Fusobacterium nucleatum enhances oxaliplatin resistance in colon cancer by increasing PVT1 expression

Abstract

Background

Approximately 50% of colorectal cancer (CRC) patients exhibit high levels of Fusobacterium nucleatum (Fn), which is associated with chemotherapy resistance. As Fn itself cannot be directly targeted for therapy in vivo, elucidating the mechanism underlying Fn-induced chemotherapy resistance is crucial, though it remains unclear.

Methods

qPCR was used to analyze the correlation between Fn abundance and clinical parameters in 80 human colon cancer samples. The effect of Fn on the sensitivity of colon cancer cells to oxaliplatin was evaluated by clone formation, EdU proliferation and apoptosis assays. RNA sequencing was performed on Fn-infected colon cancer cells to identify differentially expressed genes. Mechanistic studies explored the interaction between PVT1 and ATAD3A, and the role of TLR4/NF-κB pathway in regulating PVT1 expression.

Results

qPCR experiments showed that Fn abundance was associated with later clinical stage and shorter RFS. Clone formation, EdU proliferation assay and apoptosis assay showed that Fn could change the sensitivity of colon cancer cells to oxaliplatin. Further RNA sequencing showed that Fn infection could upregulate the expression of long noncoding RNA plasmacytoma variant translocation 1 (PVT1) in colon cancer cells. The abundance of Fn in colon cancer tissues was positively correlated with the level of PVT1, and the mechanism was that PVT1 binds to AAA domain protein 3 (ATAD3A) and prevents its ubiquitination. Fn upregulates ATAD3A expression through PVT1 and inhibits ER stress-mediated cell death. In addition, in colon cancer cells co-cultured with Fn, PVT1 expression is regulated by the TLR4/NF-κB pathway.

Conclusions

This study delineates a pathway where Fn infection promotes oxaliplatin resistancein colon cancer cells by upregulating PVT1 via the TLR4/NF-κB pathway. PVT1 subsequently stabilizes ATAD3A, suppressing cell death. PVT1 is a potential target to overcome the high abundance of Fusobacterium nucleatum leading to oxaliplatin resistance in colon cancer.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12967-025-07226-3.

Introduction

Colorectal cancer (CRC) ranks third in global incidence and second in mortality among malignant tumors [1, 2]. Although significant progress has been made in developing surgical methods and drug treatments in recent years, the mortality rate of CRC remains high, making it the primary factor endangering human life and health [3, 4]. Resistance of colon cancer to chemotherapy is an important cause of recurrence, metastasis and death. Oxaliplatin (OXA) is one of the key drugs used for colon cancer chemotherapy. It is a platinum chemotherapy drug that mainly binds to DNA in cancer cells, interferes with DNA replication and transcription, and thus induces cancer cell apoptosis [5, 6]. Recent research suggests that imbalances in intestinal flora can modify the tumor microenvironment, contributing to chemotherapy resistance in colon cancer [7, 8]. A study found that over 50% of CRC tissues are infected with Fusobacterium nucleatum (Fn), potentially a significant yet under-researched factor in chemotherapy resistance [9–11]. However, the specific mechanism by which Fn causes drug resistance in colon cancer is still unclear, resulting in no progress in chemotherapy sensitization treatment for patients with higher abundance of Fn. The mechanism underlying tumor chemotherapy resistance includes many factors, including epigenetic regulatory mechanisms, such as lncRNAs, which serve a critical function in tumor chemotherapy resistance [12–16]. Studies have shown that the lncRNA plasmacytoma variant translocation 1 (PVT1) affects apoptosis and autophagy in lung cancer, thereby contributing to cisplatin resistance [17]. Zhou et al. reported that the expression level of PVT1 is remarkably high in the tissues and cell lines of gemcitabine-resistant pancreatic cancer patients [15]. PVT1 is potentially implicated in tumor resistance to chemotherapy, yet its role and mechanism in colon cancer chemotherapy resistance remain unexplored. This study revealed that Fn enhances Oxaliplatin resistance in colon cancer by increasing PVT1 expression, with a high presence of Fn correlating with elevated PVT1 expression. Further analysis indicated that PVT1 influences colon cancer chemotherapy resistance by interacting with the key protein AAA domain-containing protein 3 (ATAD3A) and the detailed molecular regulatory mechanism by which the PVT1–ATAD3A/HSPA5-PERK/eIF2α signaling axis contributes to Fn-mediated chemotherapy resistance in colon cancer was revealed.

