mTOR-autophagy axis regulation by intermittent fasting promotes skeletal muscle growth and differentiation

Abstract

Intermittent fasting (IF) as a dietary intervention with potential health benefits has garnered significant attention in recent years. This study investigated the effects of varying fasting intensities on skeletal muscle growth using mouse models. Compared to the normal-diet (ND) control group, short-term fasting induced feeding amount-dependent alterations in skeletal muscle autophagy markers, characterized by elevated LC3B expression, reduced p62 levels, and decreased p-mTOR/mTOR ratio. Notably, short-term mild fasting (sMF) significantly upregulated myogenic (MYH, MyoD) and adipogenic (LPL, PPARγ) differentiation markers, whereas short-term severe fasting (sSF) suppressed myogenic markers without significantly affecting adipogenic factors. Pharmacological modulation using 3-methyladenine (3-MA) and rapamycin (RAPA) confirmed the critical role of autophagy in myogenic and adipogenic processes. Multi-cycle IF studies revealed that intermittent mild fasting (IMF) enhanced metabolic efficiency (evidenced by increased feed conversion ratio), elevated organ indices of gastrocnemius and quadriceps femoris muscles, and reduced groin fat. IMF also promoted intramuscular adipogenesis and myofiber remodeling. In contrast, intermittent severe fasting (ISF) impaired glucose tolerance, decreased triglyceride levels and aspartate aminotransferase (AST) activity, inhibited myofiber growth, and exhibited no significant effect on intramuscular adipogenesis. Our findings demonstrate that IMF enhances skeletal muscle mass and reduces visceral adiposity through mTOR-autophagy axis, providing an optimized fasting regimen for metabolic health and body composition regulation.

Introduction

The mechanisms underlying muscle growth and development in animals represent a critical focus in animal genetics research. Despite significant advancements, numerous regulatory factors and mechanisms remain to be elucidated. Skeletal muscle dynamically regulates autophagic flux through multiple pathways under conditions of starvation, hypoxia, and exercise, thereby influencing muscle metabolism and growth [1, 2]. Autophagy, a highly conserved cellular process, maintains cellular homeostasis is through degradation of proteins and organelles while recycling energy substrates [3, 4]. The Taoist “Bigu” regimen in traditional Chinese health practices and the European-originated “fasting therapy” (encompassing dietary restriction and intermittent fasting) dating back to the 18th century have gained widespread recognition as health-promoting and disease-preventive approaches. Recent investigations have revealed that the therapeutic mechanisms of fasting interventions are closely associated with cellular autophagy, with substantial evidence demonstrating starvation-induced autophagy activation [5]. Emerging studies further indicate that prolonged starvation triggers atypical autophagy mechanisms analogous to LC3B-associated phagocytosis, wherein large lipid droplets serve as platforms for LC3B lipidation during autophagic processes [6]. Additionally, energy restriction exerts beneficial effects on chronic disease management and cancer therapy through anti-inflammatory responses and modulation of oncogenic pathways such as IGF-1R, Ras, and AKT/mTOR [7–10]. Our previous studies have demonstrated that short-term serum starvation induces moderate autophagy that enhances metabolic activity and differentiation capacity in skeletal muscle satellite cells (SMSCs), whereas prolonged starvation leads to apoptosis and diminished differentiation potential [11, 12]. Building upon these findings, this study employs mouse models to systematically investigate the effects of varying fasting intensities on autophagy regulation and muscle growth dynamics. The research aims to elucidate the molecular mechanisms underlying fasting-mediated skeletal muscle development and provide theoretical foundations for optimizing economic animal husbandry practices.

