Abstract
Background
Flavescence dorée (FD) is one of the most damaging grapevine diseases in Europe, caused by the quarantine-listed Grapevine flavescence dorée phytoplasma (FDp). Given the absence of resistant cultivars and curative treatments, effective disease control relies on early and accurate FDp detection. PCR-based diagnostics are the gold standard, but their accuracy depends on DNA extraction quality. Grapevine tissues contain PCR inhibitors like polysaccharides and polyphenols, complicating DNA isolation. While CTAB methods yield high-quality DNA, they are time-consuming, and commercial kits provide purer but often lower DNA yields at high costs. A rapid and optimized DNA extraction method for FDp detection is urgently needed.
Results
We developed the “HotShot Vitis” (HSV) method, a modified HotSHOT protocol optimized for grapevine tissues. HSV was benchmarked against the CTAB method and a commercial silica membrane kit. Although HSV showed limitations in DNA quantification due to buffer composition, it efficiently extracted DNA suitable for amplifying the grapevine trnL-F gene and detecting FDp by two qPCR assays. DNA extracted by HSV also supported molecular typing and sequencing of FDp 16 S rRNA and map genes, performing comparably to CTAB and the commercial kit. Importantly, HSV reduced the extraction time to about 30 min, significantly faster than the CTAB (2 h) and kit (40 min) methods.
Conclusions
HSV is a fast, reliable, and chemically low-risk DNA extraction method for FDp detection and characterization in grapevine. Its efficiency and simplicity make HSV ideal for large-scale diagnostics and early disease management.
Supplementary Information
The online version contains supplementary material available at 10.1186/s13007-025-01460-y.
Keywords: FDp, HotShot vitis, Low chemical risk method, Map gene, Molecular typing, Phytoplasma diagnostics, qPCR, Vitis vinifera, 16SrV
Background
Flavescence dorée (FD) is one of the most destructive diseases affecting grapevine (Vitis vinifera) in European vineyards, particularly in Italy and France [1, 2]. This disease is caused by Grapevine flavescence dorée phytoplasma (FDp), a phloem-restricted quarantine-listed pathogen included in the A2 list of the European and Mediterranean Plant Protection Organization (EPPO) [3]. FD causes severe economic loss due to its ability to rapidly spread within vineyards and the severe decline it causes in infected vines. Based on nucleotide sequence analysis of the 16 S rRNA gene and the intergenic spacer region between the 16 S and 23 S rRNA genes, FDp has been classified within the 16SrV taxonomic group (elm yellows group), specifically in the 16SrV-C and 16SrV-D subgroups [4–6]. Further genetic analysis using informative loci, such as methionine aminopeptidase (map), currently considered the most promising marker for distinguishing phytoplasma strains within the 16SrV group, has led to the identification of three distinct FDp genetic clusters: map-FD1 (16SrV-C), map-FD2 (16SrV-C and 16SrV-D), and map-FD3 (16SrV-C) [7, 8]. Infected vines display symptoms such as leaf yellowing (in white cultivars) or reddening (in red cultivars), incomplete cane lignification, delayed budbreak, and bunch necrosis [9, 10]. FDp-infected plants die or become less productive over the years, constituting a potential source of inoculum. The primary vector, Scaphoideus titanus, transmits FDp in a persistent and propagative manner, facilitating the fast dissemination of the pathogen over large areas [11]. As the management of FDp primarily relies on vector control using insecticides. No resistant grapevine cultivars or cures are available; early detection of infected vines through rapid and reliable diagnostic methods is crucial for effective disease management [12], especially considering that FDp titre can vary considerably throughout the year and among different grapevine varieties [13, 14].
Molecular diagnostic methods, particularly polymerase chain reaction (PCR) based techniques, are currently regarded as the gold standard for phytoplasma detection in grapevine [15–19]. However, the sensitivity and reliability of these assays are highly dependent on the quality and purity of the extracted DNA, which is strongly influenced by the extraction method employed [16, 20]. Among the most widely used protocols for DNA extraction is the cetyltrimethylammonium bromide (CTAB) method [21], along with its numerous variants [22–25]. These protocols have been extensively applied for extracting DNA from a wide range of biological tissues, including both plant and non-plant sources, and have proven effective in isolating FDp DNA [26–28]. CTAB-based methods typically provide high yield and good-quality DNA at a low cost, but they are labour-intensive and time-consuming. This is particularly problematic when processing grapevine tissues rich in polysaccharides and polyphenols [29, 30], which act as potential PCR inhibitors and reduce detection sensitivity, especially in samples with low phytoplasma titre [31, 32].
To overcome these limitations, commercial silica membrane-based kits have been introduced for grapevine diagnostics [33, 34]. These kits offer faster workflows and typically produce highly purified DNA with minimal levels of PCR inhibitors due to their optimized binding, washing, and elution steps. However, despite these advantages, many commercial kits prioritize DNA purity over yield, which is a significant limitation in phytoplasma detection, where the pathogen is present in low titres and high DNA recovery is critical for reliable amplification [35–38]. Moreover, no commercial kits are currently tailored specifically for phytoplasma extraction, raising concerns about their efficiency in recovering FDp from infected tissues. The high cost of these kits also limits their feasibility for large-scale vineyard monitoring programs, which require processing hundreds of samples within tight budget constraints [23, 39].
Thus, both CTAB-based and commercial kit-based approaches involve trade-offs among cost, purity, and yield. Neither method fully satisfies the need for a cost-effective, high-yield, low-inhibitor DNA extraction method specifically optimized for FDp detection in grapevine tissues. These persistent limitations underscore the urgent need for an innovative extraction method that ensures reliable phytoplasma detection, minimizes processing time, and is adaptable across grapevine cultivars.
To address these knowledge gaps, the present study aimed to develop a novel DNA extraction method from grapevine leaves, specifically tailored to FDp. The method was designed to (i) enable rapid and reliable DNA extraction from grapevine leaf tissues, (ii) optimize DNA quality and purity for accurate FDp diagnosis, and (iii) ensure compatibility with downstream genetic characterization using the 16 S rRNA and map genes. The resulting protocol – hereafter referred to as “HotShot Vitis” – offers a simplified, efficient approach to FDp DNA extraction. It is anticipated that HotShot Vitis will support the implementation of early detection strategies of FD, thereby enhancing the timely management of this destructive grapevine disease.