Our study showed that PVT1 is a key molecule mediating oxaliplatin resistance in colon cancer induced by Fn.

Methods

Human specimens

A retrospective analysis of clinical data was performed on colon cancer patients who underwent surgery at the Fourth Hospital of Hebei Medical University between 2021 and 2022, with none receiving preoperative treatment. A total of 80 patients (41 stage I-II and 39 stage III) were included in this study. qPCR was conducted on freshly excised colon cancer tissues and their corresponding normal tissues obtained during surgery. Prognostic information was collected through the medical record system and telephone follow-up. The Ethics Committee of Hospital approved the study. All participants provided informed consent before joining the study.

Bacterial strain, cell lines

The Fusobacterium nucleatum strain ATCC 25586 was obtained from the China General Microbiological Culture Collection Center (CGMCC) in Beijing, China. Fusobacterium nucleatum was grown on Columbia blood agar (Jinan Baibo Biotechnology Co., Ltd.) in anaerobic jars (HITECH, Guangzhou, China) at 37 °C.

Human normal colon epithelial cells (NCM460) along with colon cancer lines (HCT116, SW620, SW480, HT29) and HEK293T cells were acquired from the Research Center of the Fourth Hospital of Hebei Medical University (Shijiazhuang, China). Short tandem repeat (STR) profiling was employed to authenticate these cell lines. The cells were cultured in RPMI 1640 or DMEM medium, both supplemented with 10% fetal bovine serum (FBS). Incubation took place in a 37 °C, 5% CO₂ incubator manufactured by Thermo (USA).

For the Fn infection assay, cells were cultured in antibiotic-free medium and co-incubated with Fn at an MOI of 100:1, as previously described [7, 18].

Extract rna and conduct qPCR analysis

Total RNA was isolated from tissue specimens or colon cancer cell lines by TRIzol reagent. After that, a TIANGEN reverse transcription kit (Beijing,China) was employed to reverse-transcribe it into cDNA. Quantitative real-time PCR was then carried out on an ABI 7500 system (USA) using Superbrilliant ZAPA SYBR Green qPCR Master Mix (Zsgentech, Tianjin, China) to assess the cDNA. Each sample underwent triplicate testing, and results were analyzed via the 2^-ΔΔCt method. Table 1 shows the detailed primer information.

Table 1.

Primer sequence and Sequence of siRNA

Primer sequence	Forward （5’−3’ ）	Reverse （5’−3’)
ATAD3A	GAGCAGGCACCCCAGTTAAT	ATTTGTGGTTGGGTCAGGGG
Fn	CAACCATTACTTTAACTCTACCATGTTCA	GTTGACTTTACAGAAGGAGATTATGTAAAAATC
PGT	ATCCCCAAAGCACCTGGTTT	AGAGGCCAAGATAGTCCTGGTAA
B-actin	GAGCACAGAGCCTCGCCTTT	TCATCATCCATGGTGAGCTGG
PVT1	GCCATAGATCCTGCCCTGTTTGC	TCCTCAGCCTCCAAGCGTTCC
U6	GTGCTCGCTTCGGCAGCACAT	GTTTAAGCACTTCGCAAGGTA
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG
Sequence of siRNA	Sense 5’−3’
TLR4 siRNA	GGGCUUAGAACAACUAGAATT
P65 siRNA	GCCCUAUCCCUUUACGUCATT
PVT1 siRNA-1	CCAAACUGCCGAGGAUUAUTT
PVT1 siRNA-2	GCAGCCAUGAAGAAUGAAATT
Control siRNA	UUCUCCGAACGUGUCACGUTT

Fn quantification

Fn quantitative analysis was performed as previously described [7, 19], gDNA was isolated from colon cancer tissue with the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany). Relative abundance was calculated by 2^−ΔCt method. PGT served as the reference gene [7].

Rna sequencing

Total RNA was isolated from HCT116 cells that had been infected with Fn for 24 h or had not been infected with Fn for 24 h. RNA integrity was verified using a Bioanalyzer 2100 (Agilent, California, USA). Finally, 2 × 150 bp double-end sequencing (PE150) was performed on an Illumina Novaseq^TM 6000 (LC-Bio Technology CO., Ltd., Hangzhou, China) according to the supplier’s protocol. StringTie was used to calculate FPKM for mRNAs and lncRNAs to evaluate their expression levels. Differentially expressed mRNAs and lncRNAs (|log₂ (fold change) | > 1, p<0.05 by parametric F-test for nested linear models via the edgeR R package) were identified [20].

