Protocol to screen chemicals to enhance homology-directed repair in CRISPR-Cas9 gene editing

Summary

CRISPR-Cas9-based gene editing via homology-directed repair (HDR) enables precise modifications, though its efficiency is limited by the prevalence of non-homologous end joining (NHEJ). Here, we present a protocol for enhancing HDR efficiency by identifying chemicals using high-throughput screening (HTS). We describe steps for designing 96-well plates, executing HTS, and performing data analysis. We then detail procedures for identifying small molecules that improve HDR-associated gene editing. This protocol has potential application in HTS analysis focused on discovering reliable HDR enhancers.

For complete details on the use and execution of this protocol, please refer to Jang et al.¹

Graphical abstract

Highlights

• •Protocol for screening chemicals that enhance HDR efficiency in human cultured cells
• •Steps for combining LacZ colorimetric and viability assays for quantifiable HDR readout
• •Instructions for rapid identification of HDR-enhancing compounds in a single assay
• •Suitable for high-throughput screening using a standard plate reader

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

CRISPR-Cas9-based gene editing via homology-directed repair (HDR) enables precise modifications, though its efficiency is limited by the prevalence of non-homologous end joining (NHEJ). Here, we present a protocol for enhancing HDR efficiency by identifying chemicals using high-throughput screening (HTS). We describe steps for designing 96-well plates, executing HTS, and performing data analysis. We then detail procedures for identifying small molecules that improve HDR-associated gene editing. This protocol has potential application in HTS analysis focused on discovering reliable HDR enhancers.

Before you begin

This protocol describes the HTS procedure for identifying chemicals that enhance HDR-associated CRISPR-Cas9 gene editing. The HDR assay integrates a LacZ sequence into the LMNA locus via HDR, and β-galactosidase activity is used as a readout to detect successful gene editing events. Cell culture experience is required. Cell culture medium preparation, plate coating solution preparation, plate coating, cell culture, and transfection are performed within a biosafety cabinet.

Preparation of cell culture medium

Timing: 30 min

• 1.Add supplements required for cell culture of HEK293T to 500 mL fresh DMEM-medium:

Reagents	Final concentration	Amount
DMEM	N/A	500 mL
Fetal Bovine Serum	∼10% (v/v)	50 mL
Zell Shield	∼1% (v/v)	5 mL

Store at 4°C for up to 3 months.

Alternatives: Penicillin-Streptomycin (Invitrogen, Cat# 15140122, 10,000 U/mL) can be used instead of Zell Shield.

• 2.Warm medium in water bath at 37°C before cell culture.

Preparation of plate coating solution

Timing: 30 min

• 3.
  Make 10× poly-D-lysine hydrobromide (PDL) solution:

  Reagents	Final concentration	Amount
  Poly-D-lysine hydrobromide	0.1 mg/mL	5 mg
  DPBS (Sterile)	N/A	50 mL

  Store at −20°C freezer up to 3 years.

  • a.
    Pipette the solution up and down several times in the 50 mL sterile conical tube using a 10 mL pipette.
  • b.
    Aliquot 5 mL of 10× PDL solution into individual 50 mL sterile conical tube and store in −20°C freezer.

    Note: Autoclaving or filtering not required.

• 4.Add 45 mL of DPBS to 5 mL of 10× PDL solution to make a 1× PDL solution. 1× PDL solutions can be stored at 4°C for up to 2 years.

Preparation of 96-well plate

Timing: 1–2 h

• 5.Add 1× PDL solution to each well of 96-well plates (All clear plate).

Note: PDL coating is recommended to enhance cell adhesion, as HEK293T cells exhibit weak attachment to standard tissue culture surfaces.

Note: The amount of coating solution depends on the type of cell culture plate used. For a 96-well plate, 50 μL of coating solution is sufficient to cover the full area of well. We recommend users carefully assess well coverage to determine the optimal volume for their specific needs.

• 6.Incubate plates with coating solution for at least 1 h in a biosafety cabinet or in a 37°C CO₂ incubator.
• 7.Remove the 1× PDL coating solution thoroughly.

Note: 1× PDL coating solution may be reused 1–2 times, but only if strict sterility is maintained. After carefully removing the 1× PDL coating solution from each well, store it at 4°C.

• 8.The coated plates can be used immediately or stored under sterile conditions for use on the following day.

Note: After PDL coating, it is recommended to remove the coating solution and store the dried coated plates until use.

Preparation of HEK293T cells

Timing: 10–20 min (for step 9)

Timing: 1–2 h (for step 10)

This protocol describes a method to culture HEK293T cells. The procedure involves thawing and passaging. Warm the medium in a 37°C water bath before thawing or passaging cells.

• 9.
  Thaw frozen HEK293T cells.

  • a.
    Thaw cryo-frozen cells in a 37°C water bath until the freezing medium is approximately 70% thawed.
  • b.
    Transfer the contents of the cryovial into a sterile 15 mL conical tube containing 4 mL of culture media.
  • c.
    Centrifuge the cells at 200 × g for 3 min at 15°C–30°C.
  • d.
    Aspirate and remove the supernatant and resuspend the cell pellet in 1 mL of culture medium.
  • e.
    Add the cells to a 100 mm dish containing 10–12 mL of culture media.
  • f.
    Place the 100 mm dish in a CO₂ incubator (37°C, 5% CO₂) and gently move the dish back and forth and side to side to evenly distribute the cells.
• 10.
  Subculture HEK293T cells.

