cancer Res. Treat.126, 355–364 (2011). [DOI] [PubMed] [Google Scholar]
  • 41.Akce, M. et al. Phase II trial of nivolumab and metformin in patients with treatment-refractory microsatellite stable metastatic colorectal cancer. J. Immunother. Cancer11, e007235 (2023).
  • 42.Foretz, M., Guigas, B. & Viollet, B. Metformin: update on mechanisms of action and repurposing potential. Nat. Rev. Endocrinol.19, 460–476 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Shirwany, N. A. & Zou, M. H. AMPK in cardiovascular health and disease. Acta Pharm. Sin.31, 1075–1084 (2010). [Google Scholar]
  • 44.Zheng, B. et al. Oncogenic B-RAF negatively regulates the tumor suppressor LKB1 to promote melanoma cell proliferation. Mol. Cell33, 237–247 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Jeon, S. M., Chandel, N. S. & Hay, N. AMPK regulates NADPH homeostasis to promote tumour cell survival during energy stress. Nature485, 661–665 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Cai, Z. et al. Phosphorylation of PDHA by AMPK drives TCA cycle to promote cancer metastasis. Mol. Cell80, 263–278.e267 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zhang, J. et al. S100A4 blockage alleviates agonistic anti-CD137 antibody-induced liver pathology without disruption of antitumor immunity. Oncoimmunology7, e1296996 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Li, Y. et al. Limited cross-linking of 4-1BB by 4-1BB ligand and the agonist monoclonal antibody utomilumab. Cell Rep.25, 909–920.e904 (2018). [DOI] [PubMed] [Google Scholar]
  • 49.Hong, D. S. et al. Utomilumab in patients with immune checkpoint inhibitor-refractory melanoma and non-small-cell lung cancer. Front. Immunol.13, 897991 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Claus, C. et al. Tumor-targeted 4-1BB agonists for combination with T cell bispecific antibodies as off-the-shelf therapy. Sci. Transl. Med.11, eaav5989 (2019).
  • 51.Peper-Gabriel, J. K. et al. The PD-L1/4-1BB bispecific antibody-anticalin fusion protein PRS-344/S095012 elicits strong T-cell stimulation in a tumor-localized manner. Clin. Cancer Res.28, 3387–3399 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Jeong, S. et al. Novel anti-4-1BBxPD-L1 bispecific antibody augments anti-tumor immunity through tumor-directed T-cell activation and checkpoint blockade. J. Immunother. Cancer9, e002428 (2021).
  • 53.Eskiocak, U. et al. Differentiated agonistic antibody targeting CD137 eradicates large tumors without hepatotoxicity. JCI Insight5, e133647 (2020).
  • 54.Qi, X. et al. Optimization of 4-1BB antibody for cancer immunotherapy by balancing agonistic strength with FcgammaR affinity. Nat. Commun.10, 2141 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Kamata-Sakurai, M. et al. Antibody to CD137 activated by extracellular adenosine triphosphate is tumor selective and broadly effective in vivo without systemic immune activation. Cancer Discov.11, 158–175 (2021). [DOI] [PubMed] [Google Scholar]
  • 56.Warmuth, S. et al. Engineering of a trispecific tumor-targeted immunotherapy incorporating 4-1BB co-stimulation and PD-L1 blockade. Oncoimmunology10, 2004661 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Muik, A. et al. Preclinical characterization and phase I trial results of a bispecific antibody targeting PD-L1 and 4-1BB (GEN1046) in patients with advanced refractory solid tumors. Cancer Discov.12, 1248–1265 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Kim, D., Paggi, J. M., Park, C., Bennett, C. & Salzberg, S. L. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol.37, 907–915 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Kovaka, S. et al. Transcriptome assembly from long-read RNA-seq alignments with StringTie2. Genome Biol.20, 278 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol.15, 550 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Tian, Y. et al. ChAMP: updated methylation analysis pipeline for Illumina BeadChips. Bioinformatics33, 3982–3984 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Teschendorff, A. E. et al. A beta-mixture quantile normalization method for correcting probe design bias in Illumina Infinium 450 k DNA methylation data. Bioinformatics29, 189–196 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Hao, Y. et al. Integrated analysis of multimodal single-cell data. Cell184, 3573–3587.e3529 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.He, Y. et al. Multi-omics characterization and therapeutic liability of ferroptosis in melanoma. Signal Transduct. Target Ther.7, 268 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Farshidfar, F. et al. Integrative molecular and clinical profiling of acral melanoma links focal amplification of 22q11.21 to metastasis. Nat. Commun.13, 898 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Miao, Y. R. et al. ImmuCellAI: a unique method for comprehensive T-cell subsets abundance prediction and its application in cancer immunotherapy. Adv. Sci.7, 1902880 (2020). [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Reporting Summary (241.2KB, pdf)
41467_2025_63338_MOESM4_ESM.pdf (65.2KB, pdf)

Description of Additional Supplementary Files

Supplementary Data 1 (24.5KB, xlsx)
Supplementary Data 2 (2.9MB, xlsx)
Source Data (2.8MB, xlsx)

Data Availability Statement

Transcriptomics data of 33 cancer types were downloaded from The Cancer Genome Atlas (TCGA) data portal (https://portal.gdc.cancer.gov/). In-house data of melanoma were available from our previous study (He_SignalTransductTargetTher_2022 and Farshidfar_NatCommun_2022 cohort)64,65. Transcriptomics data of immunotherapy cohorts were collected from multiple public databases (Supplementary Table 1). Processed single-cell transcriptome data for melanoma were retrieved from GEO under accession number GSE189889(43). The infiltrations of immune cells for TCGA were calculated by ImmuCellAI66. Source data are provided with this paper.

All scripts used to analyze the data in the MATERIALS AND METHODS section are available via Code Ocean at https://codeocean.com/capsule/2891918/tree/v3.


Articles from Nature Communications are provided here courtesy of Nature Publishing Group

RESOURCES