Western blotting assay

Cellular proteins were extracted using RIPA buffer (Solarbio, China). These proteins were separated by SDS-polyacrylamide gel electrophoresis and then transferred to a PVDF membrane (Millipore, USA). They were closed with rapid closure solution (NCM, China) for 20 min at room temperature. Following this, the samples were treated with a primary antibody overnight at 4 °C, followed by incubation with a secondary antibody for 1 h at room temperature. The strips were scanned by an Odyssey infrared imaging system (LI-COR Biosciences, Lincoln, Nebraska, USA) and quantified using Image-J software.The antibodies and other reagents used are shown in Table 2.

Table 2.

Source of reagents or resource

Reagents or Resource	Source
NF-κB p65 (D14E12) XPⓇ Rabbit mAb	Cell Signaling Technology,#8242
Phospho-NF-κB p65 (Ser536) (93H1) Rabbit mAb	Cell Signaling Technology,#3033
Anti-TLR4 antibody	Abcam,ab13556
Anti-MyD88 antibody	Abcam,ab133739
Anti-ATAD3A antibody	Santa Cruz,sc-376185
Anti-HSPA5 antibody	PTM BIO,PTM-5779
Anti-PERK antibody	Cell Signaling Technology,#3192
Anti-P-PERK antibody	Cell Signaling Technology,#3179
Anti-eIF2α antibody	Cell Signaling Technology,#5324
Anti-p-eIF2α antibody	Cell Signaling Technology,#9721
anti-ubiquitin antibody	Proteintech,10201-2-AP
Anti-B-actin antibody	Proteintech,20536-1-AP
The secondary antibodies goat anti-mouse	Abbkine,A23710
The secondary antibodies goat anti-rabbit	Abbkine,A23920
Antibody Diluent	Absin,abs954
Oxaliplatin	MedChemExpress,HY-17371
Cycloheximide	MedChemExpress,HY-12320
MG132	MedChemExpress,HY-13259

Apoptosis assay

The experimental cells were digested, centrifuged, and washed, and then operated according to the instructions using PE Annexin V Apoptosis Detection Kit (BD, USA), and flow cytometric analysis was performed using a flow cytometer (Beckman, California, USA), and the data were analyzed using FlowJo software.

EdU cell proliferation assay

The BeyoClick EdU Cell Proliferation Kit with Alexa Fluor 488 (China) was utilized to evaluate cell proliferation, following the manufacturer’s guidelines. Around 10 × 10⁴ cells were plated in 12-well plates and allowed to incubate for 24 h before the assay. The cells were then exposed to 10 μM EdU reagent for 2 h, fixed with 4% paraformaldehyde, and stained with fluorescent dye and Hoechst. EdU-positive cells were visualized with a Nikon confocal microscope (Japan), and their quantification was carried out using Photoshop software.

Cell proliferation assay and drug cytotoxicity assay

Cells were inoculated in 96-well plates at a density of 2 × 10³ per well. After 24 h of incubation, the medium was renewed with complete medium containing different oxaliplatin concentrations. The cell inhibition rate was assessed after a further 48 h of incubation using the CCK-8 assay (MedChemExpress, USA) following the manufacturer’s instructions.

The percentage of viable cells was determined by CCK-8 assay under different treatment conditions. Briefly, cells were seeded in 96-well plates with 100 μL of culture medium. 10 μL of CCK8 solution was added to each well at the indicated time points and incubated at 37°C for 2 h.The reaction product was assessed by measuring the optical absorbance at 450 nm using a microplate reader (BioTek).

Plate clone-formation assay

Cells were plated in six-well plates at a density of 1.0 × 10³ cells per well and subjected to different treatments. After three weeks, the cells were fixed with 4% paraformaldehyde (White Shark, Hefei, China) at room temperature for 30 min, followed by staining with crystal violet (Solarbio, China) for 15 min. Next, they were washed with water, air-dried, and photographed. The colony counts were determined by capturing images and analyzing them with Image-J software. All experiments were repeated three times.

Immunofluorescence assay

Cells were inoculated at a density of 2 × 10⁴ in each 15-mm confocal dish and fixed with 4% formaldehyde. The samples were treated with 0.3% Triton X-100 for permeabilization for 10 min, and then blocked with 10% goat serum (Proteintech, China) for 30 min. After sealing, the cells were incubated with diluted primary antibody at 4 °C overnight. After washing the cells three times with PBST, the cells were incubated with the secondary antibody. Cell nuclei were labeled with DAPI (Solarbio, China) and visualized using a Nikon A1RHD25 confocal laser scanning microscope.