Materials and methods

Mouse grouping and handling

Six-week-old female C57BL/6J mice were obtained from the Comparative Medicine Laboratory Animal Center of Yangzhou University. Feed is purchased from Xietong Pharmaceutical Bio-Engineering (3,902 kcal/kg; No. 1010097, CHN). The mice were housed individually, and their daily average food intake was measured. Mice in the normal-diet group (ND) were allowed free access to feed. The short-term mild fasting group (sMF) received 70% of the daily average food intake, while the short-term severe fasting group (sSF) was restricted to 30% of daily average food intake. To investigate autophagy modulation, autophagy inhibition group was achieved via intraperitoneal injection of 3-methyladenine (3-MA; 15 mg/kg; A8780, Solarbio, CHN), whereas autophagy activation group was induced by rapamycin (RAPA; 2 mg/kg; IR0010, Solarbio, CHN), and mice in each group were post-sampled after 36 h of feeding. In the study of the effect of intermittent multi-cycle fasting on muscle development, mice in the intermittent mild fasting group (IMF) were fed 70% of the average daily food intake on the first day, and then fed ad libitum on the next day for 20 cycles; mice in the intermittent severe fasting group (ISF) were fed 30% of the average daily food intake on the first day, and then fed ad libitum on the next day for 20 cycles.

Fig. 1.

Multi-cycle feeding pattern. A)Normal-diet group (ND); B) Multi-cycle Intermittent mild fasting group(IMF); C) Multi-cycle Intermittent severe fasting group (ISF)

Metabolic levels of skeletal muscle tissues were measured by short-term fasting

Blood glucose levels were measured by collecting tail vein blood from each group of mice after short-term fasting, as well as from the ND group. The longissimus dorsi muscles of mice were collected, weighed and tissue homogenized, and ATP levels were determined by following the instructions of ATP assay kit (S0026, Beyotime, CHN). The skeletal muscle tissues were collected to isolate the tissue mitochondria, and the mitochondria were added with JC-1 staining working solution using fluorescent enzyme marker to detect the membrane potential according to the detection kit (C2006, Beyotime, CHN). Mice longissimus dorsi muscles ultrasonically crushed and processed to determine the level of ROS using the kit (E004-1-1, Njjcbio, CHN), and the specific detection method is the same as the literature [12].

Effect of short-term fasting on autophagy level in skeletal muscle tissues

The longissimus dorsi muscles of mice in each group after short-term fasting and control mice were collected, and total tissue protein was extracted and protein concentration was determined. After polyacrylamide gel electrophoresis and membrane transfer, expression of autophagy-related proteins LC3B (ab229327, Abcam, USA), p62 (ab233207, Abcam, USA), AMPK (66536-1-lg. Proteintech, USA), phospho-AMPK (p-AMPK, GTX03702, GeneTex), mTOR (66888-1-lg, Proteintech, USA) and phospho-mTOR (p-mTOR, 67778-1-lg, Proteintech, USA) was determined using Tubulin (11224-1-AP, Proteintech, USA) as an internal reference protein.

Effects of short-term fasting on myogenic and lipogenic differentiation of skeletal muscle tissues

Longissimus dorsi muscles were isolated from both short-term fasting and control mice. To evaluate myogenic differentiation capacity, Western blot was performed using MHC (SC-53088, Santa Cruz, USA) and MyoD (SC-32758, Santa Cruz, USA) antibodies. The adipogenic differentiation capacity of mouse skeletal muscle tissue was detected using PPARγ (SC-7273, Santa, USA) and LPL (SC-373759, Santa, USA) antibodies.Tubulin served as an internal reference protein. The acquired images were used to determine the gray value of the hybridization bands using ImageJ software, and the ratio of the gray value of the target protein and the gray value of the internal reference protein tubulin band was the relative expression of each target band. Data were brought into GraphPad Prism 9, and significance was determined by one-way ANOVA.

Determination of growth performance of intermittently fasted mice

The feed intake of intermittently fasted mice and normal-diet mice was recorded on a daily basis, and the body weights of mice were recorded and plotted on a weekly basis. The Feed Conversion Ratio (FCR) was calculated according to FCR=(Feed Consumption/Weight Gain)×100. Heart, liver, spleen, lungs, kidneys, groin fat, gastrocnemius and quadriceps muscles were removed from each group of mice and weighed. The organ index was calculated according to the following formula, Organ Index = (Organ Weight /Mouse Body Weight)×100.