  • a.
    Remove the complete medium, DPBS, and Trypsin-EDTA (TE) from 4°C refrigerator.
  • b.
    Warm complete media and DPBS in a 37°C water bath until they reach 37°C. Allow TE warm to 15°C–30°C.
  • c.
    After wiping the bottles of complete medium, DPBS, and TE with 70% Ethanol, place them in a biosafety cabinet.
  • d.
    Transfer the cell culture vessels from the CO₂ incubator to a biosafety cabinet.
  • e.
    Aspirate the cell medium and wash the cells with 2–5 mL of DPBS.
  • f.
    Aspirate DPBS and add 1 mL of TE to 100 mm dish.

    Note: HEK293T cells are weakly adherent and prone to detachment during DPBS washing. Perform this step gently to avoid cell loss.

    Note: We maintain HEK293T passaging cultures without PDL coating. However, for experimental cell seeding, we use PDL coating due to the weak adhesion of HEK293T cells.

  • g.
    Incubate for 1–3 min at 15°C–30°C. Firmly hold the cell culture vessels with the lid secured and gently tap them with the palm of your hand to detach the cells from the bottom.
  • h.
    Add the 3–4 mL of complete medium to the cell culture vessel.
  • i.
    Detach all cells from the bottom of the cell culture vessel by pipetting up and down 15–20 times using a 1 mL pipette.
  • j.
    Transfer the entire cells to a 15- or 50-mL conical tube.
  • k.
    Centrifuge the conical tube at 200 × g for 3 min at 15°C–30°C.
  • l.
    Aspirate the supernatant and resuspend cells in culture media and add the cell to a 100 mm dish containing media in a 1:3–1:5 ratio.
  • m.
    HEK293T cells are ready for the next passaging after 2–3 days.

    Note: We recommend using cells between passage 3–5 for screening experiments after thawing.

Preparation of cell lysis buffer and beta-galactosidase solution

This protocol describes a method for preparing cell lysis buffer and beta-galactosidase solution. Due to the reduced colorimetric activity of aged solutions, it is recommended to prepare beta-galactosidase solution fresh before each experiment.

5× lysis buffer

Reagents	Final concentration	Amount
1 M Tris-HCl (pH 8.0)	125 mM	6.25 mL
0.5 M EDTA (pH 8.0)	10 mM	1 mL
100% Glycerol	50% (v/v)	25 mL
100% Triton X-100	5% (v/v)	2.5 mL
Distilled water (DW)	N/A	15.25 mL

Store at 4°C for up to 1 week.

Beta-galactosidase solution

Reagents	Final concentration	Amount
1 M Sodium phosphate	200 mM	2.76 g
Magnesium chloride	2 mM	19 mg
14.3M β-mercaptoethanol	100 mM	0.699 mL
o-nitrophenyl-β-D-galactopyranoside (ONPG)	1.33 mg/ml	133 mg
DW	N/A	Up to 100 mL

Prepare beta-galactosidase solution fresh before experiment.

Preparation of donor DNA plasmids

Timing: 3–4 days

This protocol describes a method for preparing donor DNA plasmids containing ∼500 bp homology arms on each side. The methods for generating DNA plasmid using cloning technique and plasmid purification are included.

Note: It has been observed that longer homology arms tend to increase HDR efficiency. Typically, homology arms ranging from 300 bp to 1 kb are used by researchers to achieve efficient HDR-mediated gene editing.

• 11.
  Prepare genomic DNA from HEK293T by using ReliaPrep gDNA Tissue Miniprep System or genomic DNA extraction buffer.

  • a.
    By using the following modifications to ReliaPrep gDNA Tissue Miniprep System.

    Alternatives: Although we used ReliaPrep gDNA Tissue Miniprep System in this protocol, genomic DNA can be extracted using other genomic DNA preparation kits.

    Note: Genomic DNA purity tends to improve when prepared from a 6-well scale or larger. A greater amount of starting material allows for more effective washing steps and removal of contaminants, leading to higher DNA quality. Furthermore, higher concentrations of inorganic components such as salts and buffers facilitate the efficient elimination of residual impurities during the purification process.

    • i.
      Wash cells once with sterile cold 1× PBS and harvested by scraping.
    • ii.
      Resuspend the cell pellet in 160 μL of PBS and add 20 μL of Proteinase K solution.
    • iii.
      Incubate at 56°C for 10–30 min.
    • iv.
      Add 160 μL of Cell Lysis Buffer (CLD) and 20 μL of RNase A solution.
    • v.
      Incubate again at 56°C for 10–30 min.
    • vi.
      Proceed with the remaining steps according to the manufacturer’s instructions (Promega, ReliaPrep gDNA Tissue Miniprep System).
  • b.
    By using genomic DNA extraction buffer.

    Note: While DNA extracted using the DNA extraction buffer may not be fully purified, it is adequate for subsequent PCR.

    • i.
      Wash cells once with sterile cold 1XPBS.
    • ii.
      Add directly genomic DNA extraction buffer to the vessels.
    • iii.
      Scrape cells and collect them to 1.5 mL tube.
    • iv.
      Incubate 60°C for 15 min–16 h.
    • v.
      Vortex for 15 sec–1 min.
    • vi.
      Incubate 98°C for 5 min.
    • vii.
      Store at 4°C for short-term storage (up to 1 week) or at −20°C for long-term storage.
      Genomic DNA extraction buffer

      Reagents	Final concentration	Amount
      0.5 M Tris (pH 8.0)	40 mM	4 mL
      100% Tween-20	1% (v/v)	0.5 mL
      0.5 M EDTA	0.2 mM	20 μL
      100% Nonidet P-40 Substitute	0.2% (v/v)	0.1 mL
      DW	N/A	Up to 50 mL

      Store at 4°C for up to 3 months.
• 12.
  Perform PCR using genomic DNA as a template.

  • a.
    After determining the target DNA, design PCR primers to facilitate assembly using In-Fusion or NEBuilder HiFi DNA assembly kits.