Rna fluorescence in situ hybridization (fish)

RNA FISH were performed using the Ribo^TM Fluorescence In Situ Hybridization Kit (Ribobio, China), following the manufacturer’s instructions. Probes for PVT1, 18S RNA, and U6 were labeled with Cy3 dye. A total of 20,000 cells were inoculated in 15 mm confocal dishes, fixed with 4% formaldehyde and permeabilized with 0.3% Triton X-100 for 20 min. Cells were incubated in pre-hybridization buffer at 37 °C for 40 min. Cells were incubated with 2 µL of probe at 37 °C for 18 h. After washing in SSC buffer, samples were stained with DAPI for 20 min and then imaged using a Nikon A1RHD25 confocal laser scanning microscope.

Nuclear and cytoplasmic rna isolation

RNA was isolated using the Cytoplasmic and Nucleus RNA Purification Kit (Norgen Biotek, Canada) according to the instructions provided by the manufacturer. Subsequently, the expression levels of PVT1, GAPDH and U6 in the nucleus and cytoplasm were determined by qPCR.

Rna immunoprecipitation (Rip)

The RIP was conducted following the manufacturer’s guidelines using the Magna RIP RNA Binding Protein Immunoprecipitation Kit (Millipore, USA). Post-harvest, cells were lysed and incubated overnight at 4 °C with anti-ATAD3A antibody (Santa Cruz, sc-376185, USA) and immunoglobulin G (Santa Cruz, sc-2025, USA). The coprecipitated RNA was then adsorbed using magnetic beads (Invitrogen, USA) and analyzed via qPCR.

ChIRP-MS

Total protein lysate from HCT116 cells and SW480 was incubated at 30 °C with two sets of ChIRP probes synthesized by RiboBiotechnologies (RiboBio,China) : probe 1 and probe 2. Pierce™ Streptavidin Magnetic Beads (Thermo Scientific) were introduced to each binding reaction and incubated at room temperature with rotation. The RNA-protein bead complex underwent washing with a buffer, followed by protein loading and denaturation at 100 °C for 5 min. Add the sample to the electrophoresis gel for electrophoresis. After the bromophenol blue runs out, perform the silver staining experiment. When differential bands appear, stop the silver staining and cut the gel for mass spectrometry analysis. (LC-MS/MS, thermo, QExactive HF, USA)

Rna-pulldown

GenePharma (Suzhou,China) supplied full-length sense, antisense, and truncated pUC57–T7–PVT1 plasmids. These plasmids were linearized using Takara restriction endonucleases (Japan) and used as templates to transcribe PVT1 forward, reverse, and truncated probes. Biotin-labeled RNA was then synthesized in vitro using a biotin-RNA labeling mix (Roche, Indianapolis, IN, USA). Post-synthesis, the product was treated with RNase-free DNase I (Takara, Kyoto, Japan) and purified using LiCl (Invitrogen, USA). Biotinylated PVT1 probes were precipitated by Pierce™ Streptavidin Magnetic Beads (Thermo Scientific) and incubated with HCT116 cell protein lysates. The RNA-protein bead complexes were washed with buffer, boiled in 1×loading buffer for 5 min, and analyzed via Western Blot.

Co-ip

Cells were lysed using mild RIPA(Solarbio,Beijing, China) buffer. Lysates were incubated with 2 µg of specific primary antibody and spun at 4 °C overnight. Proteins bound to magnetic beads (BEAVER, Jiangsu, China) were eluted by heating at 95 °C for 5 min. Eluted proteins were separated using SDS-PAGE, transferred to a PVDF membrane and probed with specific antibodies.

Dual luciferase reporter assay

Plasmids were designed and constructed by Public Protein/Plasmid library (PPL, China). The PVT1 promoter region containing wild-type (WT) or mutant (MT) NF-κB p65 binding sites was cloned into the pGL3-Promoter vector. These constructs were used to transfect HEK293T cells with si-p65 or si-NC (Ribobio, China) using Lipofectamine 2000 (Invitrogen, USA). The Dual Luciferase Reporter Gene Assay System (Promega, USA) was used for luciferase reporter gene assay. Luciferase activity was measured and normalized to Renilla luciferase as an internal control.