Methods
Plant material
In August 2024, Vitis vinifera cv. ‘Sangiovese’ plants were selected from a vineyard located in Arezzo, Tuscany, Central Italy (43°27′4″ N, 11°52′41″ E), where FD infection had been reported by diagnostic analyses conducted by the Regional Phytosanitary Service of Tuscany in 2023. Additionally, typical FD symptoms (i.e., reduced shoot development and a bushy growth appearance) were observed again in June 2024. The vineyard was partially bordered to the north by a wood and surrounded by other vineyards on the remaining sides. Both symptomatic and asymptomatic plants from the same row were selected for sampling. Collected leaves were immediately placed in coolers and transported on the same day to the Plant Pathology Laboratory of the Department of Agriculture, Food, and Environment (DAFE), University of Pisa, where they were stored at -80 °C until analysis.
Preliminary FDp analysis by standard methods and subsample preparation for comparative analysis
The samples underwent preliminary testing for the presence of FDp and Candidatus Phytoplasma solani (BNp; i.e., the phytoplasma associated with Bois noir, another detrimental grapevine disease [40]), in order to identify positive and negative controls for evaluating the newly proposed buffer DNA extraction method, following the procedures described in Pedrelli et al. [28]. FDp-positive samples were subsequently characterized based on the 16 S rRNA and map genes [28]. Based on the preliminary screening results, FDp-positive (+) and FDp-negative (−) samples were separately pooled to create two uniform composite samples. From each composite, three aliquots were prepared, each containing a mixture of leaf veins and midribs. These aliquots were then divided into three parts, resulting in a total of 18 subsamples for downstream analyses.
DNA extraction methods
A novel DNA extraction protocol (“HotShot Vitis”, HSV) was developed by adapting the Hot Sodium Hydroxide and Tris (HotSHOT) method originally described by Truett et al. [41], with specific modifications to improve DNA extraction from grapevine tissue. DNA extraction was carried out as follows (further non-mandatory details are reported in Additional file 1):
500 mg of grapevine tissues (midribs and veins) were placed in a Bioreba extraction bag (Bioreba AG, Reinach, Switzerland) with 3 mL of alkaline buffer, containing 60 mM sodium hydroxide (NaOH), 0.2 mM disodium ethylenediaminetetraacetate (disodium EDTA), 1% (w/v) polyvinylpyrrolidone (PVP-40; molecular weight 40,000), 0.1% (w/v) sodium dodecyl sulfate (SDS), and 0.5% (w/v) sodium metabisulfite (Na₂S₂O₅) in autoclaved distilled water and adjusted to pH 12.
The tissue was homogenized at room temperature using an Omex grinder (Bioreba AG).
500 µL aliquot of the homogenate was transferred to a 1.5 mL microcentrifuge tube and incubated at 95 °C for 10 min at 300 × rpm in a thermo-mixer.
Samples were then cooled on ice for three minutes.
An equal volume (500 µL) of neutralization buffer (40 mM Tris-HCl, in autoclaved distilled water and adjusted to pH 5) was added, gently mixed, and centrifuged at 10,000 × g for 5 min at 12 °C.
The supernatant was carefully transferred to a new tube, avoiding any pellet disturbance.
DNA extracts were stored at 4 °C for short-term use (i.e., within the same week) or at -20 °C for longer preservation.
For comparison, parallel DNA extractions were performed using the CTAB protocol [42] and a commercial silica column-based kit (NucleoSpin Plant, Macherey-Nagel, Dueren, Germany), as recommended by EPPO [PM 7/079 (2)] for FDp diagnostics [43]. Subsamples from FDp-positive and FDp-negative grapevines were assigned to one of the three DNA extraction methods and labelled accordingly: HSV+, CTAB+, and KIT + for FDp-positive, and HSV−, CTAB−, KIT − for FDp-negative samples. All extractions were conducted by the same operator under standardized laboratory conditions to ensure consistency and comparability.
DNA yield and quality assessment
DNA quantity (ng/µL) and purity (A260/280 ratio) were measured in triplicate for each extract using a QIAxpert system (Qiagen, Venlo, Netherlands) with 2 µL of DNA per measurement. DNA integrity was further assessed by electrophoresis on a 1.5% agarose gel. To assess DNA extraction efficiency across methods and sample types, each extract was diluted 1:10 and analysed by qPCR with primers targeting the chloroplast trnL-F spacer region, serving as an internal plant control [18]. qPCR reactions (20-µL) were run in triplicate on a Rotor-Gene Q thermocycler (Qiagen) using the QuantiNova Probe Kit (Qiagen). Positive (FDp-infected), negative (healthy grapevine), and no-template (NTC) controls were included in all assays.
Detection and characterization of FDp
The presence of 16 S rRNA phytoplasma subgroups V (16SrV; i.e., FDp) and XII (16SrXII; i.e., BNp) was assessed by qPCR using subgroup-specific primers targeting the 16 S rRNA gene and the map gene (Table 1) [17, 18]. The cycling conditions for the primer pairs were as follows: an initial denaturation at 95 °C for 2 min; 45 cycles consisting of 5 s at 95 °C and 30 s at 60 °C. Each DNA extract was tested in tenfold dilution series (undiluted to 10− 8), with three technical replicates per dilution, to identify the optimal dilution for diagnostic analysis. For confirmation, end-point PCR was conducted using the universal primer pair P1/P7 [44], followed by nested PCR with subgroup-specific primers R16(V)F1/R1 for detection of 16SrV [45]. The cycling conditions for the primer pairs were as follows: an initial denaturation at 95 °C for 3 min; 35 cycles of 30 s at 95 °C, 30 s at 55 °C (for P1/P7) or 50 °C (for R16(V)F1/R1), and 1 min at 72 °C; followed by a final extension at 72 °C for 10 min. Map gene amplification was performed using both conventional and nested PCR with primer pairs FD9F5/MapR1 and FD9F6/MapR2, respectively [7]. The cycling conditions for both primer pairs were as follows: an initial denaturation at 95 °C for 3 min; 35 cycles of 30 s at 92 °C, 30 s at 52 °C, and 1 min 30 s at 66 °C; followed by a final extension at 66 °C for 5 min. PCRs were run on undiluted and 1:10 diluted samples, each in three technical replicates. Amplicons were visualized via 1.5% agarose gel. PCR products from 16SrV-positive samples and the map gene were sequenced by the Sanger DNA sequencing method (Eurofins, Ebersberg, Germany), and subgroup classification was carried out using iPhyClassifier [46]. Map gene typing was performed via RFLP analysis using the AluI and Eco72I restriction enzymes to characterize their map cluster (i.e., map-FD1, map-FD2, and map-FD3) [7]. Nucleotide sequences were analysed using BioEdit [47] and compared using BLASTn against NCBI sequence dataset (www.ncbi.nlm.nih.gov) [11]. qPCR reactions were conducted on a Rotor-Gene Q thermocycler (Qiagen) with a 20-µL reaction volume containing QuantiNova Probe PCR Master mix (Qiagen). Both PCR and nested PCR were performed on a C1000 Touch® thermal cycler (Bio-Rad, Hercules, CA, USA) with reaction volumes of 25 and 50 µL, respectively, utilizing DreamTaq White and Green PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA).
