Comparison of immunogenicity and protection efficacy of self-amplifying and circular mRNA vaccines against SARS-CoV-2

Summary

Recent advances in vaccine technology have positioned messenger RNA (mRNA) vaccines as safe and reliable options for human use. Conventionally, mRNA vaccines were designed using linear or self-amplifying mRNA (SAM), the latter considered to be superior. Subsequent studies on Circular mRNA (Circ-RNA) vaccines proved their efficacy. Here, we compared the efficacy of SAM- and Circ-RNA vaccines using the SARS-CoV-2-RBD (receptor binding domain) antigen. Both SAM-RBD and Circ-RBD induced a comparable anti-RBD IgG titer and virus-neutralizing antibody titer. However, the latter induced a higher memory T cell response. The Circ-RBD vaccine is stable for 4 weeks at 4°C. A bivalent vaccine containing Circ-RBD of both delta and omicron SARS-CoV-2 variants potently neutralized these viruses. These findings demonstrate Circ-RNA-RBD as an excellent vaccine candidate against COVID-19 and also provide a platform for developing bivalent Circ-RNA vaccine candidates against SARS-CoV-2 or other viruses with rapidly emerging variants.

Graphical abstract

Highlights

• •An unmodified Circ-RNA vaccine efficiently protects mice against SARS-CoV-2
• •SARS-CoV-2 Circ-RNA vaccine is more stable at 4°C than the self-amplifying RNA vaccine
• •A bivalent Circ-RNA vaccine protects mice against SARS-CoV-2 VoCs

Immunology; Immune response; Biotechnology

Introduction

Although messenger RNA (mRNA) vaccines have been researched for more than two decades, their proof of success in real life was witnessed for the first time during the COVID-19 pandemic. Comirnaty, the first FDA (United States food and drug administration)-approved COVID-19 vaccine (developed by Pfizer-BioNTech) and Spikevax (COVID-19 vaccine developed by Moderna), both mRNA vaccines, were pivotal in controlling the COVID-19. Since then, there is considerable momentum to develop mRNA vaccines against multiple pathogens, allergic diseases, and cancer.^1,2,3,4,5,6 Advances in mRNA delivery technology, in vitro transcription technology and reduction in the cost of production have improved the overall yield, stability, efficacy, and economic viability of the mRNA vaccine, thereby positioning it as the preferred option for vaccine development.⁷ Both linear mRNA (such as Comirnaty and Spikevax) and self-amplifying mRNA (SAM) (such as Gemcovac)-based vaccines have been approved for use in humans.^1,2,8 More recently, several independent studies have demonstrated the efficacy of circular mRNA (Circ-RNA) vaccines.^9,10,11,12

Linear mRNA-encoding the vaccine antigen is generally small in size (compared to the SAM), contains a methyl-guanosine cap analog at the 5′’-end, poly A-tailed at the 3′’-end, and the antigen-encoding sequence is flanked by untranslated regions (UTR) at both sides. A major challenge of linear mRNA-based vaccines is the low stability of the input mRNA. The stability of the linear mRNAs is increased by incorporating pseudo-uridine or N6-Methyladenosine (m6A) into the sequence.^13,14 SAM vaccines are generally based on engineered genomes of alphaviruses such as the Venezuela Equine Encephalitis virus (VEEV), Semliki Forest Virus (SFV) or Sindbis virus (SINV).¹⁵ Here, the viral structural protein-encoding sequence is replaced with the sequence of the vaccine antigen so that non-structural proteins of the virus enable the replication of the viral genome without the production of infectious progeny virions. Thus, SAM vaccines should produce the required quantity of antigen for a prolonged period with less amount of the input RNA (compared to the linear mRNA), leading to a stronger and more durable immune response.¹⁶ However, use of viral replication machinery for amplifying the input RNA has certain disadvantages such as: size of the SAM RNA is considerably longer as it contains the sequence to express viral non-structural proteins; viral RNA-dependent RNA polymerase, which is required for the replication of the SAM RNA has low fidelity, increasing the possibility of introducing mutation(s) in the antigen-encoding sequence; pre-existing anti-vector immunity remains a concern; the generation of dsRNA during the replication of SAM might activate host defense machinery leading to the degradation of SAM; possibility of uncontrolled and excessive replication of SAM due to mutations in the non-structural proteins cannot be ruled out. Notably, one of the SAM vaccines (COVAC1) failed to induce 100% seroconversion, while another SAM vaccine (ARCT154) showed a very good response in phase I clinical trials.^17,18 Gemcovac (Gennova), a commercially available SAM vaccine, also shows very good protection efficacy in clinical trials.⁸

Circular RNAs (Circ-RNA) are covalently closed single-stranded RNAs without free 5′- and 3′- ends. It is produced naturally through back-splicing, which involves the connection of the 3′- end of an exon to the 5′- end of another exon, creating a close loop RNA. The circular structure provides resistance to most of the RNases except RNase A, RNase T1, and RNase T2, thus significantly increasing their half-life compared to linear mRNAs. Endogenous Circ-RNAs act as miRNA sponges to regulate various cellular processes by binding to nucleic acids and proteins, thereby modulating transcription and cellular signaling pathways.¹⁹ Circ-RNAs do not induce the cellular innate immune pathway RNA sensors.^20,21 Recent reports have demonstrated the ability of engineered Circ-RNAs to express the vaccine antigens using internal ribosomal entry site (IRES)-mediated translation, thereby eliminating the requirement of capping of the 5′-end of the mRNA.^9,22 Circ-RNA-based vaccines against the severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2) and Monkey pox has been shown to induce potent immune responses and protect the animals from challenge with the respective viruses.^9,12 Notably, in the case of SARS-CoV-2, Circ-RNA immunization produced a higher T_H1 biased humoral immune response and a higher neutralizing to binding antibody ratio than its mRNA counterpart, supporting its protection efficacy and superior potential for evading the antibody-dependent enhancement (ADE).⁹

SARS-CoV-2, the causative agent of the coronavirus-induced disease-19 (COVID-19), is responsible for the worst global pandemic of the 21^st century. So far approximately 776 million COVID-19 cases and 7 million deaths have been reported globally (https://data.who.int/dashboards/covid19). The viral genome shows a high mutation rate, leading to the emergence of multiple variants, some of which, such as the B.1.617.2 (Delta) and the Omicron B.1.1.529 (BA.1) variants, pose serious health issues.^23,24 Omicron B.1.1.529 (BA.1) became the most dominant circulating strain with 22 subvariants accounting for 87% of infections. Omicron strain dominated the previous variant of concern (VOC) in 2022 and carries the largest number of mutations of the previous VOC, with 37 mutations within its spike protein. 15 mutations at the RBD region covering almost all the critical mutation sites, such as K417N, S477N, T478K, E484A and N501Y make more transmissible and immune evasion to pre-existing immunity. Previous non-Omicron infection or vaccination has little protection against the Omicron variant.^25,26,27 The Omicron sub-variants, including the BA.4/5 and XBB, continue to emerge, with total immune escaping potential to the previous vaccination. Few studies have shown the broader protective efficacy of bivalent mRNA and nanoparticle vaccines composed of a mixture of antigens from the SARS-CoV-2-Beta and Delta or Delta and Omicron variants.^15,28,29 Despite the development of several vaccines against SARS-CoV-2, there is limited access to vaccines globally and there is scope for improving the efficacy and duration of protection offered by the vaccines.

Being the viral outer surface protein, the spike protein of SARS-CoV-2 is the main target for vaccine development. The receptor binding domain (RBD) of the spike protein, which accounts for one-fifth of the total protein, produced over 90% of the neutralizing antibody in infected patients.³⁰ There are no reports of antibody dependent enhancement (ADE) by vaccines based on the full length spike protein of the SARS-CoV-2. However, the possibility of ADE induction by the spike protein of emerging SARS-CoV-2 variants cannot be ruled out. Therefore, RBD would be the best target for developing SARS-CoV-2 vaccines.

In the present study, we compared the immunogenicity and virus neutralization potential of the Circ-RNA and SAM-RNA vaccine candidates using the SARS-CoV-2-RBD as the vaccine antigen. Although both Circ-RBD (Circ-RNA backbone) and SAM-RBD (SAM-RNA backbone) elicited comparable humoral and neutralizing antibody responses, the former induced a significantly higher T_H1-biased cellular immune response and protected mice from challenge with SARS-CoV-2. Further, the Circ-RBD vaccine was stable in a refrigerator, induced a durable neutralizing antibody response, and a bivalent vaccine formulation encoding the RBD of Delta (Circ-RBD^Del) and Omicron (Circ-RBD^Omi) variants induced a high cross-neutralizing antibody response against both variants, confirming the protective efficacy of the Circ-RNA vaccines. The significance of these findings in designing better mRNA vaccines based on circular RNA technology is discussed.