Health status test of mice on intermittent fasting

The mice were observed daily for changes in body temperature, diet and mental status, whole blood was collected and serum was separated from each group of mice at the end of the feeding experiments for blood biochemical tests. After overnight fasting, blood glucose was measured from the tail vein of the mice, 10 min later, 20% glucose solution (1 g/kg) was injected intraperitoneally, and blood glucose was monitored at different time points.

Blood glucose was measured in tail vein blood of mice after fasting for 4 h, and insulin solution (0.3U/kg) was injected intraperitoneally, 10 min later, blood glucose was monitored at different time points. The above blood glucose value data were plotted using Graphpad prism 9 software and the Area Under Curve (AUC) was calculated.

Effect of intermittent fasting on myofibrillar and fat mass in skeletal muscle tissues

Mouse gastrocnemius muscle was collected from each group, dehydrated after 4% paraformaldehyde fixation, sectioned and stained with hematoxylin and Eosin (HE) to determine the myofibrillar muscle fiber area and intermuscular gap of the skeletal muscle tissues. Mouse gastrocnemius muscle tissue was fixed with 2.5% glutaraldehyde and examined by transmission electron microscopy. Mouse gastrocnemius muscle tissues were prepared as frozen sections and stained with oil red O to detect the amount of fat in the skeletal muscle tissues of mice in each group; the fat content in the skeletal muscle tissues was detected by Soxhlet extraction; and the triglyceride content in the skeletal muscle tissues was detected by using a kit (BC0625, Solarbio, CHN). Muscle fiber cross-sectional area, intermuscular space distance and oil red O mean optical density were calculated by ImageJ software. The data were imported into GraphPad Prism 9 and statistically analyzed by one-way ANOVA.

Effects of intermittent mild fasting on autophagy and skeletal muscle differentiation protein detection in skeletal muscle tissue

The longissimus dorsi muscles of mice in each group were collected, and a part of them was subjected to Western blot to detect autophagy, myogenic and lipogenic differentiation proteins in skeletal muscle with Tubulin as internal reference. The remaining skeletal muscle tissue was fixed, paraffin-embedded, and sectioned. Following antigen retrieval, sections were blocked with 5% BSA and subsequently incubated overnight at 4 °C with primary antibodies against LC3B and p62. After washing, sections were incubated for 1 h at room temperature with fluorescent HRP-conjugated secondary antibody (A22120, Abbkine, CHN). For immunohistochemical analysis, parallel sections were similarly processed using MHC primary antibody followed by HRP-labeled secondary antibody incubation. The grayscale values of Western blot bands, the mean optical density of fluorescence and optical density values of DAB staining positive sites was analyzed using ImageJ. Detailed experimental protocols were consistent with those described in reference [13]. Data were brought into GraphPad Prism 9, and significance was determined by one-way ANOVA.

qRT-PCR detection of the expression of myogenic and adipogenic-related genes

Mouse gastrocnemius muscle was collected from each group. Total RNA was extracted using TRIzol reagent. Reverse transcription was performed with PrimeScript RT Master Mix. Gene-specific primers (Table 1) designed by Primer Premier 6.0 were synthesized by Tsingke Biotechnology, SYBR^® Premix EX TaqTM Fluorescent real-time Quantification Kit from Takara was used. Relative mRNA expression was calculated by 2 − ΔΔCt method using β-actin as endogenous control. Statistical comparisons were performed using one-way ANOVA in SPSS.

Table 1.

Primer information of related genes for qRT-PCR detection

Gene name	Primer sequence(5′→3′)	Annealing temperature	bp
pparγ	F: TCCGTGATGGAAGACCACTC R: CACAGACTCGGCACTCAATG	55	277
LPL	F: CCAAGAGAAGCAGCAAGATG R: CCACCTCCGTGTAAATCAAG	55	228
MyoD	F: TGCTCTGATGGCATGATGG	55	263
	R: TGTTCTGTGTCGCTTAGGG

Statistical analyses

The data were presented as mean ± standard error of mean (SEM) with representative figures. Statistical analysis was performed using GraphPad Prism 9 and analyzed by analysis of variance (ANOVA). The value of statistical significance was set as *P < 0.05 or ** P < 0.01.