Table 1.
Primer pairs used in this study
| Primers | Sequence 5′-3′ | Final concetration (µM) | Specificity | References |
|---|---|---|---|---|
| FD9F5 | CAAAAAATTACTTTTGGCGGGAC | 1 | 16SrV group - map gene | [7] |
| MapR1 | TGCTCAAAATGAGCGCTTAAAC | |||
| FD9F6 | GTCGCTTTAGAATCGACACA | |||
| MapR2 | TCGGAAGTAACAGCAGTCCA | |||
| BN-F | GGTTAAGTCCCGCAACGAG | 0.15 | 16SrV group | [17] |
| BN-R | CCCACCTTCCTCCAATTTATCA | |||
| BN-FAM | AACCCTTGTTGTTAATTGCCATCATTAAG | 0.2 | ||
| FD-F | AAGTCGAACGGAGACCCTTC | 0.15 | 16SrXII group | |
| FD-R | TAGCAACCGTTTCCGATTGT | |||
| FD-FAM | AAAAGGTCTTAGTGGCGAACGGGT | 0.2 | ||
| mapFD-F | TCAAGGCTTCGGBGGTTATA | 0.2 | 16SrV group | [18] |
| mapFD-R | TTGTTTTAGAAGGTAATCCGTGAACTAC | |||
| mapFD-FAM | TTGTATTTCAGTGAATGAAG | |||
| mapBN-F | ATTTGATGAAACACGCTGGATTAA | 16SrXII group | ||
| mapBN-R | TCCCTGGAACAATAAAAGTYGCA | |||
| mapBN-VIC | AAACCCACAAAATGC | |||
| VITIS-F | AAATTCAGGGAAACCCTGGAA | Grapevine | ||
| VITIS-R | CCCTTGGTTGTTTTCGGAAA | |||
| VITIS-Cy5 | CTGAGCCAAATCC | |||
| P1 | AAGAGTTTGATCCTGGCTCAGGATT | 0.4 | Phytoplasma | [44] |
| P7 | CGTCCTTCATCGGCTCTT | |||
| R16(V)F1 | TTAAAAGACCTTCTTCGG | 16SrV group | [45] | |
| R16(V)R1 | TTCAATCCGTACTGAGACTACC |
Evaluation of time efficiency
The time required for DNA extraction using each method (HSV, CTAB, and KIT) was recorded using a stopwatch to ensure objective comparison. One FDp-positive and one FDp-negative samples were processed in parallel for each method to maintain comparability under standardized laboratory conditions.
Results and discussion
FDp detected in symptomatic vines with 16SrV-C and map-FD3 subgroups
Field sampling identified three symptomatic and three asymptomatic V. vinifera cv. Sangiovese plants. Symptomatic vines exhibited stunted shoot growth, bushy appearance, early leaf reddening, and downward leaf curling (Fig. 1), while asymptomatic vines showed no visible symptoms.
Fig. 1.
A Field observation of Vitis vinifera cv. ‘Sangiovese’ in early July in Arezzo (Tuscany, Central Italy); the FDp-positive vine (left) shows reduced shoot growth and a bushy appearance compared to the FDp-negative vine (right). B Symptomatic leaf from an FDp-positive vine observed in August, exhibiting initial reddening and downward curling of the leaf blade
Diagnostic testing confirmed the presence of 16SrV phytoplasma in all symptomatic vines (100%), whereas all asymptomatic vines tested negative (Table 2). No plants were positive for 16SrXII phytoplasma. End-point PCR targeting the 16 S rRNA and map genes yielded amplicons of expected sizes. In silico analysis of the 16 S rRNA sequences showed 100% identity with an FDp isolate (AB639101) previously reported in Italy, and classified within subgroup 16SrV-C. Similarly, map gene sequences matched the DicTos27 isolate (PP196536), originally detected in Dictyophara europaea in Tuscany and classified as map-FD3 (M51genotype).
Table 2.
Diagnostic and characterization results obtained from FDp-positive (+) and FDp-negative (–) grapevine leaf samples, selected for the comparison of FDp extraction methods
| Plant | qPCR | Characterization | |||
|---|---|---|---|---|---|
| 16srV | 16srXII | 16 S rRNA subgroup | map FD cluster | Genotype | |
| 1 | + | - | FDV-C | FD3 | M51 |
| 2 | + | - | FDV-C | FD3 | M51 |
| 3 | + | - | FDV-C | FD3 | M51 |
| 4 | - | - | --- | --- | --- |
| 5 | - | - | --- | --- | --- |
| 6 | - | - | --- | --- | --- |
The samples were collected from six Vitis vinifera cv. ‘Sangiovese’ plants in a vineyard located in Arezzo (Tuscany, Central Italy)
These results confirm the continued presence of the FDp 16SrV-C/map-FD3 genotype in Tuscan vineyards and reinforce its association with the alternative host-vector cycle in the region [28]. They also support phylogeographic links with southeastern European countries including Croatia, Montenegro, and Serbia (see Additional file 1) [27, 48, 49].