    Note: Several tools are available to facilitate primer design: Snapgene program (Licensed software); Web-based free tool provided by NEB: https://nebuilder.neb.com/#!/; Web-based free tool provided by Takara Bio: https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools.

  • b.
    Conduct PCR reaction using primers spanning left homology arm (500 bp).
  • c.
    Conduct PCR reaction using primers spanning right homology arm (500 bp).
  • d.
    Conduct PCR reaction using primers spanning LacZ DNA (3060 bp).
  • e.
    Run the amplified sample on agarose gel to check the size and presence of the specific DNA band.
  • f.
    Purify PCR product using PB purification kit.

    Note: If multiple nonspecific bands are observed on the agarose gel, purify the DNA using an agarose gel extraction kit.

  • g.
    Check the concentration and quality using NanoDrop.
  • h.
    Calculate the moles of amplified DNA using the mass value obtained from NanoDrop.
    Examples of DNA mass-to-mole conversion

    DNA sequence	DNA length	DNA mass	Moles of DNA
    pUC19 linear Vector	2686 bp	50 ng	30.22 fmol
    Fragment1 (Left homology arm)	500 bp	18.62 ng	120.9 fmol
    Fragment2 (LacZ insert)	3060 bp	113.9 ng	120.9 fmol
    Fragment3 (Right homology arm)	500 bp	18.62 ng	120.9 fmol

    Note: Conversion is easily accomplished using the free, web-based tool provided by NEB: https://nebiocalculator.neb.com/#!/dsdnaamt.

    Note: Assembly efficiency tends to improve with a reduced number of fragments (Figure 1). To decrease the fragment count, perform a secondary PCR using the merged initial PCR products as a template, generating a single fragment for assembly. However, overlap length can influence PCR performance.

• 13.
  Prepare a linearized vector.

  • a.
    Choose an appropriate restriction enzyme in pUC19 vector. We used KpnI and AflIII restriction enzyme from NEB.
  • b.
    pUC19 vector is cut by restriction enzymes.
    Restriction reaction

    Reagents	Final concentration	Amount
    pUC19	1 μg/μL	1 μL
    KpnI-HF	20 Units/Reaction	1 μL
    AfIIII	20 Units/Reaction	1 μL
    10× rCutSmart Buffer	1×	5 μL
    Nuclease-free Water	N/A	Up to 50 μL

  • c.
    Incubate at 37°C for 2–3 hr.
  • d.
    Purify restricted plasmid using PB purification kit.
  • e.
    Run the sample on agarose gel to check the size and linearization.
  • f.
    Check the concentration and quality using NanoDrop.
  • g.
    Calculate the moles of amplified DNA using the mass value obtained from NanoDrop.
• 14.
  Assemble the fragments (Figure 2).

  • a.
    Mix the fragments and kit reagents in the PCR tube to combine.
    DNA fragment assembly using NEBilder HiFi Assembly Master Mix

    Reagents	Final concentration	Amount
    pUC19 linear Vector	30.22 fmol	1–2 μL
    Fragment1 (Left homology arm)	120.9 fmol	1–2 μL
    Fragment2 (LacZ insert)	120.9 fmol	1–2 μL
    Fragment3 (Right homology arm)	120.9 fmol	1–2 μL
    2× NEBilder HiFi Assembly Master Mix	1×	10 μL
    Nuclease-free water	N/A	up to 20 μL

    DNA fragment assembly using In-Fusion HD Cloning Kit

    Reagents	Final concentration	Amount
    pUC19 linear Vector	30.22 fmol	1–2 μL
    Fragment1 (Left homology arm)	120.9 fmol	1–2 μL
    Fragment2 (LacZ insert)	120.9 fmol	1–2 μL
    Fragment3 (Right homology arm)	120.9 fmol	1–2 μL
    5× In-Fusion HD Cloning Kit	1×	2 μL
    Nuclease-free water	N/A	up to 10 μL

  • b.
    Incubate 15–60 min at 50°C using PCR machine.
  • c.
    Verify the DNA assembly via agarose gel electrophoresis.

    Note: Compare the assembled DNA to the individual DNA fragments as controls using agarose gel electrophoresis to verify successful assembly. Successful assembly is characterized by a decrease in fragment band intensity and the appearance of a new band at the expected size for the assembled DNA.

• 15.
  Transformation and identification of correctly inserted plasmids.

  • a.
    Perform transformation of DH5α competent cells. Spread samples on LB plate containing the appropriate antibiotic. The pUC19 vector contains ampicillin resistance.
  • b.
    The next day, pick individual isolated colonies from LB plate and cultivate in liquid LB containing the appropriate antibiotic.
  • c.
    The next day, after plasmid DNA isolation, determine the presence of the insert and analyze the DNA by Sanger sequencing.

Figure 1.

Reducing the number of insert fragments enhances assembly efficiency

Figure 2.

DNA cloning strategy for donor plasmid generation

Preparation of sgRNA plasmids

Timing: 3–4 days

This protocol describes a method for preparing sgRNA-expressing plasmids. The procedures include plasmid construction using standard cloning techniques and plasmid purification.

• 16.
  Generate vector plasmid (pUC19-sgRNA-scaffold vector plasmid) containing U6 promoter-sgRNA scaffold.

  • a.
    Amplify the U6 promoter and sgRNA scaffold by PCR using the pX330 vector as a template.
  • b.
    Purify the PCR product using a PB purification kit.
  • c.
    Measure the concentration and purity using a NanoDrop spectrophotometer.
  • d.
    Linearize the pUC19 vector by AatII restriction enzyme digestion.
  • e.
    Purify the linearized vector using a PB purification kit. Check the concentration and quality using NanoDrop.
  • f.
    Measure the concentration and purity using a NanoDrop.
  • g.
    Calculate the molar amounts of the PCR product and linearized pUC19 based on the mass values obtained from NanoDrop readings.
  • h.
    Assemble the fragments using Gibson assembly or a similar method (refer to Step 32).
  • i.
    Transform the assembled plasmid into competent E. coli and identify correctly inserted clones (refer to Step 15).