Constructs and transfection

The full-length and truncated ATAD3A plasmids (His-ATAD3A) were procured from GeneChem (Shanghai, China). The NEOFECT DNA transfection reagent (NEOFECT, China) was used to transfect these plasmids into HEK293T cells. Small interfering RNAs (siRNAs) aiming at PVT1, TLR4, and p65 were synthesized by Ribobio (China)，The sequences of siRNA are shown in Table 1.

Xenograft tumor formation assay in mice model

Twenty male BALB/c nude mice (4 weeks old) were obtained from Beijing Huafukang Biotechnology Co., Ltd. and housed in specific pathogen-free (SPF) conditions. All groups were implanted subcutaneously with 6 × 10⁶ HCT116 cells on the right side of the mice.The mice were randomly allocated into four experimental groups (n = 5 per group) one week following subcutaneous inoculation. Intratumoral delivery of Fn and siRNA was conducted at multiple sites using Entranster™-in vivo transfection reagent (Engreen, China) following the manufacturer’s protocol [8], with treatments administered every 3 days for a total of five administrations. Concurrently, oxaliplatin (MCE, USA) was delivered via intraperitoneal injection at a dosage of 6 mg/kg twice weekly over a 14-day treatment period. Upon completion of the experimental protocol, euthanasia was performed and subcutaneous neoplasms were harvested for gravimetric analysis. Tumor size was measured, and the volume was calculated using the standard formula: (length×width²)/2. All experimental manipulations were performed in strict accordance with institutional animal care protocols and approved by the Institutional Animal Care and Use Committee of the Fourth Hospital of Hebei Medical University.

IHC

Tumors were fixed in 4% paraformaldehyde and paraffin-embedded. Immunohistochemistry (IHC) assays were conducted as reported previously [21]. The relative staining score was calculated using an IHC scoring approach considering the proportion of positively-stained cells and staining intensity. The proportion of positive cells was scored as: 0 (0–5%), 1 (6–25%), 2 (26–50%), 3 (51–75%), and 4 ( > 75%). Staining intensity was scored as 0 (negative), 1 (weak), 2 (moderate), or 3 (strong). Samples were classified into low (0–6) or high (7–12) expression groups according to the immunohistochemistry (IHC) score, which was determined by multiplying the intensity score by the percentage score.

Statistical analysis

Statistical and bioinformatics analyses followed previous methods. Spearman correlation assessed gene correlations. Chi-square tests were used for enumeration data with theoretical frequencies over 5, and Fisher’s exact test for frequencies 5 or below. Student’s t-test compared two groups, while one-way ANOVA was used for three or more groups, following a normality test. Nonparametric tests were applied if data weren’t normally distributed. Xenograft assays used one-way ANOVA. Analyses were conducted with GraphPad Prism 10, with experiments repeated three times. Significance levels were *p<0.05, *p<0.01, ***p<0.001.

Results

Results 1. The abundance of fn in colon cancer tissues is associated with recurrence, and fn induces oxa resistance in colon cancer

To clarify the association between Fn abundance and colon cancer, we employed quantitative PCR (qPCR) to quantify Fn DNA levels in 80 pairs of colon tumor and neighboring tissues. The results demonstrated that Fn DNA levels were elevated in tumor tissues in contrast to neighboring tissues (Fig. 1A). The Fn DNA levels in stage III colon cancer tissues (n = 39) were higher compared to stage I and II colon cancer (n = 41) (Fig. 1B). Furthermore, the Fn DNA level in tumor tissues of patients with relapse (n = 30) was greater than that of patients without relapse (n = 50) (Fig. 1C).

Fig. 1.

(A) Relative Fn DNA levels in colon cancer tissues versus paired adjacent tissues (n = 80). (B) Fn abundance (−ΔCt) in colon cancer tissues stratified by tumor stage: I-II (n = 41) versus III (n = 39). (C) Fn abundance (−ΔCt) in colon cancer tissues categorized by clinical outcome: non-relapsed (n = 50) versus relapsed cases (n = 30). (D) Kaplan-Meier analysis evaluated the 4-year RFS of patients based on low or high Fn abundance levels. (E) Cells were cultured in the presence or absence of Fn and treated with different concentrations of OXA for 48 h. Cell viability was measured using the CCK8 assay and the IC50 was determined. As shown by the dotted line, the IC50 of OXA in HCT116 cells was approximately 3.82 μM, and in SW480 cells was approximately 4.99 μM (n = 3). (F) Cells were cultured with or without Fn and treated with IC50-OXA, and viability was assessed using the CCK8 assay at various time periods (n = 3). (G) Edu proliferation assay was employed to compare cells treated with IC50-OXA or IC50-OXA+Fn to untreated cells (n = 3). (Scale bar = 100 μm). (H) The Colony formation assay was utilized to compare cells treated with IC50- OXA or IC50-OXA+Fn to non - treated cells (n = 3). (I) Cells were cultured with or without Fn and treated with IC50-OXA for 48 h. Flow cytometry was employed to detect cell apoptosis (n = 3). *p<0.05, **p< 0.01, ***p<0.001