HSV enables endogenous gene amplification but not reliable DNA quantification
DNA extracts obtained via the HSV method exhibited low reliability in DNA quantification and purity measurements. No bands were found on agarose gel (Fig. 2), likely due to the HSV buffer components (detergents; high pH) interfering with absorbance at 260 nm in QIAxpert system (yield estimated ~-347 ng/µL) [50], and DNA migration in agarose gels [29, 51].
Fig. 2.
Agarose gel electrophoresis (1.5%) of genomic DNA extracted from both FDp-positive (+) and FDp-negative (-) subsamples using three DNA extraction methods: H = HotShot Vitis method; C = cetyltrimethylammonium bromide buffer method; K = NucleoSpin Plant Kit (Macherey-Nagel, Dueren, Germany). M = 1000 bp DNA marker
In contrast, CTAB extractions yielded the highest DNA concentrations: 34 ng/µL (CTAB+) and 27 ng/µL (CTAB−), with A260/A280 ratios of 2.04 and 2.14, respectively. KIT extractions produced lower yields (3–4 ng/µL) but acceptable A260/A280 ratios (~ 2.0–2.95). Agarose gel electrophoresis confirmed DNA integrity CTAB and KIT samples, with strong and well-defined bands.
Nevertheless, qPCR targeting the grapevine chloroplast trnL-F spacer region confirmed successful DNA extraction across all methods, with comparable Ct values (mean Ct = 15 ± SD; Table 3), validating HSV’s compatibility with molecular assays. These findings align with previous studies confirming the trnL-F marker’s robustness for assessing DNA extraction efficiency [52, 53].
Table 3.
Mean Ct values (calculated from three technical replicates) of the endogenous control (chloroplast trnL-F spacer gene) in FDp-positive (+) and FDp-negative (-) grapevine leaf samples, extracted using three DNA extraction methods
| Chloroplast trnL-F spacer | ||||
|---|---|---|---|---|
| Samples | 1st biological replicate | 2nd biological replicate | 3th biological replicate | Average Ct values |
| HSV + | 14.7 | 16.9 | 15.8 | 15.8 |
| CTAB + | 15.2 | 15.9 | 15.6 | 15.6 |
| KIT + | 15.3 | 15.1 | 14.8 | 15.1 |
| HSV - | 15.6 | 15.7 | 16.2 | 15.8 |
| CTAB - | 14.8 | 15.1 | 15.4 | 15.1 |
| KIT - | 15.3 | 15.1 | 15.2 | 15.2 |
HSV HotShot Vitis, CTAB cetyltrimethylammonium bromide buffer; KIT = NucleoSpin Plant Kit (Macherey-Nagel, Dueren, Germany). qPCR was performed on DNA samples diluted 1:10
Importantly, HSV demonstrated effective DNA extraction even in the presence of common grapevine inhibitors such as polyphenols and polysaccharides [54, 55], underscoring its utility for downstream molecular analyses.
HSV supports reliable FDp detection via qPCR
FDp detection using qPCR protocols from Angelini et al. [17] and Pelletier et al. [18] was evaluated across three extraction methods. Only positive subsamples (HSV+, CTAB+, KIT+) produced amplification signals, while all negative controls remained undetected (Table 4).
Table 4.
Mean Ct values (calculated from three technical replicates) obtained from FDp-positive (+) grapevine leaf samples serially diluted from 100 to 108, extracted using three DNA extraction methods
| DNA Extraction method |
qPCR Diagnosis protocols |
Serial dilution | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 100 | 10− 1 | 10− 2 | 10− 3 | 10− 4 | 10− 5 | 10− 6 | 10− 7 | 10− 8 | ||
| HSV + | [17] | ND | 21.0 | 24.3 | 25.5 | 29.6 | 30.5 | 34.0 | ND | ND |
| CTAB + | 13.8 | 17.0 | 20.9 | 23.6 | 26.0 | 28.1 | 32.3 | ND | ND | |
| KIT + | 14.8 | 18.1 | 22.4 | 25.5 | 28.3 | 32.0 | ND | ND | ND | |
| HSV + | [18] | ND | 21.2 | 24.8 | 26.2 | 28.7 | 31.2 | 33.2 | ND | ND |
| CTAB + | 14.9 | 18.4 | 21.7 | 24.1 | 26.6 | 29.0 | 32.0 | ND | ND | |
| KIT + | 16.6 | 20.3 | 23.1 | 26.6 | 29.8 | 32.3 | 33.0 | ND | ND | |
HSV HotShot Vitis method, CTAB cetyltrimethylammonium bromide buffer method, KIT = NucleoSpin Plant kit (Macherey-Nagel, Düren, Germany). ND not detectable
HSV + samples demonstrated reliable amplification up to a 10− 6 dilution, with Ct values rising from 21 (10− 1) to 35 (10− 6; Fig. 3). Notably, no amplification occurred in undiluted samples (100), likely due to PCR inhibitors (e.g., SDS and NaCl) known to inhibit DNA polymerases [56]. Dilution reduced inhibitor concentrations, enabling successful amplification. CTAB + and KIT + samples displayed similar dilution-dependent amplification trends, with Ct values ranging from 14 to 15 (10⁰) to 32–33 (10⁻⁶). The Pelletier protocol yielded slightly higher Ct values than the Angelini one. These findings confirm that HSV-extracted DNA is suitable for FDp detection, provided that a preliminary dilution step is performed to mitigate inhibitor effects [57, 58].
Fig. 3.
Amplification curves by qPCR using the (A) Angelini et al. [17] and (B) Pelletier et al. [18] for 16SrV phytoplasma group detection were performed on DNA extracted with the HSV method from grapevine samples infected by FDp. No amplification curves were observed for the undiluted samples, dilutions greater than 10⁻⁶, or non-template controls
HSV DNA extracts enable molecular typing and sequencing
Following successful qPCR validation, HSV-extracted DNA was evaluated for suitability in molecular typing of FDp via 16 S rRNA and map gene sequencing. Both genes were amplified successfully from undiluted and 1:10 diluted DNA obtained via HSV, CTAB, and KIT methods (Figs. 4 and 5).
Fig. 4.