Results

Production and characterization of the SARS-CoV-2 SAM-RBD and Circ-RBD vaccine formulations

The self-splicing property of the Anabaena intron (Group 1) was utilized to generate the Circ-RNA encoding the SARS-CoV-2-RBD (Wuhan isolate) fused to the CD5 signal sequence (SS) and the sequence encoding the trimerization motif of bacteriophage T4 fibritin (foldon) at the N- and C- terminus, respectively (Nucleotide sequences presented in Table S1). The fusion protein was translated under control of a Coxsackie virus B3 (CVB3) internal ribosome entry site, as reported earlier.²² A bacteriophage T7 promoter sequence was placed upstream of the anabaena intron sequence at the 5′-end to enable in-vitro transcription-mediated synthesis of the Circ-RBD RNA. Experimental conditions were optimized to the maximize circularization of the RNA, as described.²² Circularization status of the RNA was confirmed by assessing its resistance to RNase R (Figure 1A). A Semliki Forest virus (SFV) replicon was engineered to produce the self-amplifying RNA encoding the SARS-CoV-2-RBD (SAM-RBD). RBD-encoding sequence fused to the CD5 signal sequence and T4 fibritin foldon sequence at its 5′- and 3′-ends was inserted into the SFV replicon. In-vitro transcription was carried out using the SP6 polymerase, followed by Cap1-capping and poly-A tailing of the RNA. The purification of RNA was performed by high-performance liquid chromatography (HPLC) and silica-based spin column chromatography. Based on the findings, spin column purified RNA was used in all subsequent experiments. Size and integrity of the RNAs were verified by spectrophotometry and formaldehyde-agarose gel electrophoresis. Expected size of the RNAs was observed (Figure 1B; Figure S1). An aliquot of the RNAs was treated with the RNase R to check their circularization status. SAM-RBD was completely digested by RNase R treatment, whereas Circ-RBD was resistant, confirming its circularization (Figure 1B). Next, RNA was encapsulated into the lipid-nanoparticle (LNP) by microfluidic mixing, and the diameter of the resulting RNA-LNP formulation was measured. The average diameter of the SAM-RBD-LNP and the Circ-RBD-LNP was found to be 140 and 136 nm, respectively (Figure 1C). Average polydispersity index (PDI) of the SAM-RBD-LNP and the Circ-RBD-LNP was 0.06 and 0.04, respectively (Figure 1D). LNP encapsulation and stability of the SAM-RBD and the Circ-RBD RNA in the LNP complex were verified by resolving the RNA-LNP complex with or without treatment with Triton X-100 (disrupts the LNP). No RNA was visible in the SAM-RBD-LNP and the Circ-RBD-LNP complex-containing samples (Figure 1E). Treatment of the sample with Triton X-100 results in the detection of the SAM-RBD and Circ-RBD (Figure 1E). No difference was observed in the quality of the SAM-RBD and Circ-RBD RNA before and after LNP encapsulation (Figure 1E). Percentage LNP encapsulation of the SAM-RBD and Circ-RBD RNA was quantified using Ribogreen. 98.3% and 95.9% of SAM-RBD and Circ-RBD RNA, respectively, were LNP-encapsulated (Figure 1F). Transmission electron microscopy analysis of the SAM-RBD-LNP and Circ-RBD-LNP complexes revealed spherical structure with average diameter of 136 nm and 149 nm respectively (Figure 1G). Next, SAM-RBD-LNP and Circ-RBD-LNP complexes were transfected into HEK293T cells to detect the expression of RBD. Western Blot analysis of the whole cell extract using the anti-RBD antibody confirmed the expression of the RBD protein (Figure 1H, upper panel). An aliquot of the whole cell extract was probed using the anti-GAPDH antibody to check equal loading of the sample (Figure 1H, lower panel). The secretion of RBD protein into the culture medium was checked by anti-RBD western blot of the culture medium collected from the cells used in the above experiment (Figure 1H). RBD was detected in the culture medium as 2 distinct bands, likely representing the glycosylated variants of the same protein (Figure 1I). Aliquots of the same sample (from culture medium) were resolved in the non-reduced state to check the trimerization status of the RBD protein. As expected, the anti-RBD western blot detected a band of approximately 100 kDa in the non-reduced samples, indicative of RBD-trimer (Figure 1J). Note that almost similar levels of RBD protein was expressed by SAM-RBD and Circ-RBD RNAs at 24 h post-transfection (Figures 1H–1J). Next, whole cell extract was prepared from HEK293T cells transfected with the SAM-RBD-LNP and Circ-RBD-LNP at 48-, 72- and 96-h post-transfection. Western Blot analysis using an anti-RBD antibody revealed a significant reduction in the RBD protein levels at 72 and 96 h in SAM-RBD-LNP transfected cells whereas no significant change was observed in Circ-RBD-LNP transfected cells (Figure S1E, upper panel). An aliquot of the whole cell extract was probed using the anti-GAPDH antibody to check equal loading of the samples (Figure S1E, lower panel). RT-qPCR measurement of RBD RNA level in aliquots of the same samples revealed a similar pattern (Figure S1F). Possible activation of the innate immune pathways by the SAM-RBD and Circ-RBD RNAs was checked by RT-qPCR analysis of IFN-β, RIG-I, OASL, PKR, and OAS1 genes. None of these genes was induced by either of the RNAs (Figure 1K). As a positive control, cells were transfected with poly I:C in parallel, which is known to induce the cellular antiviral response pathway (Figure 1K). Collectively, these results confirmed LNP encapsulation of SAM-RBD and Circ-RBD RNA and expression of RBD protein trimer by both the RNAs. Importantly, western blot analysis also demonstrated that approximately same amount of RBD was produced by both the SAM-RBD and the Circ-RBD. Therefore, our experimental condition was suitable to compare the immune response induced by the SAM-RBD and the Circ-RBD.

Figure 1.

Production and characterization of the self-amplifying and circular RNA vaccine candidates

(A) Agarose gel electrophoresis analysis of in vitro transcribed Circ-RBD RNA before circularization, after circularization and circularized RNA after treatment with RNase R.

(B) Agarose gel electrophoresis analysis of in vitro transcribed and purified SAM-RBD and Circ-RBD RNA with (+) and without (−) treatment with RNase R.

(C) Average particle size of SAM-RBD-RNA-LNP and Circ-RBD-RNA-LNP complex.

(D) Average polydispersity Index of SAM-RBD-RNA-LNP and Circ-RBD-RNA-LNP complex.

(E) Agarose gel electrophoresis analysis of SAM-RBD and Circ-RBD-RNA incorporation into the LNP on RNA-LNP formulation treated with Triton X-100, as indicated.

(F) Average percent SAM-RBD and Circ-RBD RNA incorporation into the LNP on RNA-LNP formulation treated with Triton X-100, as indicated.

(G) Transmission electron microscopy image of SAM-RBD-LNP and Circ-RBD LNP. Scale:100 nm.

(H) Western blot analysis of RBD protein in HEK239T cells transfected with SAM-RBD and Circ-RBD RNA (upper panel). Mock: Lysate from HEK293T cells treated with LNP. Lower panel: Anti GAPDH Western blot of aliquots of cell lysate used in the upper panel. (I) Anti-RBD Western blot of RBD protein in the cell culture medium of HEK239T cells mentioned in (G).

(J) Anti-RBD Western blot of aliquots of sample used in (H) under reducing and non-reducing conditions, as indicated.

(K) RT-qPCR analysis of the indicated genes in total RNA isolated from HEK239T cells transfected with SAM-RBD or Circ-RBD-RNA, as indicated. Mock: lipofectamine 3000 transfected cells. A set of samples from poly I:C transfected cells were simultaneously processed, as positive control. Dotted line indicates the background level.

In (C, D, and K), data are represented as mean ± SD of three independent biological replicates. In (F), data are represented as the mean of two independent biological replicates. p-values were calculated by the non-parametric Student’s t test, using the Mann-Whitney test. ns: p > 0.05, ∗: p < 0.05, ∗∗: p < 0.01, ∗∗∗: p < 0.001, ∗∗∗∗: p < 0.0001.

SAM-RBD and Circ-RBD RNA vaccines induced a significant T_H1-biased humoral and cellular immune response in mice

To select the injection route and the optimal RNA dose, Balb/c mice were immunized via intradermal (ID) or intramuscular (IM) route with freshly prepared vaccine formulation containing 25 μg Circ-RBD RNA. Two weeks later, immunization was repeated and blood was collected after four weeks (day 28). Both ID and IM routes showed similar anti-RBD IgG titer (average values: 6 × 10⁵ and 1 × 10⁶, respectively) and virus neutralization titer (average NT₅₀ = 1.7 × 10³ and 1.9 × 10³, respectively) (Figures S2A and S2B). ID immunization route was selected for all subsequent experiments. Next, mice were injected with 5, 10 and 25 μg of Circ-RBD-RNA containing vaccine formulations in a two-dose immunization schedule as described above. Measurement of anti-RBD IgG titer revealed average values to be 2.2 × 10⁴, 2.8 × 10⁵, 6 × 10⁵ and average virus neutralization titer (NT₅₀) was found to be 0.5 × 10³, 1.5 × 10³, 0.8 × 10³, in 5, 10 and 20 μg RNA containing formulations, respectively (Figures S2C and S2D). There was no significant difference in values obtained between all 3 doses, hence 10 μg RNA containing formulation was selected for all subsequent experiments.

In order to evaluate the immune response generated by the Circ-RBD and SAM-RBD, 10 μg of each RNA containing vaccine formulation was intradermally injected into Balb/c mice in two dose immunization schedules at two-week interval, followed by the collection of blood and spleen samples for analysis of different immune parameters (Figure 2A). Significant level of anti-RBD IgM was detected in the sera of mice immunized with both SAM-RBD and Circ-RBD RNA (Figure 2B). Importantly, no significant difference was observed in the level of IgM between SAM-RBD and Circ-RBD immunized mice (Figure 2B). Measurement of anti-RBD IgG titer and virus neutralization titer (NT₅₀) in the sera collected on day 28 from SAM-RBD and Circ-RBD immunized mice revealed the average values to be 2.8 × 10⁵ and 3.2 × 10⁵ (anti-RBD-IgG titer) and 1 × 10³ and 1.5 × 10³ (NT₅₀), respectively (Figures 2C and 2D). IgG-isotyping of aliquots of the same sera showed comparable values between SAM-RBD and Circ-RBD groups (Figures 2E–2G). The ratio of anti-RBD (IgG2a+IgG2b) to IgG1 was found to be 1.9 and 1.8, respectively, indicating a T_H1 response (Figure 2H). Next, splenocytes from the immunized mice were cultured in vitro and induced with an overlapping peptide pool corresponding to the RBD region, followed by the selection of CD4⁺ and CD8⁺ T cells and quantification of intracellular T_H1 (IFN-γ, TNF-α) and T_H2 (IL-4) cytokines. Both CD4⁺ and CD8⁺ T cells of mice immunized with SAM-RBD and Circ-RBD induced significant IFN-γ and TNF-α response (Figures 2I–2L). Moreover, IFN-γ and TNF-α responses in CD8+ T cells were higher in the Circ-RBD immunized mice compared to those in the SAM-RBD immunized mice (Figures 2J and 2L). There were no significant changes in IL-4 response in both SAM-RBD and Circ-RBD immunized mice, indicating that both vaccine formulations induced T_H1-biased T cell immune response (Figures 2M and 2N). Representative FACS plots and FMO control plots are shown (Figures S3 and S4; Table S2). Collectively, these results demonstrate that both SAM-RBD and Circ-RBD induced a robust and comparable humoral immune response, however, the latter induced a better T_H1-biased cell-mediated immune response.