Results

Effects of short-term fasting on blood glucose and skeletal muscle metabolism levels in mice

Following short-term fasting, blood glucose levels in the sMF and sSF groups were significantly lower than those in the ND group (9.08 ± 0.64, 6.22 ± 0.36 & 13.37 ± 1.43, P < 0.01) (Fig. 2-A). Metabolic activity in skeletal muscle tissues was assessed across the three groups (Fig. 2-B, C, D). No significant differences were observed in mitochondrial membrane potential among the groups (P > 0.05). However, reactive oxygen species (ROS) levels were significantly higher in the sSF group compared to the sMF and ND groups (2.33 ± 0.10, 0.99 ± 0.07 & 1.00 ± 0.08, P < 0.01), with no significant difference between the ND and sMF groups (P > 0.05). ATP levels in the sMF group were significantly elevated compared to the ND group (1.42 ± 0.10 & 1.00 ± 0.08, P < 0.01), whereas the sSF group exhibited a significant reduction compared to the ND group (0.51 ± 0.05 & 1.00 ± 0.08, P < 0.01).

Fig. 2.

Effects of different degrees of short-term feeding on blood glucose level and skeletal muscle tissue metabolic indexes. A) Average blood glucose level in serum of mice in each group; B) ROS detection in skeletal muscle tissue of mice in each group; C)Detection of mitochondrial membrane potential in skeletal muscle tissue of mice in each group (P > 0.05); D)ATP detection in skeletal muscle tissue of mice in each group (*P < 0.05, **P < 0.01)

Effect of short-term fasting on autophagy levels in skeletal muscle tissue

Western blot analysis was performed to assess autophagy-related proteins and pathway signaling in skeletal muscle following short-term fasting (Fig. 3-A, B). Compared to the ND group, both the sMF and sSF groups exhibited a significant upregulation of LC3B protein levels (1.00 ± 0.11, 1.70 ± 0.12 & 2.62 ± 0.10, P < 0.01) and the phosphorylation ratio of AMPK (p-AMPK/AMPK) (1.00 ± 0.03, 1.70 ± 0.14 & 2.17 ± 0.21, P < 0.01). Conversely, p62 levels (1.00 ± 0.08, 0.58 ± 0.09 & 0.28 ± 0.05, P < 0.01) and the phosphorylation ratio of mTOR (p-mTOR/mTOR) (1.00 ± 0.04, 0.70 ± 0.10 & 0.35 ± 0.03, P < 0.01) were significantly reduced. These findings indicate that short-term fasting induces autophagy through the AMPK/mTOR pathway, with the degree of autophagy positively correlated with the intensity of fasting. Following intraperitoneal administration of 3-MA, LC3B protein levels and the p-mTOR/mTOR ratio were significantly decreased, while p62 levels were increased in skeletal muscle tissues of the ND, sMF, and sSF groups. In contrast, treatment with RAPA resulted in opposite trends in the expression of these autophagy-related proteins compared to the 3-MA-treated groups.

Fig. 3.

Effects of autophagy inhibitor and autophagy promoter on autophagy in mice with varying degrees of short-term fasting. A) Protein blotting results of LC3B, p62 protein, p-mTOR, mTOR with p-AMPK, AMPK protein and the internal reference protein Tubulin in different degrees of fasting mice; B) Protein blotting grayscale analysis; C) Protein blotting results of LC3B, p62 protein, p-mTOR, mTOR with p-AMPK, AMPK protein and the internal reference protein Tubulin in different degrees of fasting mice injected with autophagy accelerator and autophagy inhibitor; D) Protein blotting grayscale analysis (*P < 0.05, **P < 0.01)

Effects of short-term fasting on myogenic and lipogenic differentiation of skeletal muscle tissue

The effect of short-term fasting on myogenic and lipogenic differentiation proteins in mouse skeletal muscle tissue as assessed by Western blot analysis (Fig. 4-A). Compared to the ND group, the sMF group exhibited a highly significant increase in MYH, PPARγ, and LPL expression (P < 0.01), along with a significant increase in MyoD levels (P < 0.05). In contrast, the sSF group showed no significant changes in MYH, PPARγ, or LPL expression (P > 0.05), but a significant reduction in MyoD levels (P < 0.01). Following intraperitoneal administration of 3-methyladenine (3-MA), a marked decrease in MyoD, MYH, PPARγ, and LPL expression was observed in skeletal muscle tissues across the ND, sMF, and sSF groups. Conversely, treatment with rapamycin (RAPA) resulted in an upregulation of these proteins.