Agarose gel electrophoresis (1.5%) showing amplification of FDp 16 S rRNA gene by end point PCR using P1/P7 primers, followed by nested PCR with R16(V)F1/R16(V)R1 primers. Each lane represents amplification from DNA extracted FDp-positive grapevine subsamples, either undiluted (10⁰) or tenfold diluted (10⁻¹), using three DNA extraction methods: HSV HotShot Vitis method, CTAB cetyltrimethylammonium bromide buffer method, K = NucleoSpin Plant Kit (Macherey-Nagel, Düren, Germany). C = positive control; N = no-template control; M = 1000 bp DNA marker
Fig. 5.
Agarose gel electrophoresis (1.5%) showing amplification of FDp map gene by end point PCR using FD9f5/MAPr1 primers, followed by nested PCR with FD9f6/MAPr2 primers. Each lane represents amplification from DNA extracted FDp-positive grapevine subsamples, either undiluted (10⁰) or tenfold diluted (10⁻¹), using three DNA extraction methods: HSV HotShot Vitis method, CTAB cetyltrimethylammonium bromide buffer method, K = NucleoSpin Plant Kit (Macherey-Nagel, Düren, Germany). C = positive control; N = no-template control; M = 100 bp marker
16 S rRNA gene sequences were identical across methods and dilutions. For the map gene, only diluted samples yielded full-length 750 bp sequences from HSV and KIT extracts, while CTAB succeeded in both undiluted and diluted conditions. Sequencing chromatograms were high quality, with sharp peaks, minimal background noise, and clean base calling, especially for diluted samples (Fig. 6).
Fig. 6.
Portions of chromatograms from Sanger sequencing of amplicons generated using the HSV extraction method. A 16 S rRNA gene amplicon from undiluted DNA; B 16 S rRNA gene amplicon from 10⁻¹ diluted DNA; C map gene amplicon from 10⁻¹ diluted DNA. All chromatograms displayed sharp, well-defined peaks, low background noise, consistent signal intensity, accurate base calling, absence of artefacts, and optimal mid-region resolution, supporting reliable sequence analysis
These results indicate that a 1:10 dilution is optimal for HSV extracts, consistent with recommendations by Arnaud et al. [7] for map gene amplification. In silico analysis confirmed all sequences matched known FDp isolates: FD-C (AB639101) for 16 S rRNA and DicTos27 (PP196536) for the map gene (map-FD3, M51 genotype). All sequences were submitted to GenBank (Table 6). These results confirm that HSV supports robust and reproducible FDp molecular typing performing comparably to conventional methods in sequencing-based applications.
Table 6.
Nucleotide sequences of FDp 16 S rRNA and map gene amplicons obtained from FDp-positive grapevine subsamples, using DNA extracted, either undiluted (10⁰) or tenfold diluted (10⁻¹), with three DNA extraction methods
| Extraction method | Dilution | Isolate | 16s rRNA subgroup | Accession number | Isolate | map FD cluster | Genotype | Length (bp) | Accession number |
|---|---|---|---|---|---|---|---|---|---|
| HSV | 100 | FDp16-A | FD-C | PV902808 | FDpm-1 | FD3 | M51 | 610 | PV921599 |
| CTAB | 100 | FD-C | FDpm-2 | FD3 | M51 | 750 | PV921600 | ||
| KIT | 100 | FD-C | FDpm-1 | FD3 | M51 | 610 | PV921599 | ||
| HSV | 10− 1 | FDp16-B | FD-C | PV902807 | FDpm-3 | FD3 | M51 | 750 | PV921601 |
| CTAB | 10− 1 | FD-C | FD3 | M51 | 750 | ||||
| KIT | 10− 1 | FD-C | FD3 | M51 | 750 |
HSV HotShot Vitis method, CTAB cetyltrimethylammonium bromide buffer method; K = NucleoSpin Plant Kit (Macherey-Nagel, Düren, Germany)
HSV offers the most time-efficient DNA extraction protocol and a low chemical risk
The time required for each DNA extraction method was recorded to assess operational efficiency. Among the three DNA extraction methods evaluated, HSV required the least processing time, with completion in approximately 30 min. The KIT protocol took about 40 min, while the CTAB method required nearly two hours.
The longer duration of the CTAB method reflects its multi-step nature, involving extensive incubation and centrifugation with numerous reagents. The KIT method, though less complex, still involves multiple buffers and column-based steps. In contrast, the HSV protocol relies on only two buffers, a single heating step, and straightforward processing, resulting in faster turnaround and reduced procedural complexity. This streamlined approach enhances scalability, enabling the processing of a large number of samples with minimal resources. Our tests demonstrated that the HSV method can process up to 120 samples within a three-hour window. In comparison, the KIT and CTAB methods would yield only a quarter or less of that throughput in the same timeframe. This high level of efficiency makes HSV particularly well-suited for large-scale or time-sensitive diagnostic workflows.
Moreover, CTAB extraction methods and some commercial kits often involve hazardous reagents, such as phenol, chloroform, β-mercaptoethanol, or proprietary chemicals, that are toxic, corrosive, and require stringent safety precautions [59]. In contrast, HSV relies on a simplified buffer system that avoids organic solvents and minimizes hazardous components, making it safer for routine laboratory use.
In conclusion, HSV combination of rapid processing, operational simplicity, and enhanced chemical safety makes it a preferred choice for high-throughput applications where time, labor, and resource optimization are critical.
Conclusions
Flavescence dorée, caused by FDp, remains a major threat to grapevine health and viticultural sustainability in Europe. While current DNA extraction methods, such as CTAB-base methods and commercial kits, have facilitated the detection of phytoplasma, they often require trade-offs between cost, complexity, and performance. Critically, no existing methods are specifically optimized for the detection of FDp in grapevine tissues, which are inherently rich in PCR inhibitors. In this study, we developed and validated a novel extraction protocol – HotShot Vitis (HSV) – designed to meet the specific challenges of isolating phytoplasma DNA from grapevine leaves. HSV was benchmarked against the established CTAB method and a commercial kit recommended by EPPO demonstrating several key advantages: (i) amplification of a grapevine endogenous control (trnL-F) confirming DNA suitability for PCR; (ii) sensitive and specific detection of FDp using two independent qPCR protocols, and (iii) reliable molecular typing via 16 S rRNA and map gene amplification and sequencing. Although HSV extracts were incompatible with traditional spectrophotometric quantification due to buffer interference, they performed robustly in all downstream molecular assays. Notably, HSV offered the fastest processing time (about 30 min) among the tested methods, making it particularly suitable for rapid diagnostics and large-scale screening and minimizes chemical hazards by eliminating toxic organic solvents and harsh reagents, offering a safer alternative to CTAB and commercial kits for routine DNA extraction. Overall, HSV represents a promising, low-cost, and scalable solution for the detection and characterization of FDp in grapevine, with potential applications in both research and routine phytosanitary monitoring in viticulture.