Figure 2.

Immunogenicity assessment of SAM-RBD and Circ-RBD-RNA vaccine formulations

(A) Schematic of the immunization study. Balb/c mice were intradermally injected with 10 μg SAM-RBD or Circ-RBD-RNA-LNP on day 1 and 14. Blood was collected via retro-orbital route prior to the first immunization and subsequently on day 7 and day 28. Animals were euthanized on day 28, blood and spleen were collected.

(B) Anti-RBD IgM level at 1 week post-immunization in the sera (1:500 dilution) of mice injected with the placebo (PBS), SAM-RBD and Circ-RBD-LNP, evaluated by ELISA.

(C) Anti-RBD IgG titer at 4 weeks post-immunization in the sera of mice described in (B), evaluated by ELISA.

(D) 50% virus neutralization titer (NT₅₀) at 4 weeks post-immunization in the sera of mice described in (B), evaluated by PRNT assay.

(E) Anti-RBD IgG1 level (1:500 dilution) at 4 weeks post-immunization in the sera of mice described in (B), evaluated by ELISA.

(F) Anti-RBD IgG2a level (1:500 dilution) at 4 weeks post-immunization in the sera of mice described in (B), evaluated by ELISA.

(G) Anti-RBD IgG2b level (1:500 dilution) at 4 weeks post-immunization in the sera of mice described in (B), evaluated by ELISA.

(H) Ratio of anti-RBD T_H1 antibody (IgG2a and IgG2b) to T_H2 (IgG1) antibody in the sera of mice injected with the SAM-RBD and Circ-RBD at 4 weeks, evaluated by ELISA.

(I) Percentage of IFNγ and CD4 positive T-cells in the splenocytes, following stimulation with the SARS-CoV-2-Spike-RBD peptide pool, evaluated by FACS.

(J) Percentage of IFNγ and CD8 positive T-cells in the splenocytes, following stimulation with the SARS-CoV-2-Spike-RBD peptide pool, evaluated by FACS.

(K) Percentage of TNFα and CD4 positive T-cells in the splenocytes, following stimulation with the SARS-CoV-2-Spike-RBD peptide pool, evaluated by FACS.

(L) Percentage of TNFα and CD8 positive T-cells in the splenocytes, following stimulation with the SARS-CoV-2-Spike-RBD peptide pool, evaluated by FACS.

(M) Percentage of IL-4 and CD4 positive T-cells in the splenocytes, following stimulation with the SARS-CoV-2-Spike-RBD peptide pool, evaluated by FACS.

(N) Percentage of IL-4 and CD8 positive T-cells in the splenocytes, following stimulation with the SARS-CoV-2- Spike-RBD peptide pool, evaluated by FACS.

In all images, bars represent the average and dots represent the value obtained from each animal. Data are mean ± SD of 6 mice (B–H) and 8 mice (I–N), p-values were calculated by the non-parametric Student’s t test, using the Mann-Whitney test (B–H) and the non-parametric one-way ANOVA, using the Kruskal-wallis test (I–N). ns: p > 0.05, ∗: p < 0.05, ∗∗: p < 0.01, ∗∗∗: p < 0.001, ∗∗∗∗: p < 0.0001.

Immunization with the SAM-RBD and Circ-RBD RNA vaccines protect mice from the SARS-CoV-2 infection and prevents COVID-19 associated pathological changes

In order to evaluate the protection efficacy of the Circ-RBD vaccine, we established a mouse model of the SARS-CoV-2 infection that produces a severe disease phenotype. The intratracheal administration of the replication deficient adenovirus expressing the human angiotensin converting enzyme 2 (Ad5CMV-hACE2, denoted as hACE2 hereafter) has been shown to express the hACE2 in mouse lungs within 5 days of transduction.³¹ We hypothesized that increased hACE2 expression in the lungs will permit more pronounced SARS-CoV-2 infection in the lungs, leading to a more severe disease phenotype. To test the hypothesis, mice were transduced with the hACE2 via intratracheal administration, followed by intranasal infection with the 10⁵ PFU of SARS-CoV-2 (Wuhan isolate), as described.³² Body weight of the animals were measured every day, blood was collected prior to infection and up to 3 weeks after infection. Survival of the animals were monitored. Few animals were sacrificed each week and blood and lung tissue were collected for analysis. Results obtained in the pilot experiment confirmed that our animal model displayed a more severe pathogenic effect, including lethality in some animals. The protection efficacy of the SAM-RBD and Circ-RBD RNA vaccines was compared in the model. Mice were immunized twice at 2 weeks intervals, followed by the intratracheal transduction of the hACE2 (on day 28). 10⁵ PFU of the SARS-CoV-2 (Wuhan) was intranasally administered after 5 days, and disease parameters were followed up for the next three weeks (up to day 54). The experimental plan is summarized (Figure 3A). In the placebo group, there was a marked reduction in the body weight from the 2^nd day of infection up to the 7^th day, after which there was a gradual increase in the body weight up to the 21^st day (Figure 3B). In the case of SAM-RBD and Circ-RBD vaccine immunized groups, weight loss was observed between the 2^nd to 4^th day post-infection after which the animals gained weight, indicating that both vaccines protected the animals from progressing to severe disease pathology (Figure 3B). Placebo group animals appeared sick, displayed hunchback posture, barely moved, and importantly, three animals died during the observation period (one animal each died on day 36, 38, and 40) (Figure 3C). The remaining animals started to gain weight from day 41 onwards. Notably, SAM-RBD and Circ-RBD vaccine immunized animals were almost normal throughout the observation period.

Figure 3.

Immunization with SAM-RBD and Circ-RBD RNA vaccines protect mice from intratracheal SARS-CoV-2 challenge-induced disease symptoms

(A) Schematic of immunization and challenge study. Blood was collected before immunization on day 0 and day 14. Intratracheal transduction of hACE2-adenovirus was done on day 28, followed by intranasal infection with SAR-CoV-2 (Wuhan) on day 33. Mouse weight was measured every day from day 33–54. Mice were sacrificed (3 animals at each time point) on day 40, 47 and 54 and blood and lung tissues were collected.

(B) Weight of each mouse (n = 6) in placebo, SAM-RBD and Circ-RBD RNA vaccine immunization group was measured every day from day 33–54 and the percent weight change with respect to the weight on day 33 (considered 100%) is plotted in the graph.

(C) Survival of mice in placebo, SAM-RBD and Circ-RBD RNA vaccine immunized groups were monitored every day from day 33–54.

(D) Anti-RBD IgG titer in the sera of placebo, SAM-RBD and Circ-RBD RNA vaccine immunized, SARS-CoV-2 (Wuhan) infected mice as indicated in (A). Sera collected on day 40, 47 and 54 were evaluated by ELISA (n = 9 at day 33 and 40, n = 6 at day 47 and n = 3 at day 54).

(E) Measurement of viral RNA level in aliquots of the lung tissue of placebo, SAM-RBD and Circ-RBD RNA vaccine immunized, SARS-CoV-2 (Wuhan) infected mice as indicated in (A). Viral RNA level was determined by RT-qPCR in samples collected on day 40, 47 and 54 (n = 6).

(F) Lung morphology of the placebo, SAM-RBD and Circ-RBD RNA vaccine immunized, SARS-CoV-2 (Wuhan) infected mice, collected on day 40.

(G) Representative H&E-stained image of lung tissue section prepared from placebo, SAM-RBD or Circ-RBD RNA vaccine immunized, SARS-CoV-2 (Wuhan) infected mice, collected on day 40. Images were acquired at 40X (left panel) and 200X magnification (right panel). Black and red arrows indicate peribronchiolar and perialveolar infiltration, respectively. Black arrow-head indicates neutrophil infiltration.

(H) Lung infiltration score of placebos, SAM-RBD and Circ-RBD RNA vaccine immunized, SARS-CoV-2 (Wuhan) infected mice, evaluated by analysis of H&E-stained images of tissue sections prepared from lungs collected on day 40 (n = 6).

Dots represent the value obtained from each animal. Data are shown as the mean ± SD and significance was determined using unpaired Student’s t test, Mann-Whitney test. ∗: p < 0.05, ∗∗: p < 0.01, ∗∗∗: p < 0.001, ∗∗∗∗: p < 0.0001.

Anti-RBD IgG titer was measured in the placebo and vaccinated groups on days 33, 40, 47, and 54. There was no anti-RBD IgG in the placebo group on day 33, and an average titer of 5∗10³ was observed after one week of infection, which increased up to 10⁵ by day 54 (Figure 3D). SAM-RBD vaccine immunized group showed an average anti-RBD IgG titer of 10⁵-10⁶ in the samples collected between 33 and 54 days whereas Circ-RBD vaccine immunized group showed an average anti-RBD IgG titer of 10⁶ (Figure 3D). The estimation of viral RNA level and viral load in the lung revealed higher viral RNA level (approximately 10-fold higher) and higher viral load (10³ PFU/mg of lung) in the lung tissue of placebo group (samples collected on day 40) compared to the SAM-RBD and Circ-RBD vaccine immunized groups (Figure 3E; Figure S5A). Both viral RNA level and viral load were significantly less in the placebo group samples collected on day 47 and 54, which inversely correlated with the anti-RBD IgG titer observed at the same time point (Figure 3E; Figure S5A). Morphology and histopathology analysis of lung tissue of placebo group collected on day 40 showed multiple lesions, pneumonia and infiltration of inflammatory cells whereas SAM-RBD and Circ-RBD vaccine immunized lung samples were significantly better (Figures 3F and 3G). A similar profile was observed in the lung samples collected on day 47 and 54 (Figures S5B and S5C). The quantification of lung infiltration score in the slides further confirmed the above observation (Figure 3H; Figure S5D). Collectively, these findings confirmed the functional ability of the SAM-RBD and the Circ-RBD vaccines in protecting mice against SARS-CoV-2 infection.