Fig. 4.

Effects of the autophagy inhibitor and the autophagy promoter on marker proteins of myogenic and lipogenic differentiation in mice with varying degrees of short-term fasting. A) Protein blotting results of MYH, MyoD, PPARγ, LPL protein and the internal reference protein Tubulin in different degrees of fasting mice; B) Protein blotting grayscale analysis; C) Protein blotting results of MYH, MyoD, PPARγ, LPL protein and the internal reference protein Tubulin in different degrees of fasting mice injected with autophagy accelerator and autophagy inhibitor; D) Protein blotting grayscale analysis (Statistical analysis was performed using GraphPad Prism 9 and analyzed by ANOVA. *P < 0.05, **P < 0.01 Lr, ladder. Error bars represent mean ± SEM, n≥ 3)

Effects of intermittent fasting on growth performance in mice

Following intermittent fasting protocols, the ISF group exhibited a significantly lower final body weight compared to the ND and IMF groups (21.20 0.21, 22.03 ± 0.20 & 21.97 ± 0.2, P < 0.05), while no significant difference was observed between the IMF and ND groups (Fig. 5-A, B, C; P > 0.05). Total feed intake during the intermittent fasting period was significantly lower in the IMF and ISF groups compared to the ND group (99.13 ± 0.69, 83.44 ± 1.34 & 110.90 ± 2.36, P < 0.01), with the ISF group showing the most pronounced reduction (Fig. 5-D, E; P < 0.01).The feed conversion ratio in the ND group was significantly higher than that in the IMF group (89.98 ± 1.91 & 83.28 ± 0.70, P < 0.05) but significantly lower than that in the ISF group (89.98 ± 1.91 & 156.80 ± 2.22, P < 0.01). Compared to the ND group, the IMF group demonstrated a significant increase in the organ indices of the quadriceps femoris (0.54 ± 0.02 & 0.58 ± 0.01, P < 0.05) and gastrocnemius (0.52 ± 0.01 & 0.57 ± 0.01, P < 0.05), along with a significant reduction in the groin fat index (1.69 ± 0.07 & 1.46 ± 0.05, P < 0.05). Notably, the ISF group exhibited a significantly lower groin fat index compared to both the ND and IMF groups (1.19 ± 0.03, P < 0.05).

Fig. 5.

Effects of intermittent fasting on growth performance of mice. A) Pre-experimental body weights of mice; B) Post-experimental body weights of mice; C) Weekly body weight changes in mice; D)Total feed intake in intermittent fasting mice; E) Feed conversion ratio in intermittent fasting mice; F) External morphology of intermittent fasting mice in each group (partial); G) Comparison of inguinal fat; H) Comparison of left hindlimb muscle morphologic size; I) Comparison of gastrocnemius muscle morphology size appearance; J) Comparison of quadriceps morphologic size; K) Mean final weight and monthly food intake in mice (*P < 0.05, **P < 0.01)

Effects of intermittent fasting on the health status of mice

The results of serum triglyceride levels, glucose tolerance, and insulin tolerance tests are presented in Fig. 6. Compared to the ND group, the ISF group exhibited a significant reduction in serum triglyceride levels and aspartate aminotransferase (AST) activity (P < 0.01). Although the IMF group showed a decreasing trend in these parameters, the differences were not statistically significant compared to the ND group (P > 0.05). As shown in Fig. 6-B and C, the area under the glucose tolerance curve (AUC) in the ISF group was significantly lower than that in the ND group (929.20 ± 95.05 & 1200.37 ± 58.33, P < 0.05). Following insulin injection, blood glucose levels returned to baseline within 90 min in the ND and IMF groups, whereas the ISF group exhibited a delayed recovery, requiring 120 min. However, no significant differences were observed in the area under the insulin tolerance curve (AUC) among the three groups (P > 0.05).