Note: Once generated, this vector plasmid can be used universally for different target sequences by simply replacing the target-specific oligonucleotides.

• 17.
  Design the sgRNA target site.

  • a.
    Use an online tool such as Cas-Designer (http://www.rgenome.net/cas-designer/) to design a sgRNA target sequence for LMNA.
  • b.
    The LMNA target sequence (without PAM) is:

   ccatggagaccccgtcccag.

• 18.Order two complementary oligonucleotides for LMNA sgRNA cloning.

Forward oligo: 5′-cacc(CCATGGAGACCCCGTCCCAG)-3′ : (LMNA target sequence)

Reverse oligo: 5′-aaac(CTGGGACGGGGTCTCCATGG)-3′ : (Complementary sequence of LMNA target)

• 19.
  Anneal the two oligos.

  • a.
    Prepare the following annealing mixture:

    Reagents	Amount
    Oligo 1 (100 pM)	5 μL
    Oligo 2 (100 pM)	5 μL
    Ligation buffer (NEB) or Buffer H (Takara)	5 μL
    Nuclease-free water (Sterile)	35 μL

  • b.
    Incubate at 95°C for 4 min.
  • c.
    Incubate for at 70°C 10 min.
  • d.
    Turn off the heat block and allow the mixture to cool gradually to ambient temperature (15°C–30°C).

    Note: Cooling can be achieved by leaving the tube on the heat block for 8–20 h.

    Alternatives: PCR machine or water bath can be used instead of heat block.

  • e.
    Add 700 μL of sterile nuclease-free water to the annealed oligos.

    CRITICAL: Do not perform column purification. The annealed oligos pass through the PB column, and the purity is sufficient for the next step.

• 20.
  Linearize the pUC19-sgRNA-scaffold vector plasmid.

  • a.
    Digest the pUC19-sgRNA-scaffold vector plasmid with BbsI enzyme at 37°C for 1–3 h.
    Restriction reaction

    Reagents	Final concentration	Amount
    pUC19-sgRNA-scaffold vector	1 μg/μL	1 μL
    BbsI	10 Units/Reaction	1 μL
    NEBuffer r2.1	1×	5 μL
    Nuclease-free Water	N/A	Up to 50 μL

  • b.
    Purify the linearized vector using a PB purification kit.
  • c.
    Measure the concentration and purity using a NanoDrop.
• 21.
  Ligate the linearized vector and annealed oligos.

  • a.
    Prepare the ligation reaction as follows:
    Ligation reaction

    Reagents	Amount
    Linearized pUC19-sgRNA-scaffold vector (50 ng/μL)	1–2 μL
    Diluted annealed oligos	2 μL
    Ligation buffer (NEB)	1 μL
    T4 DNA Ligase (NEB)	0.5 μL
    Nuclease-free water (Sterile)	Up to 10 μL

  • b.
    Incubate the ligation mixture according to the manufacturer’s instructions (typically at 16°C–25°C for 1–2 h or at 4°C for 12–16 h).
• 22.Transform the ligated mixture into competent E. coli and identify correctly inserted clones by Sanger sequencing (refer to Step 15).

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Chemicals, peptides, and recombinant proteins
Dulbecco’s modified Eagle’s medium (DMEM)	Gibco	Cat#11995-065
Fetal bovine serum	Gibco	Cat#16000-044
ZellShield	Minerva Biolabs	Cat#13-0050
Opti-MEM I reduced serum medium	Gibco	Cat#31985-070
Trypsin-EDTA (0.05%), phenol red	Gibco	Cat#25300-054
Lipofectamine3000	Invitrogen	Cat#L3000075
DPBS	Gibco	Cat#14190-144
1 M Tris-HCl, pH 8.0	Bioneer	Cat#C-9006
0.5 M EDTA, pH 8.0	Biosolution	Cat#BE002
Glycerol	Sigma-Aldrich	Cat#G7893
Triton X-100	Plusone	Cat#17-1315-01
DL-Dithiothreitol	Sigma-Aldrich	Cat#D0632
TWEEN® 20	Sigma-Aldrich	Cat#P9416
Nonidet P-40 Substitute	Amresco	Cat#E109
Magnesium chloride	Sigma-Aldrich	Cat#M4880
2-Mercaptoethanol	Sigma-Aldrich	Cat#M3148
o-nitrophenyl-β-D-galactopyranoside (ONPG)	Thermo Scientific	Cat#34055
Poly-D-lysine hydrobromide	Sigma-Aldrich	Cat#P64607
Dimethyl sulfoxide (DMSO)	Sigma-Aldrich	Cat#D8418
KpnI-HF	New England Biolabs	Cat#R3142L
AflIII	New England Biolabs	Cat#R0541S
AatII	New England Biolabs	Cat#R0117S
BbsI	New England Biolabs	Cat#R0539S
T4 DNA ligase	New England Biolabs	Cat#M0202S
Critical commercial assays
Cell count kit-8	Dojindo	Cat#CK04
KOD-Multi&Epi	TOYOBO	Cat#KME-101
NEBuilder HiFi DNA Assembly Master Mix	New England Biolabs	Cat#E2621L
In-Fusion HD Cloning Kit	Takara	Cat#639649
QIAquick PCR Purification Kit	QIAGEN	Cat#28106
ReliaPrep gDNA Tissue Miniprep System	Promega	Cat#A2051
Experimental models: Cell lines
HEK293T	ATCC	CRL-3219 RRID:CVCL_0063
Oligonucleotides
LA fragment PCR forward primer 5′-CGGTACCCGGGGATCGGCAAG CTTGGAGCCGACAG-3′	This paper	N/A
LA fragment PCR reverse primer 5′-AAAACGACCTCCATGGCCGG -3′	This paper	N/A
LacZ fragment PCR forward primer 5′-CATGGAGGTCGTTTTACAACGTCG-3′	This paper	N/A
LacZ fragment PCR reverse primer 5′-GACGGGGTTTTTTGACACCAGAC -3′	This paper	N/A
RA fragment PCR forward primer 5′-TCAAAAAACCCCGTCCCAGC-3′	This paper	N/A
RA fragment PCR reverse primer 5′-CGACTCTAGAGGATCCAACTTGTC CCTGATACCCC-3′	This paper	N/A
LMNA sgRNA forward oligo 5′-CACCCCATGGAGACCCCGTCCCAG-3′	This paper	N/A
LMNA sgRNA reverse oligo 5′-AAACCTGGGACGGGGTCTCCATGG-3′	This paper	N/A
Recombinant DNA
pX330-U6-Chimeric_BB-CBh-hSpCas9	Addgene	Cat#42230, RRID:Addgene_42230
pUC19 plasmid is included as a component of the DH5α chemically competent E. coli kit	Enzynomics	Cat#CP011 RRID:Addgene_50005
Software and algorithms
Prism 8	GraphPad	https://www.graphpad.com/scientific-software/prism/
SnapGene software	SnapGene	https://www.snapgene.com
Cas-Designer tool	Seoul National University	http://www.rgenome.net/cas-designer/
NEBioCalculator	New England Biolabs	https://nebiocalculator.neb.com/#!/ligation
NEBuilder	New England Biolabs	https://nebuilder.neb.com/#!/
In-Fusion molar ratio calculator	Takara	https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools/in-fusion-molar-ratio-calculator
In-Fusion Cloning Primer Design Tool	Takara	https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools
Other
SpectraMax ID5	Molecular Devices	N/A
NanoDrop One/OneC Microvolume UV-Vis spectrophotometer	Thermo Scientific	Cat#ND-ONEC
Thermo bath	FinePCR	ALB64