Circ-RBD vaccine formulation is stable in refrigerator (4°C) and induces a durable immune response in both female and male mice

Since Circ-RBD vaccine induced a better overall immune response than the SAM-RBD, we compared its stability and the durability of the immune response induced by it to that of the SAM-RBD. To evaluate the effect of prolonged storage (up to 4 weeks) of the vaccines in the refrigerator (4°C), they were stored in aliquots in the refrigerator for 2 or 4 weeks, followed by the evaluation of their physical and functional characteristics. No significant change in particle diameter, polydispersity index and percent RNA encapsulation was observed between the samples stored for 2 and 4 weeks, compared to the freshly prepared sample (0 weeks) (Figures 4A–4C). Mice were injected with aliquots of the same samples in a two-dose immunization schedule (as described above), followed by the collection of blood on the 28^th day. There was no difference in the anti-RBD IgG titer and the virus neutralization titer (NT₅₀) between freshly prepared and two weeks-stored Circ-RBD immunized samples (IgG titer = 1.0 × 10⁶ and 8 × 10⁵, NT₅₀ = 3.6 × 10³ and 1.5 × 10³ respectively) (Figures 4D and 4E). There was approximately 0.5 log drop in the anti-RBD IgG titer and a 1.5 log drop in NT₅₀ in the Circ-RBD immunized samples stored for 4 weeks at 4°C (IgG titer = 4.8 × 10⁶, NT₅₀ = 1.1 × 10²) (Figures 4D and 4E). SAM-RBD immunized samples showed anti-RBD IgG titer and NT₅₀ similar to that of the Circ-RBD immunized samples on day 0, however, there was significant drop in both read outs in samples stored for 2 and 4 weeks (Figures 4D and 4E). These results support the superior efficacy of the Circ-RBD vaccine.

Figure 4.

Stability and durability of the immune response induced by the SAM-RBD and Circ-RBD-LNP vaccine formulation

(A) Average size of the SAM-RBD and Circ-RBD-LNP stored at 4°C for 0, 2 and 4 weeks, evaluated by dynamic light scattering.

(B) Average polydispersity index of the SAM-RBD and Circ-RBD-LNP, stored as indicated in (A).

(C) Percentage of RNA encapsulated into the LNP in the SAM-RBD and Circ-RBD-LNP formulation, stored as indicated in (A). Equal aliquots of the samples were treated with the Triton X-100.

(D) Anti-RBD IgG titer in the sera of mice immunized for 4 weeks with the SAM-RBD and Circ-RBD-LNP, stored as indicated in (A).

(E) 50% virus neutralization titer (NT₅₀) in aliquots of the sera used in (D), evaluated by PRNT assay.

(F) Anti-RBD IgG titer at 0, 1, 3 and 9 months post-immunization in the sera of mice immunized with the Circ-RBD-LNP, evaluated by ELISA.

(G) 50% virus neutralization titer (NT₅₀) in aliquots of the sera described in (F), evaluated by PRNT assay.

(H) Anti-RBD IgG titer at 9 months post-immunization with the Circ-RBD-LNP, in male and female mice, evaluated by ELISA.

(I) 50% virus neutralization titer (NT₅₀) in aliquots of the sera described in (H), evaluated by PRNT assay.

In (A and B), data are represented as mean ± SD of three independent biological replicates. In (C), data are represented as mean of two independent biological replicates. In (D–I), data are represented as mean ± SD of 6 mice. p-values were determined by the unpaired Student’s t test, using the Mann-Whitney test. ∗: p < 0.05, ∗∗: p < 0.01, ∗∗∗: p < 0.001.

Next, the durability of the immune response and influence of gender on the immune response elicited by the Circ-RBD was evaluated by immunizing male and female mice with the Circ-RBD vaccine in a two-dose immunization schedule (day 1 and day 14), followed by measurement of the anti-RBD IgG titer and NT₅₀ up to 9 months. Both the anti-RBD IgG titer and NT₅₀ were measured in the mice sera at 1, 3 and 9 months post-first immunization. There was no drop in the anti-RBD IgG titer or NT₅₀ after 9 months of immunization, with reference to the samples collected after one month of the first immunization (Figures 4F and 4G). Both male and female mice induced a similar level of the anti-RBD IgG titer and NT₅₀ (Figures 4H and 4I). Collectively, these results demonstrated that Circ-RBD vaccine was stable in standard refrigeration condition and induced a highly durable neutralizing antibody response in both male and female mice.

A bivalent SARS-CoV-2 Circ-RBD vaccine induces robust immune response and efficiently neutralizes both the delta and the omicron BA.1 variant viruses

Recent reports on bivalent mRNA vaccines and nanoparticle vaccine demonstrate their efficacy in conferring broad spectrum immunity against the SARS-CoV-2 variants of concern.^28,30,33 The feasibility of using the Circ-RNA vaccine technology for developing a bivalent vaccine was tested by evaluating the immunogenicity and virus neutralization potential of a vaccine formulation containing 1:1 mixture of the Circ-RNAs encoding the RBD of the Delta (Circ-RBD^Del) and the Omicron BA.1 (Circ-RBD^Omi) variants of the SARS-CoV-2. Sequence encoding the RBD region of the Delta and the Omicron variants of the SARS-CoV-2 were inserted into the Circ-RNA backbone vector in place of the RBD (Wuhan) sequence so that both RBD^Del and RBD^Omi are fused in-frame with the CD5 secretory signal and foldon sequence at their N- and C-terminus, respectively. The expression and secretion of the RBD^Del and RBD^Omi were verified by western blot analysis of the whole cell lysate and the culture medium of the HEK239T cells transfected with the Circ-RBD^Del-LNP and Circ-RBD^Omi-LNP formulations. Anti-RBD western blot revealed that both Circ-RBD^Del and Circ-RBD^Omi were expressed in the HEK239T cells and secreted to the culture medium (Figure 5A, upper panel, 5B, upper and middle panel). The secretion of the Circ-RBD^Omi was not as efficient as that of the Delta and the Wuhan variants as the ratio of protein in intracellular to culture medium was much higher in the RBD^Omi (Figure 5B, middle panel). GAPDH level was measured in aliquots of the same samples to monitor equal loading (Figures 5A and 5B, lower panel). Mice were injected with vaccine formulations containing 10 μg of Circ-RBD^Wuhan, Circ-RBD^Del, Circ-RBD^Omi or 1:1 mixture of 5 μg Circ-RBD^Del and 5 μg Circ-RBD^Omi in a two-dose immunization schedule at two weeks intervals, as described earlier, followed by the collection of blood on day 28 and the estimation of the anti-RBD IgG titer and the virus neutralization titer. Mice immunized with the vaccines containing the Circ-RBD^Wuhan, Circ-RBD^Del and Circ-RBD^Del+Omi produced an anti-RBD IgG titer of approximately 10⁶ against the SARS-CoV-2 Wuhan and Delta variants whereas it was 0.3 × 10⁵, 0.6 × 10⁵ and 0.6 × 10⁵, respectively in case of the Omicron variant (Figures 5C–5E). In contrast, the Circ-RBD^Omi vaccine induced an average anti-RBD IgG titer of 1.2 × 10⁵ against the SARS-CoV-2 Wuhan and Delta variants and 1.8 × 10⁵ against the Omicron variant (Figures 5C–5E). The virus neutralization titer (NT₅₀) of the sera showed a pattern broadly similar to that of the anti-RBD IgG titer. As observed earlier, NT₅₀ of sera from the Circ-RBD^Wuhan immunized group against the Wuhan variant was 3.5 × 10³ (Figure 5F). Sera from the Circ-RBD^Del and Circ-RBD^Del+Omi showed approximately similar NT₅₀ as that of the Circ-RBD^Wuhan (Figure 5F). However, NT₅₀ of sera from the Circ-RBD^Omi immunized mice against the Wuhan variant was found to be 0.2 × 10³, which is in line with the data on its anti-RBD IgG titer against the same variant (Figure 5F). NT₅₀ of sera from the Circ-RBD^Del and the Circ-RBD^Del+Omi immunized mice against the SARS-CoV-2 Delta variant was found to be 8.1 × 10³ and 8.8 × 10³, respectively, indicating that the virus neutralization efficacy of the bivalent vaccine was similar to its monovalent counterparts (Figure 5G). Sera from the Circ-RBD^Wuhan immunized mice was almost as efficient as sera from the Circ-RBD^Del immunized mice in neutralizing the SARS-CoV-2 Delta variant (NT₅₀ = 1.7 × 10³) (Figure 5G). However, sera from the Circ-RBD^Omi immunized mice were significantly less efficient in neutralizing the SARS-CoV-2 Delta variant than that of the Circ-RBD^Wuhan, Circ-RBD^Del and Circ-RBD^Del+Omi immunized mice (Figure 5G). Sera from the Circ-RBD^Omi and Circ-RBD^Del+Omi immunized mice showed an NT₅₀ of 8.1 × 10³ and 2.3 × 10³, respectively, against the SARS-CoV-2 Omicron BA.1 variant, indicating that bivalent vaccine was equally effective as its monovalent (Circ-RBD^Omi) counterpart (Figure 5H). NT₅₀ of sera from the Circ-RBD^Del and the Circ-RBD^Wuhan immunized mice against the Omicron BA.1 variant were found to be 0.3 × 10³ and 0.06 × 10³ respectively, suggesting that they were less efficient in neutralizing the Omicron BA.1 virus (Figure 5H). Collectively, these data demonstrate that the bivalent Circ-RBD vaccine produces potent neutralizing antibodies against the Delta and the Omicron BA.1 variants of the SARS-CoV-2.

Figure 5.

Assessment of immunogenicity and virus neutralization potential of the Circ-RBD^Del and Circ-RBD^Omi bivalent vaccine formulation

(A) Western blot analysis of the RBD protein in the HEK239T cells transfected with the Circ-RBD-Delta RNA (upper panel). Mock: HEK293T cells treated with LNP. Lower panel: Anti GAPDH Western blot of aliquots of the samples used in the upper panel.

