Abstract
The balance of the vaginal ecosystem results from synergistic interactions established between the different colonizing microorganisms. Lactobacillus spp. stands out as a predominant member, acting a crucial protective role in maintaining vaginal health. As vulvovaginal candidiasis remains prevalent and antifungal resistance grows, there is a pressing need for alternative therapies. However, any development of new therapies must carefully consider their impact on naturally colonizing species, particularly Lactobacillus spp., believed to be crucial in preserving vaginal homeostasis. This underscores the importance of assessing the protective effect of the oil on Lactobacillus spp. when exploring alternative therapies. This study evaluates the effect of the vapor phase of white thyme essential oil (VP-WTEO), on Candida albicans biofilm formation and on co-colonization of a reconstituted human vaginal epithelium (RHVE), with a specific emphasis on its effect on Lactobacillus gasseri. The VP-WTEO effect on both species was evaluated by DNA quantification and by microscopy, while the effect on the RHVE was assessed by the determination of lactate dehydrogenase activity. The results revealed that the VP-WTEO had a significant inhibitory effect on C. albicans biofilm formation and induced a significant reduction in their mature biofilms. Furthermore, it was observed a significant reduction in the number of C. albicans cells colonizing the RHVE without any alteration on the number of cells of L. gasseri in the presence of the VP-WTEO. This study suggests that the VP-WTEO could be a promising solution to treat and prevent VVC, being a safe alternative for the remaining vaginal microbiota.
Keywords: Vulvovaginal candidiasis, Lactobacillus species, Candida species, Biofilm, Vaginal microbiota
Introduction
The balance of the vaginal ecosystem results from synergy and complex interactions between the host and the diverse microorganisms present in the microbiome that colonizes the vaginal mucosa [1]. The vaginal microbiota includes a wide range of beneficial microorganisms, predominantly constituted by the Lactobacillus spp. Such beneficial bacteria include Lactobacillus crispatus, L. jensenii, L. iners and L. gasseri, that coexist with the human host in mutualism, with the host providing nutrients and the bacteria protecting the vaginal environment from the colonization of pathogenic microorganisms [2]. Indeed, Lactobacillus spp. play a key protective role in preventing gynecological diseases [3]. Vulvovaginal candidiasis (VVC) is a prevalent infection of the vaginal mucosa caused by Candida spp [4]. Notably, Lactobacillus spp. were reported to inhibit various virulence traits of Candida spp. including their adherence to epithelial cells, thereby suppressing the possible attachment of fungal cells [5]. In addition, these bacterial cells secrete biosurfactants and release hydrogen peroxide and lactic acid that inhibit the growth of Candida spp. and the formation of invasive hyphae [5].
Similarly to Lactobacillus spp., Candida spp. are also present in the vaginal microbiota as a commensal microorganism, however, certain factors such as broad-spectrum antibiotics, pregnancy, immunosuppression or contraceptives can lead to their transition to a pathogenic microorganism [4]. Candida albicans is the most frequent species responsible for VVC [6]. This infectious disease is often treated with antifungal drugs, especially azoles. However, these agents are fungistatic and cells exposed repeatedly to these antifungals can lead to fungal adaptation and consequent resistance [1, 7]. Thus, the increase in drug resistance, combined with the high incidence of VVC, highlights the need to develop new therapeutic approaches, more effective, without the risk of inducing resistance, for the prevention and treatment of this gynecological infection. However, it is imperative that the development of these new therapies does not disrupt the vaginal microbial homeostasis, in particular the naturally colonizing Lactobacillus spp.
Thus, the present study aims to evaluate the effect induced by a previously developed therapy in the vaginal species L. gasseri, and also on C. albicans. This therapy consists of exposure to the vapor phase of white thyme essential oils (VP-WTEOs), following evaluation the toxicity of this therapy in a toxicological model of Galleria mellonella larvae. Previous work has demonstrated that VP-EOs exhibit strong antifungal activity against drug-resistant Candida spp. thus emerging as an interesting alternative for VVC treatment [8, 9]. Furthermore, after exposure to VP-EO, significant inhibition of biofilm formation and the ability to destroy mature biofilms of drug-resistant vaginal Candida isolates was observed [8]. Additionally, previous studies demonstrate that WTEO is highly effective in inhibiting planktonic growth and completely preventing biofilm formation of the multi-resistant species Candida auris [10, 11]. In contrast to previous investigations, the present study extends these findings by evaluating the potential impact of VP-WTEO therapy on beneficial Lactobacillus spp., which are fundamental for the maintenance of vaginal homeostasis. This assessment of selectivity is crucial, as it ensures that the antifungal activity of VP-WTEO does not compromise the integrity of the protective vaginal microbiota. By incorporating this dimension into the analysis, our study provides a more comprehensive evaluation of the therapeutic potential and safety profile of VP-WTEO, thereby contributing novel and clinically relevant insights into its application for the management of VVC.
Materials and methods
Microorganisms and culture conditions
In this study, three clinical isolates of C. albicans resistant to one of the antifungal agents (fluconazole, ketoconazole and caspofungin) belonging to a collection of yeasts created by the Candida Research Group of the Centre of Biological Engineering of University of Minho [6], and a reference strain of Lactobacillus gasseri ATCC 33323 (acquired from DSMZ), were used. The Candida isolates and L. gasseri were kept in Sabouraud Dextrose Broth (SDB; Liofilchem, Italy) and in De Man, Rogosa and Sharpe broth (MRS, Liofilchem), respectively, both with 20% v/v) glycerol (Biochem Chemopharma, France), at −80 ± 2 °C. These species were sub-cultured from the frozen stock onto Sabouraud Dextrose Agar (SDA; Liofilchem) (Candida isolates) and MRS agar (L. gasseri) plates and incubated for 24 h at 37 °C, L. gasseri was incubated in a 5% O2 environment in saturated humidity. Before the test, the pre-inoculum of C. albicans was prepared in SDB with colonies grown on SDA plates (18 h at 37 °C and under agitation at 120 rev/min) and L. gasseri was pre-cultured in MRSB twice with 1% vol/vol) taken directly from the cryovial (24 h at 37 °C in an environment of 5% O2 in saturated humidity). So, the cellular suspensions were centrifuged and washed twice with Phosphate Buffered Saline (PBS) (5000 g for 10 min, at 4 °C).