Fig. 6.

Effects of intermittent fasting on the health status of mice. A) Blood biochemistry in in intermittent fasting mice; B) Glucose tolerance curves in intermittent fasting mice and its corresponding area under the curve; C) Insulin tolerance curves in intermittent fasting mice and its corresponding area under the curve(*P < 0.05, **P < 0.01)

Effects of intermittent fasting on muscle fiber and fat mass in skeletal muscle tissue

Transmission electron microscopy (TEM) was employed to examine the ultrastructure of skeletal muscle in each experimental group (Fig. 7-A). In the ND and IMF groups, myofibrils were tightly arranged, and mitochondrial membranes remained intact, with the presence of a small number of autophagosomes at various stages. In contrast, the ISF group exhibited tightly packed myofibrils, significantly reduced mitochondrial size, partial vacuolization of mitochondrial membranes, and a substantial increase in autophagosomes at different stages. These findings indicate the presence of basal autophagy under normal physiological conditions. IMF had no apparent adverse effects on mitochondria in skeletal muscle cells, while the ISF group displayed varying degrees of mitochondrial damage and enhanced autophagy. Muscle fiber area in the ND and IMF groups was significantly larger than that in the ISF group (1425.14 ± 66.06, 1583.58 ± 56.17 & 1165.02 ± 38.64, P < 0.01), with no significant difference between the ND and IMF groups (Fig. 7-B, C; P > 0.05). The Intermuscular gap in the IMF group was significantly greater than that in the ND and ISF groups (41.72 ± 3.27, 22.97 ± 1.46 & 32.50 ± 1.91, P < 0.05), significant differences were also found between the ND and ISF groups(P < 0.05). Lipid content and triglyceride (TG) levels in skeletal muscle were significantly higher in the IMF group compared to the ND and ISF groups (P < 0.05), with no significant difference between the ISF and ND groups (Fig. 7-D, E, F). Meanwhile, the results of intramuscular fat content measured by Soxhlet extraction method were consistent with those of Oil Red O staining (Fig. 7-G).

Fig. 7.

Effect of intermittent fasting on muscle fiber and fat content in skeletal muscle tissue. A)Ultrastructural observation of skeletal muscle(5/2 µm); B)Microscopic comparison of paraffin sections of skeletal muscle tissue from mice in 3 groups (100/50µm); C)Statistical analysis of muscle fiber area and intermuscular gap of skeletal muscle in 3 groups of mice; D)Comparison of oil red O staining in frozen sections of skeletal muscle tissues (100 μm); E)Comparative analysis of positive signals of oil red O staining; F)TG content in skeletal muscle tissues; G)Comparison of fat quantification in skeletal muscle of mice (*P < 0.05, **P < 0.01)

Effects of intermittent fasting on the expression of autophagy and differentiation proteins in skeletal muscle tissue

Western blot, immunofluorescence, and immunohistochemical analyses were performed to evaluate autophagy-related proteins and signaling pathways in skeletal muscle tissues (Fig. 8-A, B, E, G). Compared to the ND group, the IMF group exhibited a significant increase in the LC3B-II/I ratio and the phosphorylation ratio of AMPK (p-AMPK/AMPK) (P < 0.05), with the highest expression observed in the ISF group. Conversely, p62 levels and the phosphorylation ratio of mTOR (p-mTOR/mTOR) were significantly reduced in the IMF group (P < 0.05), the ISF group had the lowest expression. These results indicate that the “short-term fasting–ad libitum feeding” multi-cycle regimen induced autophagy levels proportional to fasting intensity, mediated through the AMPK/mTOR pathway. The expression of myogenic and adipogenic differentiation-related proteins was further assessed (Fig. 8-C, D, I, J). Compared to the ND group, the IMF group showed significant upregulation of myogenic (MYH, MyoD) and adipogenic (LPL, PPARγ) markers (P < 0.05). In contrast, the ISF group displayed a significant reduction in MYH and MyoD protein levels (P < 0.05), while LPL, PPARγ, and PGC-1α expression remained unchanged (P > 0.05). These findings suggest that IMF promotes both myogenic and adipogenic differentiation in skeletal muscle, whereas ISF suppresses myogenic differentiation without significantly affecting adipogenic processes.