Supplementary Information
Acknowledgments
Disclaimer
Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement.
Author contributions
APe, APa, and DR conceptualized and designed the methodology. APe and MC performed the laboratory experiments. MC, APe and APa contributed to manuscript drafting. EP, LC, CN, and DR critically revised and approved the final version of the manuscript. CN, LC and DR provided economic and material resources for this research.
Funding
CN, LC and DR provided economic and material resources for this research.
Data availability
All data generated or analysed during this study are included in this published article and its additional file 1. The nucleotide sequences have been deposited in the NCBI database.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.EFSA - European Food Safety Authority, Tramontini S, Delbianco A, Vos S. Pest survey card on flavescence dorée phytoplasma and its vector Scaphoideus titanus. EFSA Supporting Publ. 2020;EN-1909. 10.2903/sp.efsa.2020.EN-1909
- 2.Bertaccini A, Mori N, Canel A, Pacini F, Contaldo N. Flavescence dorée strains in selected Italian wine-producing areas. In: Proceedings of the 20th Congress of ICVG, Thessaloniki, Greece. Thessaloniki: International Council for the Study of Virus and Virus-like diseases of the Grapevine; 2023. pp. 92–3. https://icvg.org/data/ICVG20Abstracts.pdf. Accessed 15 Mar 2025.
- 3.EPPO. Grapevine flavescence dorée phytoplasma. 2024.
- 4.Angelini E, Clair D, Borgo M, Bertaccini A, Boudon-Padieu E. Flavescence dorée in France and Italy - Occurrence of closely related Phytoplasma isolates and their near relationships to Palatinate grapevine yellows and an alder yellows Phytoplasma. Vitis. 2001;79. 10.5073/VITIS.2001.40.79-86.
- 5.Filippin L, Jović J, Cvrković T, Forte V, Clair D, Toševski I, et al. Molecular characteristics of phytoplasmas associated with flavescence dorée in clematis and grapevine and preliminary results on the role of Dictyophara Europaea as a vector. Plant Pathol. 2009;58:826–37. 10.1111/j.1365-3059.2009.02092.x. [Google Scholar]
- 6.Oliveira MJRA, Roriz M, Vasconcelos MW, Bertaccini A, Carvalho SMP. Conventional and novel approaches for managing flavescence dorée in grapevine: knowledge gaps and future prospects. Plant Pathol. 2019;68:3–17. 10.1111/ppa.12938. [Google Scholar]
- 7.Arnaud G, Malembic-Maher S, Salar P, Bonnet P, Maixner M, Marcone C, et al. Multilocus sequence typing confirms the close genetic interrelatedness of three distinct flavescence dorée Phytoplasma strain clusters and group 16SrV Phytoplasmas infecting grapevine and alder in Europe. Appl Environ Microbiol. 2007;73:4001–10. 10.1128/AEM.02323-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Malembic-Maher S, Desqué D, Khalil D, et al. When a Palearctic bacterium Meets a Nearctic insect vector: genetic and ecological insights into the emergence of the grapevine flavescence dorée epidemics in Europe. PLoS Pathog. 2020;16:e1007967. 10.1371/journal.ppat.1007967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.EFSA Panel on Plant Health (PLH), Jeger M, Bragard C et al. Risk to plant health of flavescence dorée for the EU territory. EFSA J. 2016;14:4603. https://data.europa.eu/doi/10.2903/j.efsa.2016.4603. Accessed 04 Mar 2025.
- 10.Boulent J, St-Charles P-L, Foucher S, Théau J. Automatic detection of flavescence dorée symptoms across white grapevine varieties using deep learning. Front Artif Intell. 2020;3:564878. 10.3389/frai.2020.564878. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Chuche J, Thiéry D. Biology and ecology of the flavescence dorée vector Scaphoideus titanus: a review. Agron Sustain Dev. 2014;34:381–403. 10.1007/s13593-014-0208-7. [Google Scholar]
- 12.Carli M, Pedrelli A, Pippi L, Risoli S, Panattoni A, Lorenzini G, et al. Using leaf hyperspectral data to early detect flavescence dorée before the onset of symptoms in a heavily affected vineyard of Tuscany (Central Italy). Plant Dis. 2025. 10.1094/PDIS-04-25-0831-RE. [DOI] [PubMed] [Google Scholar]
- 13.Roggia C, Caciagli P, Galetto L, Pacifico D, Veratti F, Bosco D, et al. Flavescence dorée Phytoplasma titre in field-infected Barbera and Nebbiolo grapevines. Plant Pathol. 2014;63:31–41. 10.1111/ppa.12068. [Google Scholar]
- 14.Eveillard S, Jollard C, Labroussaa F, et al. Contrasting susceptibilities to flavescence dorée in vitis vinifera, rootstocks and wild vitis species. Front Plant Sci. 2016;7:1762. 10.3389/fpls.2016.01762. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Lee I-M, Martini M, Marcone C, Zhu SF. Classification of Phytoplasma strains in the elm yellows group (16SrV) and proposal of ‘Candidatus Phytoplasma ulmi’ for the Phytoplasma associated with elm yellows. Int J Syst Evol Microbiol. 2004;54:337–47. 10.1099/ijs.0.02697-0. [DOI] [PubMed] [Google Scholar]
- 16.Hren M, Boben J, Rotter A, Kralj P, Gruden K, Ravnikar M. Real-time PCR detection systems for flavescence dorée and bois Noir phytoplasmas in grapevine: comparison with conventional PCR detection and application in diagnostics. Plant Pathol. 2007;56:785–97. 10.1111/j.1365-3059.2007.01688.x. [Google Scholar]
- 17.Angelini E, Luca Bianchi G, Filippin L, Morassutti C, Borgo M. A new TaqMan method for the identification of phytoplasmas associated with grapevine yellows by real-time PCR assay. J Microbiol Methods. 2007;68:613–22. 10.1016/j.mimet.2006.11.015. [DOI] [PubMed] [Google Scholar]
- 18.Pelletier C, Salar P, Gillet J, Cloquemin G, Very P, Foissac X, et al. Triplex real-time PCR assay for sensitive and simultaneous detection of grapevine phytoplasmas of the 16SrV and 16SrXII-A groups with an endogenous analytical control. Vitis. 2009;87. 10.5073/VITIS.2009.48.87-95.