Step-by-step method details

This protocol utilizes a homology-directed repair (HDR) assay system in which a LacZ reporter gene is integrated into the endogenous LMNA locus. LMNA is a constitutively expressed gene encoding nuclear lamin proteins, making it an ideal target for quantifying HDR events. Successful HDR-mediated insertion of LacZ results in the expression of β-galactosidase, which can be detected by a colorimetric assay. This system allows simultaneous assessment of HDR efficiency and cell viability after chemical treatments, thereby enabling high-throughput screening for HDR-enhancing compounds.

Cell seeding for HTS screening (day 1)

Timing: 1–2 h

A sufficient number of cells should be prepared by predicting the number of cells required for the experiment in advance. Cells were maintained and cultured as mentioned above (step 9–10 in preparation of HEK293T cells section).

• 1.Design plates for HTS experiments. Leave the first column of each plate unseeded to measure the blank solution’s absorbance. Seed three separate plates for three independent HTS experiments, as illustrated in Figure 3A.

Note: Use the plates on which cells are seeded as the assay plates.

• 2.Seed HEK293T cells in 96-well PDL-coated plates at a density of 2 × 10⁴ cells/well in 100 μL medium.

Note: The seeding density is optimized to achieve approximately 70% confluency on the subsequent day. Nevertheless, cell confluency and growth rates are influenced by laboratory-specific conditions. Consequently, it is imperative to optimize the seeding concentration according to the unique conditions of each laboratory prior to conducting HTS experiments.

Note: This protocol can be adapted for use with 384-well plates. When scaling down, it is important to adjust cell numbers and reagent volumes proportionally, and to use precise pipetting to minimize variability and edge effects.

• 3.Add 1–2 mL of autoclaved DW to the reservoir at the edge of the 96-well plates.

CRITICAL: Despite maintained humidity in the CO₂ incubator, edge wells can experience media evaporation. Uneven media levels can lead to inaccurate OD readings. Adding water to the plate's edge mitigates evaporation, ensuring data accuracy.

• 4.Incubate the plates at 37°C and 5% CO₂ incubator for 24 h.

Figure 3.

Flow chart depicting the experimental procedure used in high-throughput screening (HTS)

(A) Cell seeding for HTS screening.

(B) Transfection and drug treatment.

(C) Detecting cell viability.

(D) Detecting HDR efficiency.

Dilution of chemical library (day 2)

Timing: 1–2 h

This protocol describes a method for preparing a chemical library. It details procedures for diluting chemicals into 96-well plates, facilitating efficient and organized treatment of a large number of compounds (Figure 4).

• 5.Remove the chemical library from the deep freezer (−80°C).

Note: Chemical libraries are typically dispensed into 96-well plates. It is recommended to confirm the dispensed location and seed cells in accordance with the chemical's position within the plate.

Note: Chemical libraries from the Korea Chemical Bank (www.chembank.org) are typically provided in 96-well plates with the first and second columns left empty. These vacant columns afford researchers the latitude to design flexible experimental setups, accommodating positive, vehicle, no-treatment, or no-cell controls.

• 6.To facilitate chemical thawing, incubate the chemical library at 20°C–25°C for a duration of 30–60 min.

CRITICAL: Chemicals are typically thawed at 20°C–30°C by simply placing them on the lab bench. However, pay close attention to ensure the chemicals are fully melted, as DMSO solutions can freeze at 18°C–19°C. Verify your lab's ambient temperature for complete thawing.

• 7.Prepare 96-well plates for chemical dilution.

Note: Sterile V-bottom plates are recommended for compound dilutions to ensure accurate aspiration of small chemical volumes during treatment.