The experiments in this study were conducted using synthetic vaginal fluid (SVF). The composition of SVF included 58 mM NaCl (Biochem Chemopharma, France), 33 mM glucose (Biochem), 18 mM KOH (AppliChem), 2 mM Ca(OH)2 (Frilabo), 1.75 mM glycerol (Biochem), 6.7 g yeast nitrogen base (YNB) l−1 (Difco), 6.7 mM urea (Frilabo) and acetic acid (17 mM; pKa 4.76) and lactic acid (22 mM; pKa 3.85) were added to maintain the pH at 4.2, following the method described by Fernandes et al. [9].
Essential oils
The antifungal activity of the vapor phase of white thyme essential oil (Thymus satureiodes; florame®, France) (VP-WTEO) was evaluated. White thyme EO was tested 100% pure and stored in the dark at room temperature. From the analysis carried out by the company florame®, it became known that the major compounds in the white thyme essential oil (WTEO) are borneol (31%), α-terpineol (16%) and carvacrol (9%). For this analysis, the company used Gas Chromatography (GC) with Flame-Ionisation Detection (FID): the hydrogen carrier gas; the polar Elite-WAX column (100% polyethylene glycol) (60 m/0.25 mm/0.25 μm) and the non-polar Elite-5 columns (5% diphenyl, 95% dimethylpolysiloxane) (60 m/0.25 mm/0.25 μm) [11].
Essential oil cytotoxicity
The cytotoxicity of the WTEO was tested using the in vivo Galleria mellonella larvae model [12]. For that, a group of 10 G. mellonella larvae was exposed to VP-WTEO for 72 h. Initially, G. mellonella larvae were raised in the dark at 25 °C, with a diet based on pollen grains. Afterward, the larvae selected according to their development stage, approximately 250 mg, were placed in glass Petri dishes in the presence of the WTEO (25 µL-placed in a glass well), allowing the diffusion of the oil without direct contact with the larvae, in a controlled atmosphere with a volume of 1.5 × 106 cm3. After that, larvae were kept at 37 °C in the dark, without nutrition. As a negative control, a set of larvae was maintained under the same conditions, except for exposure to VP-WTEO. The survival and morphology of the larvae were monitored, and survival curves were constructed, as described by Araújo et al. [12]. In this type of test, larvae are considered dead when they show no movement after touch.
Susceptibility of Candida albicans to white thyme essential oil
The disk diffusion method based on Ju et la [13, 14]. was used to evaluate the effect of WTEO on drug-resistant clinical isolates of C. albicans (Ca1, Ca2, Ca3). These isolates demonstrated resistance to conventional antifungals: C. albicans Ca1 was resistant to caspofungin, C. albicans Ca2 was resistant to fluconazole and ketoconazole, and C. albicans Ca3 was resistant to fluconazole. A reference strain (Candida albicans ATCC 5413) was used as a control. Swabs dipped in the cell solution adjusted to 1 × 108 cells/mL were used to inoculate SDA plates. After the plates were completely dry, 25 µL of the WTEO (100%) was pplied in sterile white disks (Liofilchem®) on the plates. Negative (vegetable oil) and positive (cell suspension) controls were performed. The plates were incubated at 37 °C for 24 h and inhibition zone diameters were measured (mm).
Antifungal activity of vapor phase of white thyme essential oil on biofilms
The effect of the VP-WTEOs on biofilm formation and on mature biofilms (24 h-old) of C. albicans (Ca2) was evaluated. Biofilms were developed as described by Fernandes et al. [8]. in order to allow the diffusion of volatile compounds and their interaction with microorganisms. To determine the effect of VP-WTEO on biofilm formation, 1 mL of Candida cell suspension adjusted to 1 × 105 cells/mL was transferred to a glass well and 25 µL of WTEO (100%)was discarded on a sterile blank disk. The set was kept inside a glass plate and the plates were incubated (24 h at 37 °C, 120 rev/min). Once formed, the biofilms were incubated in the presence of VP-WTEO for another 24 h. As a control, biofilms were formed without exposure to VP-WTEO for 24–48 h.
The VP-WTEO effect on biofilms was analysed by (a) quantification of biofilm biomass by staining with crystal violet (CV) and (b) determination of metabolic activity by XTT reduction assay [15, 16].
Quantification of Candida biomass.
For biomass quantification, biofilms were fixed with 1 mL of methanol, after 15 min was removed and allowed to dry at room temperature. After drying, 1 mL of CV (1%) was added to each well and incubated for 5 min. Then, the biofilms were washed with sterile ultrapure water and completely dry, and afterwards 1 mL of acetic acid (33%) was added. Thus, 200 µL of this solution, from each glass well, was transferred to a microtiter plate and the absorbance of each condition was read at 570 nm in triplicate, using a microtiter plate reader (Thermo Scientific™ Multiskan™ FC, Finland).
-
(b)
Quantification of metabolic activity of Candida cells.
