COL10A1-related metaphyseal dysplasia Schmid caused by the p.L644F variant in the COL10A1 gene

Highlights

● A novel missense variant, p.L644F, in the NC1 domain of COL10A1 was identified.

● The variant caused COL10A1-related Schmid metaphyseal dysplasia.

Introduction

Metaphyseal dysplasia, Schmid (MCS), COL10A1-related, is a new nomenclature revised by the Nosology Committee of the International Skeletal Dysplasia Society (1). Previously, the condition was referred to as metaphyseal chondrodysplasia, Schmid type (OMIM #156500). MCS is a rare autosomal dominant manifestation of skeletal dysplasia, characterized by short stature, genu varum, and an abnormal metaphysis (1). De novo variants are reported in 38% of the cases (2). The condition is caused by variants of the COL10A1 gene, which encodes the collagen type X alpha 1 chain (2, 3).

Case Report

A 2-yr-old boy was referred to our hospital for further evaluation of metaphyseal dysplasia due to the presence of genu varum, and radiographic findings of flaring and cupping in the long bones, including the radius, ulna, metacarpals, phalanxes, fibula, tibia, and femur, despite unaltered alkaline phosphatase levels. He was born at 40 wk of gestation with a body length of 51.0 cm (0.90 SD), a birth weight of 3,400 g (0.90 SD), and a head circumference of 34.0 cm (1.24 SD). His medical history included febrile convulsions, but no bone fractures. He stood with support at 11 mo of age, walked at 1 and 7 mo, and spoke in two-word phrases at 2 yr of age. His father and mother were 168 cm (–0.63 SD) and 158 cm (–0.04 SD) tall, respectively. There was no family history of bone fractures or bone diseases.

Physical examination revealed a short stature (height: 78.1 cm [–2.65 SD]). The patient weighed 11.9 kg (0.18 SD) and the head circumference was 52.0 cm (2.13 SD). Moreover, frontal bossing, blue sclera, genu varum, and waddling gait were observed. Postnatal growth retardation and widening of the head circumference were also noted (Supplementary Fig. 1). Blood test results were all within normal ranges (Supplementary Table 1). Radiographic findings of the bilateral knee and left ankle joints showed irregularity at the distal end of the long canal diaphysis. Translucent and sclerotic bones were observed. The femur and tibia were bent, resulting in genu varum (Figs. 1A and 1 B). No internal hips or spherical femoral heads are observed in the pelvic region. The proximal femur showed abnormal widening, sclerotic changes, and irregularities in the metaphyseal region (Fig. 1C). Irregularity and widening of the metaphysis were observed at the distal end of the radius, ulna, and metacarpals, as well as at the proximal end of the proximal phalanxes, although these changes were milder than those observed in the lower legs (Fig. 1D). Radiographs of the vertebrae were unremarkable (Fig. 1E). Similarly, the skull was normal, apart from the suggestive frontal bossing (Fig. 1F). Based on the above findings, the clinical diagnosis of MCS was established.

Fig. 1.

The patient’s radiographs. (A) Right lower limb and (B) left lower limb: The femur and tibia are bending, resulting in genu varum. Irregularity, sclerosis, and widening of metaphysis are evident. (C) Hip: Irregularity, sclerosis, and widening of metaphysis are evident in the proximal femur. (D) Right hand (projection from palmar to dorsal): Irregularity and widening of metaphysis are evident in the distal end of the radius, ulna, and metacarpals, as well as in the proximal end of the proximal phalanxes. (E) Vertebrae: Unremarkable. (F) Skull: Suggestive frontal bossing.

Genetic Analysis

Written informed consent for genetic analysis and publication of case reports was obtained from the patient’s parents. All procedures were reviewed and approved by the Ethics Committee of the Ohta General Hospital Foundation, Ohta Nishinouchi Hospital (approval no. LE116-1). Genetic testing was performed at the Kazusa DNA Research Institute (Chiba, Japan), an ISO 15189-certified registered clinical laboratory.

Next-generation sequencing of the protein-coding region exons of COL10A1, COL11A1, COL11A2, COL2A1, COL3A1, COL9A1, COL9A2, COL9A3, COMP, MATN3, and SLC26A2 and their both ends identified a thymine-to-cytosine substitution at position 1930 (c.1930 C>T) in the COL10A1 gene (Fig. 2). This variant results in an amino acid change from leucine to phenylalanine at position 644 (p.L644F) of the collagen type X alpha1 chain. Sanger sequencing of this locus in both parents revealed no pathogenic variants, including the variant identified in the son, thereby supporting the presence of a de novo variant. The following primer pair was used: AAAGAGGAGTGGACATACTCAGAGG (forward), and GACTGGAATCTTTACTTGTCAGATACCA (reverse) (Supplementary Fig. 2).

Fig. 2.

Next-generation sequencing for COL10A1. In a snapshot from the Integrated Genome Viewer (https://igv.org/), the COL10A1 gene is displayed at position 116,120,186 on chromosome 6. According to the reference GRCh38/hg38, the wild type at this position was G. A G to A substitution was detected in 48% of the 433 reads from the patient. This change indicated that the patient was heterozygous for the wild type and this variant (c.1930C>T, p.L644F).

Discussion

The p.L644F variant identified in this case was registered in ClinVar as a variant of “uncertain significance,” although it was not registered in Genome AD. The clinical significance of this variant was evaluated according to the American College of Medical Genetics and Genomics (ACMG) criteria (4). The p.L644F variant was presumed to be de novo, based on Sanger sequencing of the unaffected parents, fulfilling the criteria for strong evidence of pathogenicity (PS2) (Supplementary Fig. 2). This variant is located in the carboxyl-terminal non-collagenous (NC1) domain of the COL10A1 gene, a region where pathological variants associated with MCSs are prevalent. Wu et al. highlighted that the hydrophobic interface residues of the NC1 domain are involved in tightly packed homotrimer formation in COL10A1, suggesting that variants of the NC1 domain disrupt the stable assembly of X-type collagen (2). This fulfilled the criteria for moderate evidence of pathogenicity (PM1). Bonaventure et al. reported a missense variant (p.L644R) of COL10A1 at the same residue identified in our case (3), fulfilling the criteria for moderate evidence of pathogenicity (PM5). The phenotype of the patient was highly specific for COL10A1-related MCS, fulfilling the criteria for supporting evidence of pathogenicity (PP4). Furthermore, in silico analysis using PolyPhen-2 and AlphaMissense Pathogenicity Heatmap revealed “possibly damaging” with a score of 1.000 and “possibly pathogenic” with a score of 0.570, respectively. This fulfilled the criteria for supporting evidence of pathogenicity (PP5). In summary, the variant is classified to be “pathogenic” based on the presence of three PMs, namely, PS2, PM1, PM5, PP4, and PP5 of the ACMG guidelines.

Previous MCS cases have not reported blue sclera as a feature. Considering that type X collagen is not present in the eye (5), we considered the blue sclera observed in this case to be unrelated to MCS.

We identified a de novo COL10A1 variant (p.L644F) associated with MCS. According to the ACMG criteria, this variant is classified as “pathogenic”.

Conflict of interests

The authors declare no conflicts of interest.