(B) Western blot analysis of the RBD protein in the HEK239T cells transfected with the Circ-RBD-Omicron-BA.1 RNA (upper panel-lower exposure, middle panel-higher exposure of the same blot). Mock: HEK293T cells treated with LNP. Lower panel: anti GAPDH Western blot of aliquots of the samples used in the upper panel.

(C) Anti-RBD-wuhan IgG titer at 4 weeks post-immunization in the sera of mice injected with the placebo (PBS), Circ-RBD^Wuhan, Circ-RBD^Del, Circ-RBD^omi and bivalent Circ-RBD^Del+omi vaccine formulations, evaluated by ELISA.

(D) Anti-RBD-Delta IgG titer at 4 weeks post-immunization in the sera of mice described in (C), evaluated by ELISA.

(E) Anti-RBD-Omicron IgG titer at 4 weeks post-immunization in the sera of mice described in (C), evaluated by ELISA.

(F) 50% virus neutralization titer (NT₅₀) against the SARS-CoV-2 (Wuhan) at 4 weeks post-immunization in the sera of mice described in (C), evaluated by FRNT assay.

(G) 50% virus neutralization titer (NT₅₀) against the SARS-CoV-2 (Delta) at 4 weeks post-immunization in the sera of mice described in (C), evaluated by FRNT assay.

(H) 50% virus neutralization titer (NT₅₀) against the SARS-CoV-2 (Omicron BA.1) at 4 weeks post-immunization in the sera of mice described in (C), evaluated by FRNT assay.

In (C–E), data are shown as the mean ± SD from pooled sera of six mice, assayed in triplicate; in (F–H), data are shown as the mean ± SD of 6 mice. p-values were determined by the non-parametric one-way ANOVA, using the Kruskal-wallis test. ns: p > 0.05, ∗: p < 0.05, ∗∗: p < 0.01, ∗∗∗: p < 0.001, ∗∗∗∗: p < 0.0001.

Discussion

With the success of the COVID-19 mRNA vaccines, immunogenicity and protective efficacy of a number of vaccine candidates based on linear mRNAs, self-amplifying mRNAs and circular mRNAs have been evaluated in multiple independent studies. Given their ability to replicate inside the host, SAM-RNAs express the antigen for a longer duration with a lesser amount of the input RNA. Analogous to the SAM-RNA, Circ-RNAs also offer the advantage of expression of the antigen for a longer duration with a lesser amount of the input RNA, owing to their higher stability. On top of that, Circ-RNA vaccines do not produce any additional exogenous protein in the target cells, lack open 5′- and 3′-ends and do not produce double-strand RNA (dsRNA) in the target cell, all of which are potential unwanted features in the SAM vaccine. Therefore, Circ-RNA vaccines appear to be more promising than the linear mRNA and SAM vaccines. Comparison between linear mRNA and Circ-RNA vaccines have demonstrated the superiority of the later.⁹ However, there are no report on comparison of the protective efficacy between the Circ-RNA and the SAM vaccines. Here, we compared the efficacy of the Circ-RNA and the SAM vaccines by measuring their immunogenicity, virus neutralization potential and protection efficacy using the SARS-CoV-2 RBD as the vaccine antigen. After confirming that Circ-RBD vaccine induced a better overall response, we further evaluated its thermostability, longevity of the immune response and compatibility for the production of bivalent vaccines.

SAM-RNA was produced using the SFV replication machinery. SFV replicon was opted as there are very few reports of SFV infection in human, with very mild symptoms and no instances of mortality. SFV replicon has been used in earlier studies for heterologous protein expression and a recently it has been used to produce a vaccine candidate against the Ebola virus.^34,35 Also note that, multiple outbreaks of VEEV has been reported in North and South American countries with cases of human death. Hence chances of anti-vector immunity is higher in the case of VEEV.³⁶

The Anabaena permuted intron-exon sequence was used to produce the Circ-RNA and CVB3 IRES-mediated translation was used to produce the secretory signal and foldon fused-RBD protein in the target cells. Circ-RNA vaccine production using the above vector has been reported and well characterized.⁹ Only the RBD region was used instead of the entire Spike protein of the SARS-CoV-2 as it contains the majority of neutralizing epitopes, avoids the induction of antibody-dependent enhancement (ADE) and permits the insertion of multiple elements due to its smaller size. The trimeric structure of RBD was maintained using the foldon-motif to improve its immunogenicity and virus neutralization potential, as reported earlier.³⁷ Our initial experiments showed that immunization through both IM and ID routes induced similar immune response. Both IM and ID route have been used by different vaccine manufacturers to administer the COVID vaccine. Notably, self-amplifying mRNA based vaccine produced by Gennova (Gemcovac-OM) is administered through the ID route.⁸ Since our focus was to compare the Circular RNA vaccine with the SAM vaccine and both IM and ID routes showed similar response, we selected the ID route for immunization.

In order to compare the SAM-RBD vaccine with the Circ-RBD vaccine, it was important that both vaccine antigens were expressed at comparable levels and did not induce the host innate immune response. Western blot analysis using anti-RBD antibody and RT-qPCR analysis of the ISGs confirmed that both vaccine candidates expressed similar levels of the vaccine antigen initially and evaded the host innate immune pathway RNA sensors, respectively. However, there was a marked reduction in RBD RNA and protein levels at later time points (between 72 and 96 h) in SAM-RBD-LNP transfected cells, suggesting that SAM-RBD RNA was less stable than the Circ-RBD RNA. This might account for lesser efficacy of the SAM-RBD vaccine.

IFNγ and TNFα production in CD8⁺ memory T cells was significantly higher in Circ-RBD immunized mice than that observed in the SAM-RBD immunized mice. A similar trend was seen in the CD4⁺ memory T cells although the difference was not statistically significant. These findings suggested that the Circ-RBD vaccine induced a more potent cell-mediated immune response. SFV replicon system has been used to develop a dual antigen vaccine candidate against the Ebola virus by co-expressing the viral glycoprotein and nucleoprotein where it was observed that high intradermal dose of the Ebola virus glycoprotein induced IFNγ in CD4⁺ T cells and high intradermal dose of nucleoprotein induced very low level of IFNγ in CD8⁺ T cells.³⁵ In the case of VEEV-replicon based SARS-CoV-2-RBD and nucleocapsid (N)- expressing dual antigen vaccine immunized outbred mice, IFNγ level was moderately increased in the CD4⁺ and CD8⁺ T cells stimulated with either the S- or N-peptide pool.³⁸ Other studies on the evaluation of a SAM vaccine candidate in mice based on the SARS-CoV-2-RBD or the Spike protein expressed from an alpha virus (VEEV/VEEV+Sindbis) replicon reported a significant T cell response in splenocytes of the immunized mice, upon stimulation with the S-peptide pool.^39,40,41,42 However, SAM-Spike immunized pigtail macaques did not induce high level of IFNγ production in CD4⁺ and CD8⁺ T cells upon the stimulation of splenocyte with S-peptide pool.⁴⁰ On the other hand, the Circ-RBD vaccine of the SARS-CoV-2 induced similar level of T cell response as that of the corresponding linear mRNA vaccine and a higher neutralizing antibody response than that of the linear mRNA.⁹ Given that different assays were conducted in different laboratories to measure the T cell response, it is possible that lower IFNγ and TNFα production in CD4⁺ T cells (splenocytes stimulated with RBD peptide pool) may be attributed to the overall lesser sensitivity of our assay protocol. Whether a VEEV replicon-based SAM vaccine shows a similar profile to the SFV replicon used in our study remains to be tested. A recent study also showed potent adjuvant function of the circular RNA, irrespective of the antigen sequence and robust CD8⁺ T cell response induced by a circular RNA vaccine encoding the nucleoprotein of the influenza virus, further supporting the practical utility of the circular RNA vaccine technology.¹⁰

Functional efficacy of the Circ-RBD vaccine was characterized by evaluating its thermostability, the durability of the neutralizing antibody response, ability to protect the mice upon SARS-CoV-2 challenge and compatibility as a bivalent vaccine formulation. Circ-RBD immunization induced peak anti-RBD IgG titer at 4 weeks, which protected the mice from COVID-19 like disease pathology when SARS-CoV-2 infection was initiated in the lower respiratory tract (severe disease, often leading to lethality). Nine month follow up study of the anti-RBD IgG titer and the virus neutralization titer (NT₅₀) did not show any decline in both. Moreover, NT₅₀ was similar in both male and female mice. We observed a striking difference between the SAM-RBD and Circ-RBD with regard to their stability in normal refrigeration conditions. Clearly, Circ-RBD was more stable. After 4 weeks of storage at 4°C, despite 1.5 log reduction in NT₅₀ titer of Circ-RBD immunized samples, that was sufficient to offer protection. Note that, NT₅₀ of 100 was shown to be equivalent to 91% vaccine efficacy in mRNA-1273 vaccine recipients.⁴³ However, SAM-RBD vaccine lost the ability to protect even after two weeks of storage. Large size of the SAM-RNA might have affected its stability at 4°C. A modified SAM-RNA or change in lipid composition of the LNP might improve its vaccine efficacy.

Finally, we evaluated the functional efficacy of a bivalent Circ-RBD vaccine. Failure of monovalent vaccines in preventing COVID-19 for a longer period is ascribed to emergence of newer variants of the SARS-CoV-2 containing escape mutations in the RBD region. Bivalent vaccines based on linear mRNA platform or nanoparticle platform expressing the spike protein or RBD region of the spike protein of the SARS-CoV-2-Delta and Omicron variants have shown cross-protection against SARS-CoV-2 variants.^28,29,33 On a similar line, our data on the bivalent Circ-RBD vaccine expressing the RBD of Delta and Omicron variants demonstrate cross-protection against the Wuhan, Delta, and Omicron variants.