• 8.Prepare 10 μL of a 100× stock solution of chemicals using DMSO as the diluent, and mix thoroughly by pipetting up and down several times.

Note: Chemical libraries from the Korea Chemical Bank (www.chembank.org) are typically provided at a 5 mM concentration. For initial screening, concentrations between 1–10 μM are generally used, though the optimal concentration depends on the experiment's purpose. A 100× stock solution was prepared by combining 1 μL of each chemical with 9 μL of DMSO, resulting in a 500 μM stock.

• 9.Add 90 μL of cell culture media to 10 μL of 100× stock solution to prepare 100 μL of a 10× working solution, and mix thoroughly by pipetting up and down several times.

Note: Certain chemicals exhibit limited solubility in cell culture medium when present at elevated concentrations. In these instances, a sequential dilution methodology is required, comprising an initial dilution in DMSO and subsequent dilution in cell culture medium. Consequently, serial dilution is recommended.

• 10.Dilute DMSO control as described in step 8–9 at all plates on all plates containing diluted chemicals. The inclusion of diluted DMSO in all chemical plates facilitates treatment and reduces the potential for confusion.

CRITICAL: All assay plates must include an individual experimental negative control, such as a DMSO vehicle control. As cell-seeded plates are used as assay plates, individual controls are necessary to normalize and evaluate the O.D. of each plate.

Figure 4.

Serial dilution of chemical library in 96-well plates

Preparation of transfection (day 2)

Timing: 1–2 h

This protocol describes a method for preparing a transfection mixture. It details procedures for thawing DNA plasmids and preparing the transfection mixture (Figure 3).

• 11.Remove the DNA plasmids from −20°C refrigerator.
• 12.Thaw the DNA plasmids at 15°C–25°C.

CRITICAL: Repeated freeze-thaw cycles of DNA plasmids reduce plasmid activity. Aliquoting after DNA purification is recommended.

Note: To thaw samples more quickly, use a 15°C–25°C water bath rather than leaving them at ambient lab temperature.

• 13.Assess DNA plasmids purity and concentration using a NanoDrop spectrophotometer.

CRITICAL: For best results in your transfection experiments, make sure your DNA plasmid is pure. Check the 260/280 ratio with a NanoDrop; it should be between 1.80 and 2.00.

• 14.
  Prepare transfection mixture.

  • a.
    Combine DNA, P3000, and Opti-MEM. Incubate for 5 min at ambient temperature (15°C–30°C).

    CRITICAL: To minimize variability, prepare a single transfection mixture by scaling up the reagent volumes according to the number of wells, and evenly dispense the mixture across all wells.

  • b.
    Combine Lipofectamine 3000, and Opti-MEM. Incubate for 5 min at ambient temperature (15°C–30°C).
  • c.
    Add mixture a to mixture b. Incubate for 10–20 min at ambient temperature (15°C–30°C).

    Note: For the purpose of ensuring consistency and minimizing variability, it is advisable to prepare a master mix of the transfection mixture. Determine the reagent volumes for the master mix by multiplying the reagent volume per well by the total number of experimental groups.

    Note: In this system, a donor plasmid containing the LacZ gene flanked by homology arms targeting the LMNA locus is prepared. The Cas9-gRNA complex induces a double-strand break at the LMNA gene. Successful repair by HDR results in insertion of the LacZ sequence into the LMNA locus. Expression of LacZ can be detected by a colorimetric β-galactosidase assay, providing a quantitative readout for HDR efficiency.

    DNA+p3000 mixture (amount/well in 96-well format): Cas9, sgRNA, and donor Experimental group

    Reagents	Amount
    Cas9 DNA	0.3 μg
    sgRNA DNA	0.3 μg
    Donor DNA	0.3 μg
    P3000	1.8 μL
    Opti-MEM	5 μL

    DNA+p3000 mixture (amount/well in 96-well format): Cas, sgRNA mix control group (No donor control)

    Reagents	Amount
    Cas9 DNA	0.3 μg
    sgRNA DNA	0.3 μg
    pUC19 DNA	0.3 μg
    P3000	1.8 μL
    Opti-MEM	5 μL

    DNA+p3000 mixture (amount/well in 96-well format): Donor only control group

    Reagents	Amount
    pUC19 DNA	0.9 μg
    P3000	1.8 μL
    Opti-MEM	5 μL

    Lipofectamine 3000 mixture (amount/well in 96-well format)

    Reagents	Amount
    Lipofectamine 3000	1.8 μL
    Opti-MEM	5 μL

Administration of transfection mixture and chemical compounds (day 2)

Timing: 1–2 h

This protocol describes a method for treating cells with a transfection mixture and chemical compounds.

• 15.Remove the cells from the CO₂ incubator.
• 16.Label the plates with appropriate information.
• 17.
  Transfection to the cells.

  • a.
    Aspirate 14 μL of transfection mixture and sequentially dispense 14 μL/well to cells according to the experimental plate design (Figure 3B).

Note: For efficient and confusion-free dispensing of transfection mixture, an electronic multichannel pipette with multi-dispensing capabilities, like the Sartorius Picus pipette, is highly recommended. Multichannel pipettes are suitable for use when the solution is contained within a reservoir, 8-strip PCR tubes, or 96-well plates.

• 18.
  Chemical treatment to the cells (Figure 3B).

  • a.
    Aspirate 10× diluted chemicals and sequentially dispense 12.7 μL/well to three independent plates.

Note: For precise treatment concentration, dispense 12.7 μL to each well. Cells are incubated with a treatment solution comprising 100 μL of cell media and 14 μL of transfection mixture, with 12.7 μL of this solution added to each well.