Fig. 8.

The effect of intermittent fasting on autophagy and differentiation of skeletal muscle tissue was examined at molecular level. A) Protein blotting results of LC3B, p62 protein, p-mTOR, mTOR with p-AMPK, AMPK protein and the internal reference protein Tubulin; B)Protein blotting grayscale analysis; C)Protein blotting results of MYH, MyoD, PPARγ, LPL proteins and PGC-1α and the internal reference protein Tubulin; D) Protein blotting grayscale analysis; E) LC3B fluorescence expression (50 μm); F) LC3B fluorescence intensity analysis; G) p62 fluorescence expression (50 μm); H) P62 fluorescence intensity analysis; I) Immunohistochemical staining of myogenic differentiation marker protein MYH and PPARγ in paraffin Sect. (50 μm); J) Relative expression level of MYH (*P < 0.05, **P < 0.01)

qRT-PCR detection of the expression of myogenic and adipogenic-related genes

The expression of myogenic and adipogenic-related genes in skeletal muscle tissues of the three groups of mice was detected by qRT-PCR, and the results are shown in Fig. 9. The results of myogenic-related gene MyoD expression in skeletal muscle tissues showed that the IMF group was significantly higher than the ND group and ISF group (3.44 ± 0.40, 1.01 ± 0.11 & 0.95 ± 0.11, P < 0.01), while there was no significant difference between the ND group and ISF group (P > 0.05). For the adipogenic-related gene LPL, its expression in skeletal muscle tissues was significantly higher in the IMF group than in the ND group and ISF group (3.43 ± 0.13, 1.01 ± 0.07 & 1.62 ± 0.07, P < 0.01). Additionally, there was a highly significant difference between the ND group and ISF group (P < 0.01). The expression of the PPARγ gene in the ND group was significantly lower than in the IMF group and ISF group (1.01 ± 0.08, 1.95 ± 0.09 & 1.77 ± 0.13, P < 0.01), while no significant difference was observed between the IMF group and ISF group (P > 0.05). The partial discrepancy between mRNA detection results and protein detection results may be attributed to the influence of translation efficiency.

Fig. 9.

The expression of myogenic and adipogenic-related genes in mouse skeletal muscle tissues was detected by qRT-PCR. A) Relative mRNA expression of MyoD; B) Relative mRNA expression of LPL; C) Relative mRNA expression of PPARγ(*P < 0.05, **P < 0.01)

Discussion and summary

The regulation of skeletal muscle growth by nutrient availability has long been a focal point in developmental biology research. Our previous studies demonstrated that starvation stress induces autophagy in porcine SMSCs, and that mild serum starvation over a short period enhances both myogenic and adipogenic differentiation capacities of SMSCs [12]. Building on these findings, we hypothesized that moderate fasting might promote skeletal muscle growth. To test this hypothesis, the current study investigated the effects of short-term fasting on autophagy, metabolism, and differentiation in skeletal muscle. Autophagy, a critical cellular process, is regulated by key proteins such as LC3 and p62, as well as signaling pathways including mTOR/AMPK [14–17]. Our results indicate that short-term fasting induces autophagy in skeletal muscle through the mTOR/AMPK pathway, with autophagy levels positively correlated with the degree of starvation. By evaluating metabolic indicators such as mitochondrial membrane potential, ROS levels, and ATP content, we found that sMF significantly increased ATP levels without markedly altering ROS levels or mitochondrial membrane potential, suggesting that sMF enhances cellular metabolism and energy conversion. In contrast, sSF led to excessive ROS accumulation. While ROS is essential for regulating cell growth and various biological functions, its imbalance can directly impair skeletal muscle metabolism. The observed suppression of skeletal muscle growth and metabolism in the sSF group may be attributed to excessive ROS levels in skeletal muscle tissues [18–20].Skeletal muscle differentiation capacity was evaluated through myogenic markers (MyoD and MYH) and adipogenic markers (PPARγ and LPL) [21–24]. The study revealed that sMF significantly upregulated the expression of these differentiation markers, whereas autophagy inhibition (via 3-MA treatment) suppressed their expression, and autophagy induction (via RAPA treatment) enhanced it. These molecular findings confirm that sMF promotes both myogenic and adipogenic differentiation through mTOR-mediated autophagy. However, the adverse effects of sSF on differentiation may be linked to ROS-induced metabolic dysfunction, consistent with our prior observations in SMSCs [12, 25].