Biofilm metabolic activity was determined by the XTT (2,3-(2-methoxy-4-nitro-5-sulphophenyl)−5-[(phenylamino)carbonyl]−2 H-tetrazolium hydroxide) reduction assay. For this, the culture medium was removed, and biofilms washed with PBS. Then, 200 µL of a solution containing 10 µg/µL of phenazine methosulfate (PMS, Sigma–Aldrich, USA) plus 100 µg/µL of XTT (Sigma–Aldrich) was added to each well and incubated for 3 h at 37 °C (130 rpm) in the dark. Then, as in the previous procedure, 150 µL from each glass well was transferred to a microtiter plate and the colorimetric changes were measured at 490 nm using a microtiter plate reader (HEALES “MB580”, Shenzhen, China).
Effect of vapor phase of white thyme essential oil in colonization of C. albicans and L. gasseri of a reconstituted human vaginal epithelium
The commercial available reconstituted human vaginal epithelium (RHVE) (0.5 cm2; SkinEthic Laboratories, France) was used as a mean to mimic an in vitro model of vaginal candidiasis to study the effect of the VP-WTEO on colonization prompted by C. albicans and/or L. gasseri [17, 18]. For that, RHVE tissue inserts (0.5 cm2) were placed in glass wells. To study single species infection, 4 RHVE tissues were infected with 1 mL of standardized suspension (1 × 10 7cells/mL) of C. albicans or L. gasseri strains separately, prepared as previously described in the SVF.
To prepare the co-culture infection model, C. albicans and L. gasseri suspensions were first prepared at a final concentration of 2 × 10⁷ cells/mL each in SVF. Equal volumes of both suspensions (500 µL of each) were mixed to obtain a total volume of 1 mL containing both microorganisms. Then, 1 mL of this mixed suspension was added to each RHVE tissue insert (0.5 cm²) placed in sterile glass wells. Two RHVE tissues were used for the dual-species infection. To evaluate the effect of VP-WTEO, infected tissues (both single and dual-species) were exposed to 25 µL of WTEO (100%) in a closed glass petri dish. Non-exposed tissues were used as negative controls. All samples were incubated at 37 °C in a humidified 5% CO₂ atmosphere with agitation (120 rpm) for 24 h.
After the incubation, the tissues were washed with PBS to remove non-adherent microorganism’s cells. Subsequently, the tissues were used for (a) histological analysis and for (b) molecular studies. Additionally, the activity of lactate dehydrogenase (LDH) was also evaluated to indirectly assess the damage of microorganisms caused on the epithelium (c) [18].
Histological analysis and microscopic observation.
The part of the RHVE tissue intended for histology processing was initially fixed in 2% (v/v) paraformaldehyde and stored at room temperature. Using standard histological techniques, tissue was embedded in paraffin wax and 20 μm sections were cut and placed on HistoBond + coated microscope slides. Afterwards, the sections were dewaxed by processing through xylene, immersed in ethanol and then in water and stained with the periodic acid Schiff method (staining of keratinocytes and Candida or Lactobacillus cells). Then, the sections were analyzed in bright field using an Olympus BX51 epifluorescence microscope coupled to a DP72 digital camera (Olympus Portugal SA, Portugal) and the images were acquired using Olympus Cell-B software.
-
(b)
Quantification of Candida and Lactobacillus cells in RHVE.
Candida’s and Lactobacillus’ DNA present in tissues under different conditions was extracted using the DNA extraction kit (DNeasy Blood & Tissue Kit, Qiagen). The DNA from each tissue was quantified using the NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific, USA). Both species were quantified using real-time PCR employing a CF X96 real-time PCR system (Bio-Rad, Berkeley, USA). For quantification, a final reaction volume of 10 µL was prepared, consisting of 2 µL of DNA, 5 µL of working concentration SsoFast EvaGreen Supermix, 0.1 µL of each primer (Table 1) and 2.8 µL of H2O. Negative controls were performed, replacing the DNA with nuclease-free water.
Table 1.
Primers for real time-PCR assay for quantification of Candida albicans and Lactobacillus gasseri cells in reconstituted human vaginal epithelium
| Target | Primer | Sequence (5´->3´) |
|---|---|---|
| Candida albicans | Forward | GAGCGTCGTTTCTCCCTCAAACCGCTGG |
| Reverse | GGTGGACGTTACCGCCGCAAGCAATGTT | |
| Lactobacillus gasseri | Forward | AGGCACTAGAAGCCGATGAA |
| Reverse | CACTGCGTCTTCCTTCAACA |
The PCR cycling conditions for the L. gasseri and C. albicans involved of an initial denaturation step at 98 °C (2 min) or 95 °C (3 min), then 40 cycles of denaturation at 98 °C (5 s) or 95 °C (10 s) and primer annealing at 55 °C (5 s) or 55 °C (30 s), respectively. The same PCR protocols were used to construct calibration curves (Ct vs. Log of cells) for both species, obtained from serial dilutions of known cell concentrations, as described by Alves et al. [18, 19]. For C. albicans, suspensions were quantified using a Neubauer haemocytometer prior to DNA extraction, while for L. gasseri, CFUs were determined by plate counting. Ct values obtained from RHVE tissue samples under different colonization conditions were then interpolated into the respective calibration curve to estimate the number of cells per sample. As the DNA was extracted from the entire tissue unit (RHVE), the values were normalized and expressed as Log cells per tissue.
-
(c)
Lactate dehydrogenase (LDH) evaluate.
To measure epithelial cell damage, the CytoTox-ONE Homogeneous Membrane Integrity Assay kit (Promega) was used to determine the release of LDH from the RHVE in the culture medium. LDH activity was analyzed in a spectrophotometer (FLUOstar OPTIMA; BMG Labtech, Ortenberg/Germany) at 560 nm excitation and 590 nm emission. The LDH released during infection or co-infection and treatment with VP-WTEO for both species was expressed as LDH activity in relation to the infected epithelium and the untreated epithelium. Also, the VP-WTEO effect on tissue expressed as LDH activity relative to tissue with SVF (control) was evaluated. All experiments were performed in triplicate.