Note: An electronic multichannel pipette with multi-dispensing capabilities, such as the Sartorius Picus pipette, is recommended to minimize confusion during dispensing.

• 19.Incubate the treated-cells in a CO₂ incubator for 72 hr.

Note: Excessive cell density does not guarantee a direct correlation between OD and cell counts in a CCK8 assay. Ensure the seeding density is optimized to achieve a distinguishable OD range in the CCK8 assay after 72 h before conducting a full-scale screening experiment.

Detecting cell viability (day 5)

Timing: 1–2 h

This protocol describes a method for detecting cell viability. Using CCK8 reagents, the number of viable cells is determined by a color change in the media (Figure 3C).

• 20.Remove the cells from the CO₂ incubator.
• 21.Add 10× CCK8 reagents to all cells.
• 22.Prepare a 1× CCK8 solution by mixing complete medium and 10× CCK8 reagent at a 9:1 ratio.
• 23.Dispense the CCK8 solution into empty wells in triplicate, ensuring that the volume per well is equivalent to that of the cell-containing wells to maintain uniform liquid heights.

Note: Media and CCK8 samples without cells should be included. These samples, which represent background color, are used to normalize cell viability values.

• 24.Centrifuge at 200 × g for 1–3 min to remove bubbles.

CRITICAL: Bubbles interfere with the direct correlation between OD and cell counts in a CCK8 assay. If bubbles persist after centrifugation, centrifuge again until they are completely removed.

• 25.Incubate in a CO₂ incubator for 10–60 min.

CRITICAL: The chromogenic reaction in the CCK8 assay is robust. Frequent monitoring of the reaction following the addition of the CCK8 reagent is recommended. To maintain a direct correlation between OD and cell counts, it is imperative to avoid OD values surpassing the range of 0.8 to 1.0.

• 26.Measure the absorbance of the entire plates at 450 nm using a microplate reader.
• 27.Aspirate the total solution and wash with 1× PBS. Remove the PBS completely.

Pause point: (optional): Samples can be stored at −80°C. Wrap the plates with foil or parafilm, and freeze them with the cell-seeded bottom facing upward.

Detecting LacZ insertion (HDR efficiency) via β-galactosidase assay (day 5)

Timing: 3–4 h

This protocol describes a method for the determination of HDR efficiency. Employing a β-galactosidase assay, the presence of LacZ insertion resulting from HDR repair is quantified by a colorimetric change in the cell lysate (Figure 3D). After performing the CCK8 assay, the plates are washed with PBS, and cell lysis and LacZ detection are subsequently performed in the same plates.

• 28.Prepare 1× beta-galactosidase lysis buffer by diluting the stock solution with pre-chilled DW. Add DL-dithiothreitol (DTT) freshly to the 1× beta-galactosidase lysis buffer at a final concentration of 2 mM just before use.

1× beta-galactosidase lysis buffer

Reagents	Final concentration	Amount
5× beta-galactosidase lysis buffer	1×	10 mL
1 M DL-dithiothreitol (DTT)	2 mM	100 μL
Pre-chilled DW	N/A	Up to 50 mL

Keep the solution on ice until use. We recommend preparing 1× beta-galactosidase lysis buffer just before use.

• 29.Add 50 μL of 1× beta-galactosidase lysis buffer to the plates.
• 30.Vortex plates at 4°C for 1 h to ensure complete lysis.

Note: A multi-vortexer can be used for this step.

• 31.Add 50 μL of beta-galactosidase solution.
• 32.Centrifuge at 200 × g for 1–3 min to remove bubbles.

CRITICAL: Bubbles interfere with the direct correlation between OD and LacZ insertion in a beta-galactosidase assay. If bubbles persist after centrifugation, centrifuge again until they are completely removed.

• 33.Incubate in a 37°C incubator for 1–2 h.
• 34.Measure the absorbance of the entire plates at 420 nm using a microplate reader.

Analysis of data

Timing: 6 h to several days

This protocol describes a method for the analyzing of HDR efficiency.

• 35.
  Calculate cell viability (%). CCK8 Absorbance: A_CCK8

  • a.
    Calculate the average A value of blank samples (step 22) for each 96-well plates: A_blank
  • b.
    Calculate the average of A value of vehicle (DMSO)-treated samples: A_vehicle
  • c.
    Subtract the average A_blank value from the A value of all samples: Normalized A_CCK8

$$Cellviability(\%)=\frac{A_{CCK8}-A_{blank}}{A_{vehicle}-A_{blank}}\times 100$$

CRITICAL: Make sure your blank and vehicle samples are on the same plate as your experimental samples. When processing numerous plates, incubation and detection times may vary. Therefore, it is crucial to keep controls and samples on the same plate and analyze values from that plate for accuracy.

• 36.
  Calculate beta-galactosidase activity. Absorbance of beta-galactosidase assay: A_gal

  • a.
    Calculate the average A value of donor only samples for each 96-well plates: A_{donor only}
  • b.
    Subtract the average A_{donor only} value from the A value of all samples: Normalized A_gal

Normalized A_gal= A_gal - A_{donor only}

• 37.
  Calculate HDR efficiency.

  • a.
    Divide Normalized A_gal to each normalized A_CCK8

    $$HDRefficiency=\frac{{NormalizedA}_{gal}}{{NormalizedA}_{CCK8}}$$

    Note: It is acceptable to divide by cell viability (%).

  • b.
    Calculate the fold activation by dividing HDR efficiency values from chemical-treated samples by the average of DMSO-treated samples.

    $$Foldactivation\left(HDRefficiency\right)=\frac{HDRefficiencyofeachsample}{HDRefficiencyofDMSO}$$
• 38.Organize the viability values and HDR fold activation for each chemical in an Excel spreadsheet.
• 39.Calculate the mean and standard deviation (SD) of the triplicate results.
• 40.
  Select hit compounds (Figure 5).

