Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Multiplex PCR primers
| Target gene | Primer | Sequence (5′→3′) | Length (base) | Tm (°C) | GC % | Size (bp) |
|---|---|---|---|---|---|---|
| grlAB | grl-1 | AACGAAATCTAAATTGGGTA | 20 | 55.3 | 30 | 1,457 |
| grl-2 | GGAAATCTTGATGGCAATAC | 20 | 58.4 | 40 | ||
| gyrAB | gyr-1 | TGAAGTAACACGTCGTAAAT | 20 | 54.7 | 35 | 1,255 |
| gyr-2 | AGGTAAGACTGACGGCTCTC | 20 | 60.0 | 55 | ||
| mecAa | GMECAR-1 | ACTGCTATCCACCCTCAAAC | 20 | 60.5 | 50 | 163 |
| GMECAR-2 | CTGGTGAAGTTGTAATCTGG | 20 | 57.1 | 45 |
Primers for amplification of the mecA gene were previously described by Mehrotra et al. (18).