Statistical analysis
The results were statistically analysed using the Prism software package (GraphPad Software version 8.01). One-way ANOVA or two-way ANOVA was performed, Tukey`s multiple comparison test. Results were expressed as mean ± standard deviation (SD) and the statistical analyses performed were considered significant when p < 0.05.
Results and discussion
Under healthy conditions, the vaginal mucosa is inhabited by several microorganisms, including bacteria and fungi, which normally coexist and interact with each other and the host. However, several factors can disrupt this balance, leading to disease development [2]. In fact, it is well established that a decrease in the vaginal lactobacilii population is associated with the decrease vaginal health. Therefore, it is imperative the development of new therapeutic approaches for vulvovaginal candidiasis (VVC), that do not disrupt or imbalance the remaining microbiota.
According to previous studies, essential oils (EOs) and especially those applied in vapor phase have shown potent antifungal activity against drug-resistant Candida spp [8, 9]. Therefore, it is crucial to understand the impact of this new alternative (VP-EOs) on vaginal Lactobacillus spp as well. As an initial step, the cytotoxicity of vapor phase of white thyme (VP-WTEO) was evaluated.
The Galleria mellonella larvae model is widely used to study the effectiveness of new antimicrobial compounds, immune responses and, in this study, cytotoxicity. In addition to other benefits, this wax model is advantageous for toxicological investigations, given to its functional and structural similarity to the innate immune response in mammals [20]. The in vivo toxicity of VP-WTEO was therefore evaluated from G. mellonella. After 72 h of exposure to VP-WTEO, no evidence of toxicity were observed (Fig. 1). In fact, 100% o the larvae remained alive with no statistically significant differences between the exposed and unexposed groups.
Fig. 1.
Vapor phase of white thyme essential oil (VP-WTEO) toxicity measured in in vivo Galleria mellonella model. Survival curves of G. mellonella larvae exposed to VP-WTEO and respective control (without exposure to VP-WTEO). There was no significant difference between control and VP-WTEO exposure
Then, the antifungal activity of WTEO against planktonic cells of antifungal resistant C. albicans clinical isolates (n = 3) was evaluated through the agar disk diffusion method. Activity was evaluated based on the diameter of the inhibition halos (Dhalo) (Table 2).
Table 2.
Anti-Candida activity of white thyme essential oil on drug-resistant vaginal isolates and in a reference strain. Results obtained from the agar disk diffusion method and zones of Inhibition measured through the diameter of the halo (Dhalo) in millimeters
| Species | Isolate | Dhalo (mm) |
|---|---|---|
| C. albicans | Ca1 | 22.8 ± 0.5 |
| Ca2 | 22.5 ± 1.7 | |
| Ca3 | 24.7 ± 0.6 | |
| ATCC 5413 | 59.7 ± 8.8 |
Analysis of Table 1 shows that WTEO induced a strong inhibitory effect in all clinical isolates, with Dhalo values ranging from 22.5 mm to 24.7 mm. These results are consistent with other studies describing high antifungal activity of WTEO against drug-resistant strains of various Candida spp [21–23]. The anticandidal activity of thyme has been suggested to be related to morphological changes in Candida cells including cell membrane shrinkage, disruption of cell membrane permeability and intracellular material leakage [24, 25].
WTEO is a complex mixture of compounds extracted by steam distillation of flowering tops and is characterized by high concentrations of borneol, α-terpineol and carvacrol. Hammer et al. [26]. observed that compounds like terpinen-4-ol and α-terpineol exhibited the lowest values of minimum inhibitory concentrations (MIC) and minimum fungicidal concentrations (MFC) against Candida spp. were. Indeed, the antimicrobial activity of terpenes, especially at higher concentrations, has been attributed to their interactions with cell membranes and the consequent total loss of homeostasis, leading to severe membrane damage and cell death. At relatively low concentrations, these interactions can result in respiration inhibition and altered membrane permeability [26, 27]. Furthermore, these components also showed relatively rapid fungicidal effects against C. albicans in time-of-kill assays. In addition to this compound, borneol was previously reported to disrupt C. albicans biofilm formation [27].
However, the diffusion method results are only a a preliminary screening of the work, since the EOs effect can differ depending on the direct application or only exposure to the vapor phase. The antifungal activity when applied directly depends on its diffusibility and solubility in the liquid phase, while the activity when only exposed to VP-EOs depends on its volatility [28]. So, the VP-WTEO effect on Candida biofilm formation and on pre-formed biofilms of fluconazole and ketoconazole resistant strain (C. albicans Ca2) was then evaluated. This strain was selected due to its extremely high level of resistance to fluconazole [8]. In this context, some factors were quantified to determine the VP-WTEO effect, such as the number of cultivable cells (data published in previous work [9]), biofilm biomass (Fig. 2A) and the biofilm cell metabolic activity (Fig. 2B).
Fig. 2.