  • a.
    Determine the parameters for HIT selection criteria.

CRITICAL: Selection criteria are dependent on the experimental purpose and the range of results. Establish criteria after evaluating various options. The criteria presented below are informed by our testing procedures.

Note: The Following are the criteria we establish for screening.

Figure 5.

Criteria for hit compound selection

First criteria: Compounds with cell viability of 60% or greater were selected.

Results: 2,367 compounds were selected from a total of 2,485 chemicals.

Second criteria: Compounds demonstrating at least a 1.5-fold increase in HDR efficiency across all three independent biological replicates were classified as active for HDR enhancement.

Results: 52 compounds were selected from a total of 2,367 chemicals.

Third criteria: Compounds exhibiting an average HDR efficiency increase of at least 3-fold.

Results: 19 compounds were selected from a total of 52 chemicals.

These 19 compounds were grouped based on target similarity and are subject to individual validation experiments to confirm their efficacy. The final HIT compounds were selected based on the results of these validation experiments.

Expected outcomes

This protocol describes a β-galactosidase assay for measuring HDR efficiency. Following this protocol, researchers should expect to observe a colorimetric change in the cell lysate if HDR has successfully inserted the LacZ gene. The intensity of the color change will correlate with the level of HDR efficiency. The expected data output from this protocol is a set of absorbance values measured at 450 nm. These values will then be used to calculate HDR efficiency. In sgRNA+Cas9 samples (without donor), a minimal color change/absorbance value should be observed. In samples where HDR is successful, a much greater color change/absorbance value will be seen.

The expected outcomes after performing the assay are as follows: Chemicals exhibiting cell viability above 60% will be indicated by green dots (Figure 6A), chemicals with high HDR efficiency will be indicated by blue dots (Figure 6B), and hit compounds, selected based on criteria of at least a 3-fold increase in average HDR efficiency and at least 60% cell viability, will be indicated by red dots (Figure 6C).

Figure 6.

Expected outcome of HTS screening to identify HDR-enhancing chemicals

(A) Average of cell viability. Chemicals exhibiting cell viability exceeding 60% are denoted by green dots.

(B) Average HDR fold-change compared to DMSO control. Chemicals demonstrating high HDR efficiency (above 3-fold) are denoted by blue dots.

(C) Hit compounds, represented by red dots, are selected based on the criteria of a minimum 3-fold increase in average HDR efficiency and a minimum 60% cell viability.

Limitations

In this protocol, we have described methods for high-throughput screening using HEK293T cells. We tried similar experiments in various cell lines, such as U2OS and MDA-MB-231 cell line, but the transfection efficiency was consistently too low to identify candidates with potent efficacy. This low transfection efficiency resulted in a high rate of false negatives, making it difficult to obtain reliable results. As simultaneous transfection of three factors, including Cas9, sgRNA, and donor plasmids, into a single cell is needed, high transfection efficiency is necessary to obtain reliable results. If researchers want to proceed with this protocol in other cell lines, new methods for guaranteeing high transfection efficiency, such as electroporation or other delivery systems, will be required. Factors such as the quality of transfection reagents and the specific settings of electroporation devices can significantly impact transfection efficiency.

Troubleshooting

Problem 1

Low transfection efficiency (Step 11–14, 17).

Potential solution

Conduct experiment in early passage after cell thawing.

Purify the DNA plasmid immediately before use.

Problem 2

Chemical precipitation may occur after thawing the original stock solution or after diluting the chemicals in cell culture media (Step 5–10).

Potential solution

After determining the character of the compound, such as its solubility and thermal stability, it is warmed or the solution is sonicated to dissolve it. Care should be taken to avoid overheating or excessive sonication, which could degrade the compound.

Problem 3

Chemical color interference with the experimental color change (Step 28–33).

Potential solution

Certain chemical compounds may inherently possess color that interferes with the colorimetric readout of this assay, leading to unreliable data. In such cases, alternative assays that do not rely on colorimetric detection, such as an EGFP insertion assay, could be considered. If colorimetric detection is essential, consider using a compound at a lower concentration, or finding a chemical analog that does not have color interference.

Problem 4

Difficulty managing numerous samples (Step 1–33).

Potential solution

We strongly recommend using an electronic multichannel pipette with multi-dispensing capabilities. This minimizes human error that can occur with repeated manual pipetting.

Problem 5

Background colorimetric change in donor-only transfected cells, likely due to nonspecific integration (Step 28–33).

Potential solution

Nonspecific integration into arbitrary genes with open chromatin structures causes color change in the LacZ donor-only transfected group, even though the donor plasmid lacks promoter sequences. Therefore, to eliminate background signals, full-length reporter genes should not be used as donor DNA. To completely eliminate background signals, we generated an HEK293T-split GFP cell line.² This cell line activates EGFP signals only upon precise integration of the C-terminal EGFP sequence, effectively eliminating nonspecific EGFP signals.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Hye Jin Nam (hjnam@krict.re.kr).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Hye Jin Nam (hjnam@krict.re.kr).

Materials availability

This protocol did not generate new unique materials or reagents.

Data and code availability

This protocol did not generate original data or code.

Acknowledgments

This work was supported by a grant from the Korea Research Institute of Chemical Technology (Project number KK2531-10) to H.J.N. and the National Research Council of Science & Technology (NST) grant by the Korea government (MSIT) (no. GTL24021-000) to H.J.N.

Author contributions

M.J.J. was responsible for data visualization, reagent organization, and the writing of the manuscript. H.J.N. was responsible for conducting the experiments, data analysis and compilation, conceptualization, funding acquisition, manuscript writing, and review.

Declaration of interests

H.J.N. has filed a patent application based on this work.