While designing a Circ-RBD based vaccine, it is important to note that numerous circular RNAs are endogenously produced in the host. In addition to encoding small peptides, they play important biological roles by regulating the host transcription, splicing, and acting as miRNA sponges. Endogenous Circ-RNAs contain N6-Methyladenosine (m6A) modification, which marks them as “self” molecules and enables them to evade the innate immune sensors.⁴⁴ Although our assays did not show the activation of innate immune sensors in Circ-RBD RNA transfected cells, nonetheless, the vaccine efficacy of m6A modified Circ-RBD RNA should be tested in animal models. The effect of other nucleoside analogues on modulating the vaccine efficacy of Circ-RBD should be tested. Moreover, given that Circular RNAs act on other cellular RNAs and miRNA, possible off-target effects of the Circ-RBD vaccine should be rigorously evaluated. LNP is a key determinant of the success of an mRNA vaccine. SM-102 based LNPs were originally developed for use with linear mRNA vaccines. Whether Circ-RNA vaccine efficacy can be improved with an alternate LNP, needs to be evaluated. Recently, adjuvant lipidoid was shown to improve the efficacy of linear mRNA vaccine when compared to SM-102 LNP.⁴⁵ A similar strategy may further improve the efficacy of the Circ-RBD vaccine.

In summary, the current study compared the immunogenicity and virus neutralization efficacy of the SAM and Circ-RNA vaccine candidates encoding the SARS-CoV-2-RBD antigen, which revealed similar humoral immune response and virus neutralization potential of both vaccines and a superior cell-mediated immune response induced by the later. Our data also showed better stability of the Circ-RNA vaccine at 4°C, high durability of the neutralizing antibody response induced by it, and high virus neutralization efficacy of the bivalent Circ-RNA vaccine, all of which support the use of Circ-RNA technology in vaccine development. An earlier study showed the superiority of the SARS-CoV-2 Circ-RNA vaccine over the corresponding linear mRNA vaccine. Data obtained from this study further support the use of the Circ-RNA technology for vaccine development.

Limitations of the study

Our study is limited to comparing the vaccine efficacy of SAM-RBD and Circ-RBD in mice. Experiments in non-human primates such as rhesus macaques offer better conditions, closer to the immune parameters in humans. Production of a homogenous population of SAM and circular RNAs needs to be further optimized. Although circular RNA is smaller in size compared to the SAM RNA, resulting in a higher yield of the former by in vitro transcription, complete circularization of the in vitro synthesized RNA across independent batches needs to be monitored to ensure the reproducibility of the results. LNP composition might alter the immune response induced by the vaccine. Linear and circular RNA may have different LNP requirements for inducing the best desired immune profile. Hence, multiple LNPs should be tested for both SAM and circular RNAs to select the best formulation for each RNA and then compare their vaccine efficacy.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Milan Surjit (milan@thsti.res.in).

Materials availability

Materials generated in the study are available upon request.

Data and code availability

• •Data: Raw data supporting the findings of this study are available as supplemental information and raw data of FACS are available at https://figshare.com/s/61b536f9f2e238756556 (https://doi.org/10.6084/m9.figshare.30009442).
• •Code: This study did not generate any original code.
• •Other items: No additional resources were generated or analyzed during this study.

Acknowledgments

This study was partly supported by a BIRAC grant to M.S. (BT/COVID0081/01/20) and THSTI core grant to M.S. O.N.S. and U.B. are supported by senior research fellowships from the Council of scientific and industrial research and the department of Biotechnology, Government of India, respectively. We are thankful to the experimental animal facility and biosafety level three (BSL3) facility of THSTI for helping with the experiments. The following reagent was deposited by the Center for Disease Control and Prevention (USA) and obtained through BEI Resources, NIAID, NIH (USA): SARS-Related Coronavirus 2, isolate hCoV-19/USA-WA1/2020, NR-52281 and SARS-Related Coronavirus 2, isolate hCoV-19/USA/MD-HP20874/2021 (Lineage B.1.1.529; Omicron Variant), NR-56461, contributed by Andrew S. Pekosz. We are thankful to Henrik Garoff for the pSFV3 plasmid.

Author contributions

Conceptualization: M.S.; investigation: O.N.S., U.B., G.J., T.R.A., K.C., S.N., P.S., S.C., and F.M.; data analysis: O.N.S., G.J., T.R.A., B.N.P., S.M., G.B., C.T.R.K., P.G., and M.S.; resources: T.S., S.M., D.N., G.B., C.T.R.K., P.G., and M.S.; article writing: O.N.S., M.S., G.B., S.M., and C.T.R.K. All authors have reviewed, edited, and agreed to the final version of the article.

Declaration of interests

The authors have no conflict of interest to declare.

STAR★Methods

Key resources table

REAGENT or RESOURCES	SOURCE	IDENTIFIER
Bacterial and virus strains
SARS-CoV-2	BEI	USA-WA1/2020
B.1.617.2	BEI	hCoV-19/USA/PHC658/2021
B.1.1.529	THSTI	SARS-CoV-2/human/IND/THSTI_287/2021
Ad5-hACE	Viral Vector Core (University of Iowa, Iowa,USA)	VVC-McCray-7723
Recombinant DNA
pSFV3	Addgene	Cat# 92072
Chemicals, peptides, and recombinant proteins
Lipofectamine 3000	Thermo Fisher Scientific	Cat# L3000075
uranyl acetate	PolyScience	Cat# 21447-25
Triton X-100	Sigma Aldrich	Cat# X100
Ribogreen	Thermo Fisher Scientific	Cat# R11490
RNAse R	Abcam	Cat# ab286929
DMEM	Hi Media	Cat# 2023-24
MEM	Gibco	Cat# 11-095-080
RPMI 1640	Hi Media	Cat# AT150
FBS	Hi Media	Cat# RM9955-500 ML
Pen/Strep	Thermo Scientific	Cat#11360070
RNeasy Kit	Qiagen	Cat# 74104
SM102	Cayman Chemical	Cat# 33474
DSPC	Sigma	Cat# 850365P
Cholesterol	Sigma	Cat# 700000P
DMG-PEG 2000	Sigma	Cat# 880151P
Amicon ultra centrifugal filter	Merck Millipore	Cat# UFC703008
TRI-reagent	MRC	Cat# TR118
CMC	Sigma Aldrich	Cat# C4888, C5678
Vetbond	3M	Cat#1469Sb
SARS-CoV-2 RBD peptide pool	JPT innovative peptide solution	PM-WCPV-S_RBD-1
GolgiStop	BD bioscience	Cat# 554724
FC	Thermo Fisher Scientific	Cat# 14-9161-73
IC fixation buffer	Thermo Fisher Scientific	Cat# FB001
Permeabilizing buffer	Thermo Fisher Scientific	Cat# 00-8333-56
Critical commercial assays
MegaScript SP6 transcription kit	Thermo Fisher Scientific	Cat# AM1330
MegaScript T7 transcription kit	Thermo Fisher Scientific	Cat# AM1334
RNeasy Kit	Qiagen	Cat# 74104
Poly(A) tailing kit	Thermo Fisher Scientific	Cat# AM1350
Scriptcap Cap 1 capping system	CellScript	Cat# sccs1710
Firescript cDNA synthesis kit	Solis Biodyne	Cat# 06-15-00050
HOT FIREPol SolisGreen qPCR Mix	Solis Biodyne	Cat# 08-47-0000S
Antibodies
goat anti-Mouse IgG-HRP	Southern Biotech	Cat# 1030-05; RRID: AB_2619742
anti-SARS-CoV-2 Spike S1	Thermo Fisher Scientific	Cat# PA5-81795; RRID: AB_2788969
goat anti-Rabbit IgG-HRP	Thermo Fisher Scientific	Cat# 31460; RRID: AB_228341
Anti-mouse IgG (H + L) Alexa Flour 488	Thermo Fisher Scientific	Cat# A28175; RRID: AB_2536161
anti-GAPDH antibody	Santa Cruz Biotechnology	Cat# SC-25778; RRID: AB_10167668
Mouse monoclonal antibody isotyping reagent	Sigma Aldrich	Cat# ISO2
SARS-CoV-2 spike antibody	GeneTex	Cat# GTX632604; RRID: AB_2864418
anti-mouse CD3	BioLegend	Cat# 100204; RRID: AB_312661
anti-mouse CD4	BioLegend	Cat# 100408: RRID: AB_312693
anti-mouse CD8	BioLegend	Cat# 100714; RRID: AB_312753
anti-mouse CD44	BioLegend	Cat# 103030: RRID: AB_830787
anti-mouse IFNγ	BioLegend	Cat# 505810; RRID: AB_315404
anti-mouse TNFα	BioLegend	Cat# 506328; RRID: AB_2562902
anti-mouse IL-4	BioLegend	Cat# 504126; RRID: AB_2686971
Experimental models: Cell lines
HEK293T	ATCC	Cat# CRL-3216
VeroE6	ATCC	Cat# CRL-1586
Experimental models: Organisms/strains
BALB/c mice	Jackson Laboratories	Cat# 000651
Oligonucleotides
hIFNβ	Chen et al.44	N/A
hRIG-I	Chen et al.44	N/A
hOASL	Chen et al.44	N/A
hPKR	Chen et al.44	N/A
hOAS1	Chen et al.44	N/A
hGAPDH	Verma et al.46	N/A
SCoV2	Verma et al.46	N/A
mHPRT	Surjit et al.47	N/A
Software and algorithms
GraphPad prism v9.0	GraphPadSoftware	N/A
FlowJo Analyst	FlowJo Software (Treestar)	N/A
Deposited data
Data S1	Figshare: https://figshare.com/s/61b536f9f2e238756556	https://doi.org/10.6084/m9.figshare.30009442

Experimental model and study participant details

Cell line

HEK293T cells were obtained from ATCC (Cat# CRL-3216) and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 mg/mL streptomycin. African green monkey kidney epithelial cells (VeroE6; ATCC Cat#CRL-1586) were obtained from ATCC and cultured in Minimum Essential Medium (MEM) with 10% FBS, 2 mM L-glutamine, 100 U/mL penicillin, and 100 mg/mL streptomycin. All cell cultures were incubated at 37°C in a humidified atmosphere with 5% CO₂. Cells were tested for mycoplasma contamination at regular intervals and before experiments.