Effect of the vapor phase of white thyme essential oils on the biofilm formation and pre-formed biofilm of antifungal-resistant Candida albicans Ca2. A Biofilm biomass (Abs CV) and B metabolic activity (Abs XTT). * indicate statistical reduction of biofilms cell cultivability in comparison with the respective control (* p < 0.1, ** p < 0.01, *** p < 0.001, **** p < 0.0001)
Previous work demonstrated that VP-WTEO led to the inhibition of biofilm formation and a reduction in mature biofilm of C. albicans Ca2 [9]. Based on these previous findings and on the results of the biomass quantification and the metabolic activity of the biofilm cells, it was observed that the VP-WTEO has an effect against drug resistant C. albicans biofilms. Indeed, the cultivable cells within biofilmsdeveloped in the presence of the VP-WTEO showed a significant reduction, ranging from 1 to 2 orders of magnitude (Log CFU/mL), in comparison to biofilms grown in the absence of VP-WTEO [9]. In terms of biofilm biomass quantification and metabolic activity, the results demonstrated a notable decrease in biofilm formation, with reductions of 56% in biomass (Fig. 2A) and 37% in metabolic activity (Fig. 2B), respectively. This set of results confirms the effectiveness of VP-WTEO mainly in inhibiting biofilm formation. In fact, previous work has reported that the vapor generated by EOs exhibits greater antimicrobial activity compared to the EOs liquid phase when applied by direct contact. Furthermore, a study carried out by Wang et al. [29], demonstrated that the anti-C albicans activity of borneol (a major constituent of WTEO) in the vapor phase was significantly greater than in the liquid phase. The authors observed that sub-MIC concentrations of the liquid phase of borneol reduced germ tube formation of C. albicans ATCC 10,231 by 60% − 99% [29] Germ ube formation and biofilm integrity in Candida spp., particularly in C. albicans, are important virulence factors. The germ tube (filamentous form) allows penetration into deeper layers of the mucosa and confers greater resistance to phagocytosis, facilitating the transition from the state of harmless symbiosis to a pathogen [27]. The fact that EO molecules in the vapor phase exert antifungal effects without requiring direct contact suggests that such EOs can be used in the prevention and treatment of several diseases, such as VVC.
The effect of new antifungal therapies on commensal microbiota is extremely important. Therefore, in this work, a Reconstituted Human Vaginal Epithelium (RHVE) was used and co-colonization by C. albicans and L. gasseri was induced. This procedure aimed to evaluate the effect of the developed therapy (VP-WTEO) on beneficial vaginal microbiota, such as Lactobacillus. For this purpose, the species of L. gasseri was selected due to its predominance in vaginal environments and also because it was recently shown to inhibit growth of C. albicans, both in planktonic cultures and in mixed biofilms, resulting in enhanced loss of yeast cell viability [30–32]. The infection and co-infection of RHVE by C. albicans and L. gasseri and subsequent VP-WTEO treatment were evaluated after 24 h and the results confirm the efficacy of VP-WTEO against the C. albicans colonization (Figs. 3 and 4).
Fig. 3.
Effect of the vapor phase of white thyme essential oil (VP-WTEO) on single and co-colonization of Candida albicans with Lactobacillus gasseri of the reconstituted human vaginal epithelium (RHVE) after 24 h. A Number of cells (Log cells/tissue) in single (C. albicans or L. gasseri) and mixed colonization (C. albicans (quantified species) + L. gasseri or C. albicans + L. gasseri (quantified species)) relative to VP-WTEO-treated RHVE). * indicate statistical reduction of number of cells in comparison with the respective control (*** p < 0.001, **** p < 0.0001). B Relative lactate dehydrogenase (LDH) activity measured in culture supernatants after 24 h of single or mixed colonization in relation to simulated vaginal fluid (&) and VP-WTEO effect (*). */& indicate statistical reduction of LDH activity in comparison with the respective control (*/& p < 0.1, ***p < 0.001)
Fig. 4.
Effect of the vapor phase of white thyme essential oil (VP-WTEO) on single and mixed colonization of Candida albicans (green arrow) and Lactobacillus gasseri (yellow arrow) in reconstituted human vaginal epithelium (RHVE) after 24 h. Image acquired by epifluorescence microscopy. The bar represents 50 μm and 20 μm
The results obtained from the PCR analysis (Fig. 3A) show a significant decrease in Candida cells in both single colonization (p < 0.001) and co-colonization with L. gasseri (p < 0.0001) after VP-WTEO exposure, which is also evident in the RHVE tissue images (Fig. 4). Interestingly, while L. gasseri remains unaffected in co-colonization, it shows increased susceptibility when exposed alone, possibly due to its limited biofilm-forming capacity as previously reported [33], which could make the cells more susceptible to the antimicrobial action of the VP-EO. These findings suggest a selective antifungal effect of VP-WTEO, primarily targeting C. albicans without compromising the beneficial L. gasseri in mixed colonization. Ambrosio et al. observed some EOs display selective antibacterial activity, with Eucalyptus globulus showing greater efficacy against the pathogenic Enterococcus faecalis compared to the beneficial Lactobacillus rhamnosus [34]. This selectivity is critical, as Lactobacillus species are essential components of the vaginal microbiota, contributing to host protection and VVC prevention [30, 35–41]. Previous studies have shown that Lactobacillus spp. enhances antifungal treatments by producing organic acids that increase fungal membrane permeability [36] and biosurfactants with anti-adhesion and anti-biofilm activities [41].