- 19.Rossi M, Pegoraro M, Ripamonti M, et al. Genetic diversity of flavescence dorée phytoplasmas at the vineyard scale. Appl Environ Microbiol. 2019;85:e03123–18. 10.1128/AEM.03123-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Rizzo D, Da Lio D, Bartolini L, Francia C, Aronadio A, Luchi N, et al. DNA extraction methods to obtain high DNA quality from different plant tissues. In: Luchi N, editor. Plant pathology. New York, NY: Springer US; 2022. pp. 91–101. 10.1007/978-1-0716-2517-0_5. [DOI] [PubMed] [Google Scholar]
- 21.Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980;8:4321–6. 10.1093/nar/8.19.4321. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull. 1987;19:11–5. [Google Scholar]
- 23.Li R, Mock R, Huang Q, Abad J, Hartung J, Kinard G. A reliable and inexpensive method of nucleic acid extraction for the PCR-based detection of diverse plant pathogens. J Virol Methods. 2008;154:48–55. 10.1016/j.jviromet.2008.09.008. [DOI] [PubMed] [Google Scholar]
- 24.Inglis PW, Pappas MDCR, Resende LV, Grattapaglia D. Fast and inexpensive protocols for consistent extraction of high quality DNA and RNA from challenging plant and fungal samples for high-throughput SNP genotyping and sequencing applications. PLoS ONE. 2018;13:e0206085. 10.1371/journal.pone.0206085. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Dar GJ, Nazir R, Wani SA, Farooq S, Aziz T, Albekairi TH. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: insights from multilocus gene amplification. Open Life Sci. 2025;20:20221006. 10.1515/biol-2022-1006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Casati P, Jermini M, Quaglino F, Corbani G, Schaerer S, Passera A, et al. New insights on flavescence dorée Phytoplasma ecology in the vineyard agro-ecosystem in Southern Switzerland. Ann Appl Biol. 2017;171:37–51. 10.1111/aab.12359. [Google Scholar]
- 27.Krstić O, Cvrković T, Marinković S, Jakovljević M, Mitrović M, Toševski I, et al. Genetic diversity of flavescence dorée phytoplasmas in vineyards of serbia: from the widespread occurrence of autochthonous map-M51 to the emergence of endemic map-FD2 (Vectotype II) and new map-FD3 (Vectotype III) epidemic genotypes. Agronomy. 2022;12:448. 10.3390/agronomy12020448. [Google Scholar]
- 28.Pedrelli A, Carli M, Panattoni A, Pellegrini E, Rizzo D, Nali C, et al. Investigating a new alarming outbreak of flavescence dorée in Tuscany (Central Italy): molecular characterization and map gene typing elucidate the complex Phytoplasma ecology in the vineyard agroecosystem. Front Plant Sci. 2024;15:1489790. 10.3389/fpls.2024.1489790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Gao Y, Yin X, Jiang H, et al. Comprehensive leaf cell wall analysis using carbohydrate microarrays reveals polysaccharide-level variation between vitis species with differing resistance to downy mildew. Polym (Basel). 2021;13:1379. 10.3390/polym13091379. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Štambuk P, Anić M, Huzanić N, Preiner D, Karoglan M, Kontić J, et al. A simple method for the determination of polyphenolic compounds from grapevine leaves. Separations. 2022;9:24. 10.3390/separations9020024. [Google Scholar]
- 31.Berges R, Rott M, Seemüller E. Range of Phytoplasma concentrations in various plant hosts as determined by competitive polymerase chain reaction. Phytopathology. 2000;90:1145–52. 10.1094/PHYTO.2000.90.10.1145. [DOI] [PubMed] [Google Scholar]
- 32.Schrader C, Schielke A, Ellerbroek L, Johne R. PCR inhibitors – occurrence, properties and removal. J Appl Microbiol. 2012;113:1014–26. 10.1111/j.1365-2672.2012.05384.x. [DOI] [PubMed] [Google Scholar]
- 33.Lemke L, Rex L, Zyprian E, Töpfer R. A simple, inexpensive and environmentally friendly method for high throughput DNA extraction from grapevine (Vitis spp). Vitis. 2011;50:7–10. [Google Scholar]
- 34.Akkurt M. Comparison between modified DNA extraction protocols and commercial isolation kits in grapevine (Vitis vinifera L). Genet Mol Res. 2012;11:2343–51. 10.4238/2012.August.13.8. [DOI] [PubMed] [Google Scholar]
- 35.Prezelj N, Nikolić P, Gruden K, Ravnikar M, Dermastia M. Spatiotemporal distribution of flavescence dorée Phytoplasma in grapevine. Plant Pathol. 2013;62:760–6. 10.1111/j.1365-3059.2012.02693.x. [Google Scholar]
- 36.Rotter A, Nikolić P, Turnšek N, Kogovšek P, Blejec A, Gruden K, et al. Statistical modeling of long-term grapevine response to ‘Candidatus Phytoplasma solani’ infection in the field. Eur J Plant Pathol. 2018;150:653–68. 10.1007/s10658-017-1310-x. [Google Scholar]
- 37.Haro C, Anguita-Maeso M, Metsis M, Navas-Cortés JA, Landa BB. Evaluation of established methods for DNA extraction and primer pairs targeting 16S rRNA gene for bacterial microbiota profiling of Olive xylem Sap. Front Plant Sci. 2021;12:640829. 10.3389/fpls.2021.640829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Wright AA, Shires M, Molnar C, Bishop G, Johnson A, Frias C, et al. Titer and distribution of ‘Candidatus Phytoplasma pruni’ in Prunus avium. Phytopathology. 2022;112:1406–12. 10.1094/PHYTO-11-21-0468-R. [DOI] [PubMed] [Google Scholar]