Viral strains

SARS-CoV-2 Wuhan isolate (NR-52281, SARS-related coronavirus-2 isolate ISA-WA1/2020) and Omicron Variants (B.1.1.529, NR56461, SARS-related coronavirus-2 isolate hCoV-19/USA/MD-HP20874/2021) were obtained from BEI Resources, amplified in Vero E6 cells in the BSL3 facility of THSTI, India, titrated and stored frozen in aliquots. SARS-CoV-2-Delta (SARS-CoV-2/human/IND/THSTI_287/2021) was isolated from clinical sample at THSTI and has been reported (GenBank: MZ356566.1). SARS-CoV-2 infection was done as described.⁴⁶

Mice

Mice were housed in pathogen free condition in individually ventilated cages at the experimental animal facility of THSTI. For SARS-CoV-2 infection experiments, animals were housed in the animal biosafety level-3 (ABSL-3) laboratory of THSTI, following Institutional Biosafety Committee (IBSC) guidelines. Institutional animal ethics committee (approval no. IAEC/THSTI/228), IBSC (approval no. THS/459/2022) and RCGM (approval no. BT/IBKP/137/2020) approval was obtained for the experiments. The mice room was maintained at 19°C–26°C with humidity between 30 and 70% and a 14-h light/10-h dark cycle. 6–8 weeks old, male and female mice were randomly allocated to experimental groups, and the number of animals used in the experiments is specified in the figure.

Method details

Plasmids

Plasmid encoding the noninfectious Semliki Forest virus replicon (pSFV3) was a gift from Henrik Garoff (Addgene plasmid # 92072; http://n2t.net/addgene:92072; RRID:Addgene_92072).³⁴ 988 to 1578 nucleotides encoding the RBD region (330–526 amino acids) of spike protein of the SARS-CoV-2 Wuhan isolate (hCoV-19/USA-WA1/2020) fused in-frame with the CD5 secretory sequence at the N-terminal and the Bacteriophage T4 fibritin trimerization motif sequence at the C-terminus was synthesized and inserted into the pSFV3 vector at the BamH1 restriction site. The resulting plasmid was named pSFV3-RBD. Transcription of SFV-RBD hybrid RNA in the pSFV3-RBD vector was under control of the SP6 promoter. A circular RNA expression cassette containing the sequence of the T7 promoter, Anabaena Group 1 intron 3′ sequence, CVB3 IRES sequence, CD5 secretory sequence, RBD region (988–1578 nucleotides) of spike protein of the SARS-CoV-2 Wuhan isolate (hCoV-19/USA-WA1/2020), bacteriophage T4 fibritin trimerization motif and anabaena group 1 intron 5′ sequence was chemically synthesised in the given order and cloned into the pUC57 vector. The resulting plasmid was named pUC57 cRNA-RBD^Wuhan. RBD corresponding to the SARS-CoV-2-Delta (hCoV-19/USA/MD-HP05285/2021) and Omicron (hCov-19/USA/MD-HP2087/2021) variants were cloned similarly and the resulting plasmids were named pUC57 cRNA-RBD^Del and pUC57 cRNA-RBD^Omi, respectively. Sequence of the constructs are available in Table S1.

In vitro transcription and RNA processing

pSFV3-RBD, pUC57 cRNA-RBD^Wuhan, pUC57 cRNA-RBD^Del and pUC57 cRNA-RBD^Omi plasmids were linearized and purified DNA was used for the in vitro transcription using the Megascript SP6 or T7 transcription kit, following the manufacturer’s instruction. SAM-RNA was capped using the Scriptcap Cap 1 capping system and polyadenylated using the Poly(A) tailing Kit, following the manufacturer’s instructions. In the case of Circ-RNA, in vitro transcribed RNA was incubated at 55°C for 15 min in the circularization buffer (10 mM MgCl₂, 50 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, pH 7.9; New England Biolabs, USA) and 2 μM rGTP to circularize the RNA, as described earlier.²² Circularized RNA was incubated at 37°C for 7 min with 0.1 units RNase R/μg RNA, followed by addition of 0.1 units RNase R/μg RNA and incubation for another 7 min. RNA was purified using the RNeasy kit, following the manufacturer’s protocol (Qiagen, Germany).

Purification of RNA by HPLC

RNA was heated at 65°C for 3 min and subsequently cooled on ice for another 3 min. The RNA was then passed through a size-exclusion column of particle size of 5 μm and a pore size of 2000 Å (Sepax Technologies; 215980P-4630) by utilizing the e2695 Separations Module (Waters). The RNA was resolved in RNase-free TE buffer (10 mM Tris, 1 mM EDTA, pH: 6) at a flow rate of 0.3 mL/min. RNA was detected by UV absorbance at 260 nm. The collected RNA fractions were purified and concentrated using the RNeasy kit.

Preparation and characterization of the RNA-LNP vaccine formulation

SM102, DSPC, Cholesterol and DMG-PEG 2000 were mixed at a molar ratio of 50:10:38.5:1.5 in absolute ethanol at 1/5 of the final LNP amount. An aqueous solution of RNeasy kit (silica-based spin column)-purified RNA was prepared by diluting it in 50 mM acetate buffer (1.2 mM sodium acetate, 4 mM acetic acid, pH 4.0) at 4/5 of the final LNP volume. Note that both HPLC column and silica spin column-purified RNA showed similar purity in agarose gel electrophoresis and spectrophotometry. Hence, silica spin column-purified RNA was used in all subsequent experiments due to ease of operation. The two solutions were mixed using a microfluidics system (ElveFlow Elvesys, France) at a flow rate ratio of 1:5. The resulting RNA-LNP complex was dialyzed with phosphate buffered saline (137 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.8 mM KH₂PO₄, pH 6.8) and concentrated using a 30 kDa MWCO Amicon ultra centrifugal filter to a volume of 0.1 μg/μL RNA concentration. Further, the RNA-LNP vaccine formulation was passed through a 0.2 μm filter and aliquoted into glass vials and stored at 4°C. Size and polydispersity (PDI) of the RNA-LNP vaccine formulation were evaluated by dynamic light scattering (ZetaSizer lab, Malvern panalytical, United Kingdom). For Transmission electron microscopy (TEM), RNA-LNP vaccine formulation was diluted ten times in H₂O, followed by staining with 2% uranyl acetate and image acquisition using JEM-1400 Flash TEM equipped with tungsten filament and sCMOS camera (JEOL Ltd, Japan). RNA encapsulation into LNP was measured by fluorescent-based RNA quantification system using Ribogreen, following manufacturer’s instruction. The encapsulated RNA was released from the LNP by treating the RNA-LNP vaccine formulation with 2% Triton X-100, followed by measurement of RNA quantity by Ribogreen assay and evaluation of RNA quality by agarose gel electrophoresis.

Transfection

HEK293T cells were seeded on 6 well plates (8 × 10⁵ cell/well) and transfected with 6 μg of RNA-LNP complex. Only LNP was added in the mock. 24 h post-transfection, cells supernatant and cell lysate were collected and analyzed for protein expression by western blot. For innate immune activation quantification, HEK293T cells were transfected with 1 μg of SAM-RBD or Circ-RBD RNA or Poly I:C were transfected using lipofectamine 3000, following manufacturer’s instruction (Thermo Fisher Scientific, Massachusetts, USA). Total RNA was isolated in TRI-reagent at indicated time points.

Western blot assay

For western blot analysis under reducing condition, samples (cells or culture medium) were incubated at 95°C for 5 min in Laemlli buffer (2% SDS, 13% glycerol, 2.5% β-mercaptoethanol, 0.005% bromophenol blue and 63 mM Tris HCl, pH 6.8). For non-reducing condition, β-merceptoethanol was omitted from the Laemlli buffer. Total protein in the samples was quantified by Bicinchoninic acid assay and equal amount of protein were resolved in SDS-PAGE, followed by transfer to Polyvinylidene fluoride (PVDF) membrane. The membrane was blocked with 5% skimmed milk, incubated with anti-Spike S1 or anti-GAPDH antibody at 1:5000 dilution. Anti-Rabbit secondary antibody was used at 1:5000 dilution. Protein bands were developed by enhanced chemiluminescence reagent, using a commercially available kit (BioRad, USA) and visualized in a gel Documentation system (Chemidoc MP, Bio Rad, USA).

RT-qPCR assay

For RT-qPCR analysis of genes involved in the antiviral response pathway, total RNA of HEK293T cells transfected with SAM-RBD or Circ-RBD RNA or Poly I:C were isolated using the TRI-reagent (MRC, Massachusetts, USA), followed by reverse transcription (RT) using the Firescript cDNA synthesis kit (Solis Biodyne, Estonia). The relative transcript levels of different genes were determined by SYBR green based RT-qPCR, as described.⁴⁶ Values obtained for GAPDH RNA was used as an internal control for normalization of the data.

For RT-qPCR analysis in the mouse lung tissue, total RNA was isolated from 10 mg lung tissue using TRI reagent, following manufacturer’s instruction. cDNA synthesis and RT-qPCR was done as mentioned above. HPRT RNA level was quantified for normalization of data. Primer sequences are as follows: hGAPDH FP: 5′ GAGTCAACGGATTTGGTCGT 3′, hGAPDH RP: 5′ TTGATTTTGGAGGGATCTCG 3′, hIFNβ FP: 5′ ACGCCGCATTGACCATCTAT 3′, hIFNβ RP: 5′ TTGGCCTTCAGGTAATGCAGA 3′, hRIG-I FP: 5′ TGTGGGCAATGTCATCAAAA 3′, hRIG-I RP: 5′ GAAGCACTTGCTACCTCTTGC 3′, hOASL FP; 5′ AGGGTACAGATGGGACATCG 3′, hOASL RP: 5′ AAGGGTTCACGATGAGGTTG 3′, hPKR FP: 5′ TCTTCATGTATGTGACACTGC 3′, hPKR RP: 5′ CACACAGTCAAGGTCCTT 3′, hOAS1 FP: 5′ GCTCCTACCCTGTGTGTGTGT 3′, hOAS1 RP: 5′ TGGTGAGAGTACTGAGGAAGA 3′, SCoV2 FP: 5′ TGGACCCCAAAATCAGCGAA 3′, SCoV2 RP: 5′ TCGTCTGGTAGCTCTTCGGT 3′, mHPRT FP: 5′ GTTGGATACAGGCCAGACTTTGTTG 3′, mHPRT RP: 5′ GATTCAACTTGCGCTCATCTTAGGC 3′, mIL-6 FP: 5′ GAGGATACCACTCCCAACAGACC 3′, mIL-6 RP: 5′ AAGTGCATCATCGTTGTTCATACA 3′, mIL-1β FP: 5′ GCCCATCCTCTGTGACTCAT 3′, mIL-1β RP: 5′ AGGCCACAGGTATTTTGTCG 3′, mTNFα FP: 5′ CATCTTCTCAAAATTCGAGTGACAA 3′, mTNFα RP: 5′ TGGGAGTAGACAAGGTACAACCC 3′, mIFNγ FP: 5′ AACGCTACACACTGCATCTTGG 3′, mIFNγ RP: 5′ GACTTCAAAGAGTCTGAGG 3′, RBD-RT-qPCR FP: 5′ ATCTGAAGCCCTTCGAGCGGGACA 3′, RBD-RT-qPCR RP: 5′ GCCGCACACGGTAGCAGGGGA 3’.