The results obtained from the LDH assays are consistent with the previous findings (Fig. 3B). The LDH assay is widely used to assess the level of damage to the cell plasma membrane. When the plasma membrane is compromised, LDH leaks out into the medium, and its activity can be measured as a marker of cell damage or cytotoxicity [42]. Similar to our previous work with vapor phase of oregano oil (VP-OEO) [43], LDH activity levels revealed no significant effects between VP-WTEO exposure in RHVE compared to control (SFV) (Fig. 3B). This result was corroborated by microscopic image observation (Fig. 4), where RHVE exposed to VP-WTEO did not undergo morphological changes. Therefore, it is possible to conclude that VP-OEO treatment does not cause relevant tissue damage, and its application seems to be safe for a future application. Furthermore, these data reaffirm the in vivo results showing an absence of cytotoxicity (Fig. 1). A significant increase in LDH was observed when tissue was colonized by C. albicans in both conditions, single-species (p < 0.1) and mixed colonization (p < 0.001). In turn, a significant decrease (p < 0.1) of LDH was observed when only L. gasseri was present. As expected, Candida spp. are able to cause vaginal epithelium damage [18, 44], while the Lactobacillus cells assumed a protector role. In fact, the effectiveness of applying Lactobacillus as a prophylaxis treatment has been well-founded in long-term administration [2]. Reid et al. [40]. demonstrated that the administration of Lactobacillus probiotics in recommended amounts can restore host-microbial and immune homeostasis. Regarding the applied treatment, an important observation can be drawn from the data obtained, VP-WTEO exposure led to a significant decrease (p < 0.1) in epithelial damage when colonization by C. albicans occurred, in both conditions (Fig. 3B). Although an increase in LDH activity was verified when L. gasseri was exposed to VP-WTEO, together with C. albicans (simulating vaginal flora conditions), there was a decrease in the damage level. So, we concluded that VP-WTEO significantly reduced Candida spp., controlling the growth of this fungus.
Conclusion
EOs have been suggested as potential sources of alternatives and new therapeutic products, with fewer side effects, lower toxicity and better biodegradability when compared to available antimicrobial agents. In this study, WTEO was selected, and its anti-Candida activity in the liquid phase and vapor phase was demonstrated. Biofilm formation and biofilm integrity in Candida are important virulence factors, and overall, the VP-WTEO results demonstrated the antifungal potential of this therapy, as it was able to interfere with both forms. The possibility of interfering with these more resistant structures, such as biofilms, is a promising therapeutic strategy.
This work also confirms the effectiveness of the VP-WTEO in controlling Candida spp. proliferation, without significant disruption of other important species of the vaginal microflora, namely Lactobacillus, thus allowing the protective function of the lactic flora in the vaginal mucosa. Therefore, this natural therapy can be applied for the treatment of VVC, while respecting the possible survival of Lactobacillus spp. Similar to inhaled medications used for respiratory treatments such bronchodilators and asthma treatments, applying the VP-WTEO to underwear can be effective. Just as these medications are administered through inhalation to directly treat respiratory conditions in the lungs, absorption of VP-WTEO through underwear may produce comparable therapeutic effects, offering antimicrobial benefits and potentially other localized therapeutic effects.
Acknowledgments
Statement of human and animal rights
This article does not contain any studies with human and animal subjects performed by any of the authors.
Abbreviations
- ATCC
American Type Culture Collection
- CV
Crystal violet
- EO
Essential oil
- FID
Flame-Ionisation Detection
- GC
Gas Chromatography
- LDH
Lactate dehydrogenase
- MFC
Minimum Fungicidal Concentrations
- MIC
Minimum Inhibitory Concentrations
- MRS
Mann Rogosa and Sharpe
- MRSB
Mann Rogosa and Sharpe broth
- PMS
Phenazine methosulfate
- RHVE
Reconstituted human vaginal epithelium
- SD
Standard deviation
- SDA
Sabouraud Dextrose Agar
- SDB
Sabouraud dextrose broth
- SVF
Synthetic vaginal fluid
- VP-WTEO
Vapor phase of white thyme essential oil
- VP-EO
Vapor phase of essential oil
- VVC
Vulvovaginal candidiasis
- WTEO
White thyme essential oil
- XTT
(2,3-(2-methoxy-4-nitro-5-sulphophenyl)-5-[(phenylamino)carbonyl]-2H-tetrazolium hydroxide)
Authors’ contributions
LF: Conceptualization, Methodology, Formal analysis, Investigation, Data Curation, Writing - Original Draft, Visualization. IS: Investigation, Methodology, Data Curation; DA: Investigation, Methodology, Data Curation; RC: Contributed reagents or other essential material, Writing - Review & Editing Visualization; SS: Methodology, Validation, Formal analysis, Writing - Review & Editing Visualization; NPM: Contributed reagents or other essential material, Writing - Review & Editing Visualization; SCO: Validation, Writing - Review & Editing Visualization; MH: Conceptualization, Investigation, Data Curation, Writing - Review & Editing Visualization, Project administration, Supervision; MER: Methodology, Validation, Formal analysis, Writing - Review & Editing Visualization, Supervision. All authors read and approved the final manuscript
Funding
Declaration: This study was supported by the Portuguese Foundation for Science and Technology (FCT) under the scope of the strategic funding of UIDB/04469/2020 unit, with DOI 10.54499/UIDB/04469/2020 and grant ref 2020.05720.BD for Liliana Fernandes. Also, this study was supported by LABBELS—Associate Laboratory in Biotechnology, Bioengineering and Microelectromechanical Systems, LA/P/0029/2020 and Maria Elisa Rodrigues thanks FCT for funding through program DL 57/2016—Norma transitória. Sofia Costa de Oliveira acknowledges national funds through FCT, I.P., within the scope of the project “RISE - LA/P/0053/2020. Nuno Pereira Mira acknowledges support from FCT through its funding of research focused on Candida-lactobacilii interactions through LactoCan project (contract number: PTDC/BIA-MIC/31515/2017), iBB (contract: UIDB/04565/2020) and i4HB funding (contract: LA/P/0140/2020).