- 39.Selz J, Adam NR, Magrini CEM, Montandon FM, Buerki S, Maerkl SJ. A field-capable rapid plant DNA extraction protocol using microneedle patches for botanical surveying and monitoring. Appl Plant Sci. 2023;11:e11529. 10.1002/aps3.11529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Pierro R, Moussa A, Mori N, Marcone C, Quaglino F, Romanazzi G. Bois Noir management in vineyard: a review on effective and promising control strategies. Front Plant Sci. 2024;15:1364241. 10.3389/fpls.2024.1364241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Truett GE, Heeger P, Mynatt RL, Truett AA, Walker JA, Warman ML. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and Tris (HotSHOT). Biotechniques. 2000;29:52–4. 10.2144/00291bm09. [DOI] [PubMed] [Google Scholar]
- 42.Boudon-Padieu E, Béjat A, Clair D, Larrue J, Borgo M, Bertotto L, Angelini E. Grapevine yellows: comparison of different procedures for DNA extraction and amplification with PCR for routine diagnosis of phytoplasmas in grapevine. Vitis. 2003;42:141. 10.5073/VITIS.2003.42.141-149. [Google Scholar]
- 43.EPPO. PM 7/079 (2) Grapevine flavescence dorée phytoplasma. EPPO Bull. 2016;46:78–93. 10.1111/epp.12280
- 44.Deng S, Hiruki C. Genetic relatedness between two nonculturable Mycoplasmalike organisms revealed by nucleic acid hybridization and polymerase chain reaction. Phytopathology. 1991;81:1475. 10.1094/Phyto-81-1475. [Google Scholar]
- 45.Lee I-M. Use of Mycoplasmalike organism (MLO) Group-specific oligonucleotide primers for nested-PCR assays to detect mixed-MLO infections in a single host plant. Phytopathology. 1994;84:559. 10.1094/Phyto-84-559. [Google Scholar]
- 46.Zhao Y, Wei W, Lee I-M, Shao J, Suo X, Davis RE. Construction of an interactive online Phytoplasma classification tool, iPhyClassifier, and its application in analysis of the Peach X-disease Phytoplasma group (16SrIII). Int J Syst Evol Microbiol. 2009;59:2582–93. 10.1099/ijs.0.010249-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Hall T. BioEdit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95–8. [Google Scholar]
- 48.Plavec J, Budinšćak Ž, Križanac I, Škorić D, Foissac X, Šeruga Musić M. Multilocus sequence typing reveals the presence of three distinct flavescence dorée Phytoplasma genetic clusters in Croatian vineyards. Plant Pathol. 2019;68:18–30. 10.1111/ppa.12934. [Google Scholar]
- 49.Radonjić S, Krstić O, Cvrković T, Hrnčić S, Marinković S, Mitrović M, et al. The first report on the occurrence of flavescence dorée Phytoplasma affecting grapevine in vineyards of Montenegro and an overview of epidemic genotypes in natural plant reservoirs. J Plant Pathol. 2023;105:419–27. 10.1007/s42161-023-01318-z. [Google Scholar]
- 50.Qiagen. QIAexpert manual. 2021. https://www.qiagen.com/us/resources/resourcedetail?id=e41041ee-99a7-404a-9494-08f07e3afed3⟨=en. Accessed 30 March 2025.
- 51.Hamelin C, Yelle J. Gel and buffer effects on the migration of DNA molecules in agarose. Appl Theor Electrophor. 1990;1:225–31. [PubMed] [Google Scholar]
- 52.Taberlet P, Coissac E, Pompanon F, Gielly L, Miquel C, Valentini A, et al. Power and limitations of the Chloroplast TrnL (UAA) intron for plant DNA barcoding. Nucleic Acids Res. 2007;35:e14. 10.1093/nar/gkl938. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Hao DC, Huang BL, Chen SL, Mu J. Evolution of the Chloroplast trnL-trnF region in the gymnosperm lineages Taxaceae and cephalotaxaceae. Biochem Genet. 2009;47:351–69. 10.1007/s10528-009-9233-7. [DOI] [PubMed] [Google Scholar]
- 54.Šikuten I, Štambuk P, Andabaka Ž, Tomaz I, Marković Z, Stupić D, et al. Grapevine as a rich source of polyphenolic compounds. Molecules. 2020;25:5604. 10.3390/molecules25235604. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Pérez-Magariño S, Cano-Mozo E, Bueno-Herrera M, Canalejo D, Doco T, Ayestarán B, et al. The effects of grape polysaccharides extracted from grape by-products on the chemical composition and sensory characteristics of white wines. Molecules. 2022;27:4815. 10.3390/molecules27154815. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Demeke T, Jenkins GR. Influence of DNA extraction methods, PCR inhibitors and quantification methods on real-time PCR assay of biotechnology-derived traits. Anal Bioanal Chem. 2010;396:1977–90. 10.1007/s00216-009-3150-9. [DOI] [PubMed] [Google Scholar]
- 57.Samarakoon T, Wang SY, Alford MH. Enhancing PCR amplification of DNA from recalcitrant plant specimens using a trehalose-based additive. Appl Plant Sci. 2013;1:1200236. 10.3732/apps.1200236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Rački N, Dreo T, Gutierrez-Aguirre I, Blejec A, Ravnikar M. Reverse transcriptase droplet digital PCR shows high resilience to PCR inhibitors from plant, soil and water samples. Plant Methods. 2014;10:42. 10.1186/s13007-014-0042-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Javaid A, Hamid A, Ali G, Shikari A, Saleem S, Wani SH, et al. Extraction of high-quality genomic DNA from plants using modified CTAB-based method. In: Hamid A, Ali G, Shikari A, Saleem S, Wani SH, Wani S, editors. Detection of plant viruses. New York (NY): Humana; 2025. 10.1007/978-1-0716-4390-7_13. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data generated or analysed during this study are included in this published article and its additional file 1. The nucleotide sequences have been deposited in the NCBI database.