Mice immunization

Male and Female Balb/c mice of 6–8 weeks old were intradermally injected on the back of the animal with 10 μg of SAM-RBD or Circ-RBD twice at two-weeks interval. In the case of intramuscular injection, mice were injected in the hind leg muscle. All injections were in 100 μL volume. Placebo animal received 100 μL PBS. Blood was collected at the indicated time points through retro-orbital sinus using a sterile hematocrit capillary tube. Wherever indicated, mice were euthanized by anesthetic overdose (Ketamine 300 mg/kg and xylazine 30 mg/kg) and blood, spleen and lungs were collected. Serum was isolated from the blood by centrifugation at 10,000g for 10 min at 4°C. Lung tissue was cut into parts and used for RNA, protein or histopathology analysis.

SARS-CoV-2 infection in mice

Replication deficient adenovirus expressing human ACE2 (Ad5CMV-hACE2, denoted as hACE2) was transduced through intranasal or intratracheal route.^31,32 For Intranasal transduction, mice were lightly anesthetized with isoflurane and 2 × 10⁸ pfu of hACE2 was administered, as described.³² Intratracheal transduction of hACE2 was performed as described.³¹ Mice were anesthetized with ketamine xylazine injection (Ketamine 100 mg/kg and xylazine 10 mg/kg), hair was shaved from the neck region and a 5 mm incision was made in the skin to expose the trachea. 2 × 10⁸ pfu of hACE2 was administered in the trachea using a 24-gauge I.V. cannula. The wound opening was glued with tissue adhesive (Vetbond, 3M Corp, USA). Animals did not show any sign of illness or inflammation at the site of the glue. Mice were infected with 10⁵ pfu SARS-CoV-2 intranasally after 5 days of hACE2 administration. Weight of the animals were measured before infection and every day after the infection and survival was checked till 21 days of post-infection. When an animal showed critical illness symptoms after SARS-CoV-2 infection, it was euthanized and samples were collected. An animal from the immunized group was euthanized for comparison when mice from the placebo group were euthanized.

ELISA

The Enzyme-Linked Immunosorbent Assay (ELISA) was performed as described, with below mentioned modifications.⁴⁸ The receptor-binding domains (RBDs) of the three SARS-CoV-2 variants-Wuhan, Delta, and Omicron, were expressed in-house in the Expi293 cells (Thermo Fisher Scientific, Massachusetts, USA) and used in the ELISA. The assay samples (mice sera) were diluted in a 3-fold series from 1:500 to 1:1,093,500. Horseradish peroxidase (HRP)-labelled Goat anti-Mouse IgG (H + L) (Jackson ImmunoResearch, USA) was used at a dilution of 1:5000. The endpoint anti-RBD IgG titer (denoted as anti-RBD IgG titer in the text and figures) refers to the dilution factor at which the absorbance (obtained in the ELISA) of the test samples exceeded three times that of the background (secondary Ab alone). Anti-RBD IgM and IgG isotype (IgG1, IgG2a and IgG2b) ELISA was performed using Mouse monoclonal antibody isotyping reagent, following the manufacturer protocol at a serum dilution of 1:500.

Flow cytometry

Splenocytes were isolated and live cells were counted using trypan blue. The cells were cultured in RPMI-10 supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin antibiotic. After 3 h, the RBD peptide pool (2 μg/mL each peptide), along with PMA-Ionomycin controls and Golg-iStop (BD), were added to the culture medium for 6 h. Unstimulated cells were maintained in parallel. Cells were blocked with FC-block at room temperature for 15 min and stained with anti-CD3, anti-CD4, anti-CD8 and anti-CD44. Following the surface staining, cells were fixed and permeabilised. Intracellular cytokine (IFNγ, TNFα and IL-4) staining was performed using respective antibodies. Cells were acquired using the BD FACS-aria (BD Biosciences), and data were analyzed using the FlowJo software (FlowJo LLC, Oregon, USA), as reported.^9,49 Raw data of FACS can be found at https://figshare.com/s/61b536f9f2e238756556.

Quantification of viral load by plaque assay

For quantification of SARS-CoV-2 level in the lungs, 5 mg of lung tissue was homogenised in 1 mL serum free DMEM and sterilized using 0.2 μm filter. The homogenate was serially diluted 10-fold and added to 2 × 10⁵ VeroE6 cells/well in 12 well plate for 1 h. Infection medium was removed, 1% carboxymethyl cellulose (CMC) was added and plates were incubated for 48 h at 37°C, with 5% CO₂ supplementation. Cells were fixed in 3.7% formaldehyde for overnight, plaques stained with 0.05% crystal violet and number of plaques in each well was counted.

Plaque reduction neutralization test (PRNT)

50% virus neutralization efficiency (NT₅₀) of the sera from mice immunized with the SAM-RBD^Wuhan and Circ-RBD^Wuhan vaccine formulations were measured by the Plaque reduction neutralization test (PRNT), as described.⁵⁰ Briefly, mouse sera were heated at 55°C for 30 min, 2-fold serially diluted starting from 1:10 in serum-free DMEM, mixed with an equal volume of virus [virus stock was appropriately diluted so that each well produces approximately 50 plaque-forming units (pfu)] and incubated at 37°C for 1 h 2 × 10⁵ VeroE6 cells/well in 12 well plates were incubated with the serum-virus mix for 1 h. Infection medium was removed and cells were overlaid with 1% CMC in 2% FBS supplemented DMEM and incubated at 37°C with 5%CO₂ supplementation for 48 h. Cells were fixed in 3.7% formaldehyde for overnight and stained with 0.2% crystal violet. The number of plaques were counted and the serum dilution leading to 50% neutralization of the virus (NT₅₀) was calculated using the GraphPad Prism 9.0 (Massachusetts, USA).

Focus reduction neutralization test (FRNT)

NT₅₀ of the Wuhan, Delta and Omicron variants were measured by the Focus reduction neutralization test (FRNT). Heat inactivated serum sample were 2--fold serially diluted, starting from 1:20 and mixed with an equal volume of the virus [virus stock was appropriately diluted so that each well produces approximately 100 focus forming units (ffu)] and incubated at 37°C for 1 h 2 × 10⁴ VeroE6 cells/well in 96 well plates were incubated with the serum-virus mix for 1 h. Infection medium was removed and cells were overlaid with 0.5% CMC in 2% FBS supplemented DMEM and incubated at 37°C with 5%CO₂ supplementation for 24 h. Cells were fixed in formaldehyde and permeabilized with 0.2% Triton X-100. Next, the cells were stained with anti-Spike antibody, following manufacturer’s protocol followed by staining with alexa fluor-488-conjugated anti-mouse IgG antibody. The number of foci was counted using an ELISPOT reader (iSPOT, AID GmBh, Strassberg, Germany) and the serum dilution leading to 50% neutralization of the virus was calculated using GraphPad Prism 9.0.

Histopathology

Histopathology analysis of the lung tissue samples were performed by the histology service of the experimental animal facility of THSTI, following established protocol. Briefly, lung tissues were kept in 10% neutral buffered formalin solution immediately after collection. After ensuring proper fixation, samples were subjected to processing and paraffin embedded blocks were prepared. 4 μm thick sections were cut using a semi-automatic microtome (Histocore Multicut- Leica Biosystem, Germany) and mounted on glass slides. The sections were stained with haematoxylin and eosin, following standard operating procedures of the facility. Slides were analyzed by a qualified histopathologist, following blind evaluation method. Semi-quantitative scoring system was adopted to score the pathological conditions, 0 indicating absence of a pathological condition while 5 indicating its highest severity. Pathological conditions such as; bronchiolitis, vasculitis, interstitial pneumonia, alveolitis and haemorrhage were analyzed and scored. Images were visualized and captured using a Bright field upright microscope (CX43RF- Olympus Life science Solutions, Japan) equipped with a color camera (DP28- Olympus Life science Solutions, Japan) and imaging software (cellSens Entry- Olympus Life science Solutions, Japan) at 200X magnification.

Quantification and statistical analysis

Statistical analysis

All cell line data are derived from 3 independent experiments and represented as mean ± SD of 3 independent experiments. Data for percentage encapsulation efficiency was derived from 2 independent experiments and represented as mean. For mouse study, 5–9 animals were used in each group, as indicated in the figures. Average values are shown in the bar and individual values are shown as dots in each bar in the graphs. Two-tailed unpaired t-test (Mann-Whitney) and One-way ANOVA (Kruskal-Wallis test) followed by Dunn’s multiple comparisons was used for comparison between groups, as indicated in the figures. Logistic regression was used to determine the NT₅₀ titer of the mice sera. All statistical analysis was performed using the GraphPad Prism 9. A p-value < 0.05 with 95% confidence interval was considered statistically significant. ns: p > 0.05, ∗: p < 0.05, ∗∗: p < 0.01, ∗∗∗: p < 0.001, ∗∗∗∗: p < 0.0001.

Published: September 4, 2025