Data availability
No datasets were generated or analysed during the current study.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Larsen B, Monif GRG. Understanding the bacterial flora of the female genital tract. Clin Infect Dis. 2001;32:e69–77. [DOI] [PubMed] [Google Scholar]
- 2.Chee WJY, Chew SY, Than LTL. Vaginal microbiota and the potential of Lactobacillus derivatives in maintaining vaginal health. Microb Cell Factories 2020. 2020;19(1):19:1–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Matsuda Y, Cho O, Sugita T, Ogishima D, Takeda S. Culture supernatants of Lactobacillus gasseri and L. crispatus inhibit Candida albicans biofilm formation and adhesion to HeLa cells. Mycopathologia. 2018;183:691–700. [DOI] [PubMed] [Google Scholar]
- 4.Gonçalves B, Ferreira C, Alves CT, Henriques M, Azeredo J, Silva S. Vulvovaginal candidiasis: epidemiology, microbiology and risk factors. Crit Rev Microbiol. 2016;42:905–27. [DOI] [PubMed] [Google Scholar]
- 5.Morales DK, Hogan DA. Candida albicans interactions with bacteria in the context of human health and disease. PLoS Pathog. 2010;6:1–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Fernandes Â, Azevedo N, Valente A, Dias M, Gomes A, Nogueira-Silva C, et al. Vulvovaginal candidiasis and asymptomatic vaginal colonization in Portugal: epidemiology, risk factors and antifungal pattern. Med Mycol. 2022. 10.1093/mmy/myac029. [DOI] [PubMed] [Google Scholar]
- 7.Parolin C, Marangoni A, Laghi L, Foschi C, Palomino RAÑ, Calonghi N, et al. Isolation of vaginal lactobacilli and characterization of anti-Candida activity. PLoS One. 2015;10:e0131220. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Fernandes L, Gonçalves B, Costa R, Fernandes Â, Gomes A, Nogueira-Silva C, et al. Vapor-phase of essential oils as a promising solution to prevent Candida vaginal biofilms caused by antifungal resistant strains. Healthcare. 2022;10(9): 1649. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Fernandes L, Costa R, Henriques M, Rodrigues ME. Simulated vaginal fluid: Candida resistant strains’ biofilm characterization and vapor phase of essential oil effect. J Med Mycol. 2022;33(1):101329. [DOI] [PubMed]
- 10.Ribeiro R, Fernandes L, Costa R, Cavaleiro C, Salgueiro L, Henriques M, et al. Comparing the effect of thymus spp. essential oils on Candida auris. Ind Crops Prod. 2022;178: 114667. [Google Scholar]
- 11.Fernandes L, Ribeiro R, Costa R, Henriques M, Rodrigues ME. Essential oils as a good weapon against drug-resistant Candida auris. Antibiotics. 2022;11(7): 977. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Araújo D, Mil-Homens D, Henriques M, Silva S. Anti-EFG1 2′-OMethylRNA oligomer inhibits Candida albicans filamentation and attenuates the candidiasis in Galleria mellonella. Mol Ther Nucleic Acids. 2022;27:517–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ju J, Xu X, Xie Y, Guo Y, Cheng Y, Qian H, et al. Inhibitory effects of cinnamon and clove essential oils on mold growth on baked foods. Food Chem. 2017;240:850–5. [DOI] [PubMed] [Google Scholar]
- 14.Ju J, Xie Y, Yu H, Guo Y, Cheng Y, Chen Y, et al. Synergistic properties of citral and eugenol for the inactivation of foodborne molds in vitro and on bread. LWT. 2020;122:109063. [Google Scholar]
- 15.Silva S, Henriques M, Oliveira R, Williams D, Azeredo J. In vitro biofilm activity of non-Candida albicans Candida species. Curr Microbiol. 2010;61:534–40. [DOI] [PubMed] [Google Scholar]
- 16.Silva S, Henriques M, Martins A, Oliveira R, Williams D, Azeredo J. Biofilms of non-Candida albicans Candida species: quantification, structure and matrix composition. Med Mycol. 2009;47:681–9. [DOI] [PubMed] [Google Scholar]
- 17.Ferreira C, Gonçalves B, Boas DV, Oliveira H, Henriques M, Azeredo J, et al. Candida tropicalis biofilm and human epithelium invasion is highly influenced by environmental pH. Pathog Dis. 2016. 10.1093/femspd/ftw101. [DOI] [PubMed] [Google Scholar]
- 18.Alves CT, Wei X-Q, Silva O, Azeredo J, Henriques M, Williams DW. Candida albicans promotes invasion and colonisation of Candida glabrata in a reconstituted human vaginal epithelium. J Infect. 2014;69:396–407. [DOI] [PubMed] [Google Scholar]
- 19.Alves CT, Silva S, Pereira L, Williams DW, Azeredo J, Henriques M. Effect of progesterone on Candida albicans vaginal pathogenicity. Int J Med Microbiol. 2014;304:1011–7. [DOI] [PubMed] [Google Scholar]
- 20.Pereira TC, de Barros PP, de Oliveira Fugisaki LR, Rossoni RD, Ribeiro F, de Menezes C, et al. Recent advances in the use of galleria Mellonella model to study immune responses against human pathogens. J Fungi (Basel). 2018;4(4):128. [DOI] [PMC free article] [PubMed]
- 21.Kozics K, Bučková M, Puškárová A, Kalászová V, Cabicarová T, Pangallo D. The effect of ten essential oils on several cutaneous drug-resistant microorganisms and their cyto/genotoxic and antioxidant properties. Molecules. 2019;24:pii. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Omran SM, Esmailzadeh S. Comparison of anti-candida activity of thyme, pennyroyal, and lemon essential oils versus antifungal drugs against Candida species. Jundishapur J Microbiol. 2009;2:53–60. [Google Scholar]