To explore the potential of fasting as a nutritional strategy, we implemented an IF regimen characterized by multi-cycle “short-term fasting (1 day)–ad libitum feeding (1 day)” intervals. This approach aims to maximize the benefits of autophagy while mitigating adverse effects. Physiological assessments, including blood biochemical indices, glucose tolerance tests, and insulin tolerance tests, demonstrated that IMF had no significant negative impacts on murine health or development. IMF reduced feed consumption while maintaining body weight gain, decreasing groin fat deposition, and increasing skeletal muscle mass. In contrast, ISF induced malnutrition and metabolic suppression, impairing both muscle and adipose tissue formation [26]. The primary focus of this study is to investigate the effects of IF on skeletal muscle growth and explore its potential clinical applications. Therefore, it is essential to comprehensively evaluate the impact of IF on overall health and major organs. Preliminary findings indicate that IMF promotes skeletal muscle growth while reducing groin fat deposition, without exerting significant effects on the development of other organs. Further investigation is warranted to assess the long-term consequences of IF on physiological systems.

At the cellular level, IMF enhanced mitochondrial function, as evidenced by elevated ATP levels and mitochondrial membrane potential, alongside reduced ROS accumulation. These findings align with studies showing that intermittent fasting improves mitochondrial activity in multiple tissues [27, 28]. TEM and molecular analyses revealed increased autophagosome formation in skeletal muscle tissues of IF groups, in which the number and morphology of mitochondria in the IMF group were not significantly different from that of the normal-fed mice, and the proportion of mitochondrial swelling and abnormality in skeletal muscle tissues of the ISF group was significantly higher than that in the other two groups. Previous studies have confirmed that long-term severe nutritional stress suppresses metabolism and induces apoptosis in skeletal muscle satellite cells [25]— findings that accord with the detrimental effects of ISF observed in our current investigation. The expression patterns of autophagy-related proteins and differentiation markers showed strong concordance with the outcomes observed in short-term fasting experiments. Collectively, these results indicate that IF triggers mTOR pathway-dependent autophagy. IMF promotes both myogenic and adipogenic differentiation in skeletal muscle, whereas ISF suppresses myogenic differentiation. These observations are consistent with our earlier findings on the effects of serum starvation on porcine SMSC metabolism and differentiation [12, 25].Building upon these findings, we have implemented this nutritional strategy in swine production management. Preliminary results indicate that controlled fasting promotes skeletal muscle tissue growth without compromising herd health (data unpublished).

Conclusion

In summary, this study reveals that fasting-induced autophagy through the mTOR pathway promotes skeletal muscle growth and differentiation. Intermittent mild fasting (IMF) serves as an effective nutritional strategy, reducing food intake and groin fat while increasing skeletal muscle mass without negative health impacts. These findings highlight the potential of IMF in enhancing muscle growth and improving feed efficiency in economically important animals.

Author contributions

Chen Xinyan participated in part of the experiments, contributed to the figure preparation, and drafted the initial manuscript; Wu Yajie participated in partial experiments and coordinated the experimental progress; He Shangfan contributed to data analysis; Yang Yuefei was involved in figure and table editing; Li Junwei and Zhu Jiaqiao participated in revising the experimental protocol; Ju Huiming secured funding and contributed to manuscript revision.

Funding

This work was supported by the Postgraduate Research & Practice lnnovation Program of Jiangsu Province (KYCX24_3830), Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD) and 111 Project (D18007).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Competing interests

The authors declare no competing interests.