- 23.Brun P, Bernabè G, Filippini R, Piovan A. In vitro antimicrobial activities of commercially available tea tree (Melaleuca alternifolia) essential oils. Curr Microbiol. 2019;76:108–16. [DOI] [PubMed] [Google Scholar]
- 24.Jafri H, Ahmad I. Thymus vulgaris essential oil and thymol inhibit biofilms and interact synergistically with antifungal drugs against drug resistant strains of Candida albicans and Candida tropicalis. J Mycol Med. 2020;30: 100911. [DOI] [PubMed] [Google Scholar]
- 25.Rajkowska K, Nowicka-Krawczyk P, Kunicka-Styczynska A. Effect of clove and thyme essential oils on Candida biofilm formation and the oil distribution in yeast cells. Molecules. 2019;24:piiE1954. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Hammer KA, Carson CF, Riley TV. Antifungal activity of the components of melaleuca alternifolia (tea tree) oil. J Appl Microbiol. 2003;95:853–60. [DOI] [PubMed] [Google Scholar]
- 27.Roxo M, Zuzarte M, Gonçalves MJ, Alves-Silva JM, Cavaleiro C, Cruz MT, et al. Antifungal and anti-inflammatory potential of the endangered aromatic plant thymus albicans. Sci Rep. 2020;10:18859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Mandras N, Nostro A, Roana J, Scalas D, Banche G, Ghisetti V, et al. Liquid and vapour-phase antifungal activities of essential oils against Candida albicans and non-albicans Candida. BMC Complement Altern Med. 2016;16:1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Wang Y, Liu H, Zhan F. Effects of natural borneol on germ tube formation and preformed biofilm activity in Candida albicans. Nat Prod Commun. 2022. 10.1177/1934578X221129128.35136386 [Google Scholar]
- 30.Zheng N, Guo R, Wang J, Zhou W, Ling Z. Contribution of Lactobacillus iners to vaginal health and diseases: A systematic review. Front Cell Infect Microbiol. 2021;11:792787. [DOI] [PMC free article] [PubMed]
- 31.Anh DN, Hung DN, Tien TV, Dinh VN, Son VT, Luong NV, et al. Prevalence, species distribution and antifungal susceptibility of Candida albicans causing vaginal discharge among symptomatic non-pregnant women of reproductive age at a tertiary care hospital, Vietnam. BMC Infect Dis. 2021;21:1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Pedro NA, Fontebasso G, Pinto SN, Alves M, Mira NP. Acetate modulates the inhibitory effect of Lactobacillus gasseri against the pathogenic yeasts Candida albicans and Candida glabrata. Microb Cell. 2023;10:88. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Xu T, Xiao Y, Wang H, Zhu J, Lee Y, Zhao J, et al. Characterization of Mixed-Species biofilms formed by four gut microbiota. Microorganisms. 2022;10(12):2332. [DOI] [PMC free article] [PubMed]
- 34.Ambrosio CMS, de Alencar SM, Moreno AM, Da Gloria EM. Evaluation of the selective antibacterial activity of Eucalyptus globulus and Pimenta Pseudocaryophyllus essential oils individually and in combination on Enterococcus faecalis and Lactobacillus rhamnosus. Can J Microbiol. 2018;64:844–55. [DOI] [PubMed] [Google Scholar]
- 35.Amabebe E, Anumba DOC. The vaginal microenvironment: the physiologic role of lactobacilli. Front Med (Lausanne). 2018;13:5:181. [DOI] [PMC free article] [PubMed]
- 36.Zangl I, Pap IJ, Aspöck C, Schüller C. The role of Lactobacillus species in the control of Candida via biotrophic interactions. Microb Cell. 2020;7:1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Tachedjian G, Aldunate M, Bradshaw CS, Cone RA. The role of lactic acid production by probiotic Lactobacillus species in vaginal health. Res Microbiol. 2017;168:782–92. [DOI] [PubMed] [Google Scholar]
- 38.Borges S, Silva J, Teixeira P. The role of lactobacilli and probiotics in maintaining vaginal health. Arch Gynecol Obstet. 2014;289:479–89. [DOI] [PubMed] [Google Scholar]
- 39.Matsubara VH, Bandara HMHN, Mayer MPA, Samaranayake LP. Probiotics as antifungals in mucosal candidiasis. Clin Infect Dis. 2016;62:1143–53. [DOI] [PubMed] [Google Scholar]
- 40.Reid G, Younes JA, Van Der Mei HC, Gloor GB, Knight R, Busscher HJ. Microbiota restoration: natural and supplemented recovery of human microbial communities. Nat Rev Microbiol. 2011;9:27–38. [DOI] [PubMed] [Google Scholar]
- 41.Dos Santos CI, França YR, Campos CDL, Bomfim MRQ, Melo BO, Holanda RA, et al. Antifungal and antivirulence activity of vaginal Lactobacillus spp. Prod against Candida Vaginal Isolates Pathogens 2019. 2019;8:8:150. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Xu J, Chatterjee M, Baguley TD, Brouillette J, Kurup P, Ghosh D, et al. Inhibitor of the tyrosine phosphatase STEP reverses cognitive deficits in a mouse model of Alzheimer’s disease. PLoS Biol. 2014;12: e1001923. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Fernandes L, Costa R, Silva S, Henriques M, Costa-de-Oliveira S, Rodrigues ME. Effect of vapor-phase oregano essential oil on resistant Candida species biofilms: mechanisms of action. Microbiol Spectr. 2023. 10.1128/spectrum.05124-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Silva S, Henriques M, Oliveira R, Azeredo J, Malic S, Hooper SJ, et al. Characterization of Candida parapsilosis infection of an in vitro reconstituted human oral epithelium. Eur J Oral Sci. 2009;117:669–75. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
No datasets were generated or analysed during the current study.