Previous research determined a 0.01 (2^-ΔCt) cutoff for differentiating high and low Fn levels, based on the Fn DNA to PGT gene ratio [7, 8, 22]. We identified 55 and 25 patients with low and high Fn abundances, respectively. No significant differences in sex, age, tumor location, size, pathological grade, or nerve and vascular invasion were noted between the groups (Table 3). However, 72.0% (18/25) of patients in the high-abundance group had stage III tumors compared to 38.18% (21/55) in the low-abundance group. Additionally, 64.0% (16/25) of the high-abundance group experienced relapses, while only 25.45% (14/55) in the low-abundance group did.Patients in the Fn-high group had a shorter four-year recurrence-free survival (RFS) (Fig.1D). The results indicate a notable correlation between Fn levels and tumor stage, recurrence, and chemotherapy resistance in colon cancer.

Table 3.

Pathological and clinical information of 80 patients with colon cancer

	n	Fn		χ2	p value
		low	high
Characteristics	80	55	25
Age				0.42229	0.516
＜60	31	20	11
≥60	49	35	14
Gender				0.295	0.587
Male	38	25	13
Female	42	30	12
Tumor location				0. 1537	0.695
Distal colon	39	26	13
Proximal colon	41	29	12
Tumor size				0.683	0.408
＜5 cm	33	21	12
≥5 cm	47	34	13
TNM stage				7.8676	0.005
I+II	41	34	7
III	39	21	18
Histological grade				0.630	0.427
1+2	62	44	18
3+4	18	11	7
Vascular invasion				1.4047	0.236
Negative	70	46	24
Positive	10	9	1
Nerve invasion				0.510	0.475
Negative	66	47	19
Positive	14	8	6
Recurrence				10.896	＜0.001
Non-recurrence	50	41	9
Recurrence	30	14	16

To investigate Fn‘s impact on chemoresistance, colon cancer cells were exposed to different OXA concentrations. Results showed that Fn reduced oxaliplatin’s cytotoxicity on colon cancer cells (Fig.1E). Cells were either infected with Fn or left uninfected and then subjected to oxaliplatin at its IC50 value，and cell viability was evaluated at specified intervals.Aligned with earlier research, Fn infection notably decreased oxaliplatin cytotoxicity following 24 or 48 h of treatment(Fig.1F). The EdU proliferation assay and colony formation analysis both demonstrated that Fn reduces OXA’s inhibitory impact on colon cancer cell proliferation and colony formation, respectively (Fig. 1 G-H). To examine if Fn infection shields colon cancer cells from oxaliplatin-induced apoptosis, cells were cocultured with Fn for 24 h, with or without the IC50 concentration of oxaliplatin. Annexin VPE/7ADD double staining in flow cytometry quantified apoptotic cell percentages across groups. The results indicated that Fn mitigated the apoptosis of colon cancer cells induced by oxaliplatin (Fig. 1I). These findings collectively indicate that Fn infection decreases the chemosensitivity of colon cancer cells to oxaliplatin in vitro.

Results 2. PVT1 expression is upregulated in fn treated colon cancer cells

Numerous previous studies have demonstrated that lncRNAs play a significant role in the chemoresistance of colon cancer [14, 23, 24]. To evaluate the impact of lncRNAs on chemoresistance in colon cancer due to Fn infection, we performed RNA sequencing of HCT116 cells infected with Fn for 24 h or not. The aim was to analyze the expression profiles of lncRNAs (Fig. 2A). RNA sequencing revealed that Fn treatment significantly altered lncRNA expression, with 99 lncRNAs upregulated and 95 downregulated (p < 0.05, |log2 (fold change)| > 1). Among them, PVT1 was one of the most upregulated lncRNAs, with log2 (fold change) = 5.45. Notably, several studies have indicated an association between PVT1 and tumor chemoresistance [15, 17, 25]. We conducted qPCR to validate the association between Fn infection and PVT1 expression. Colon cancer cells and NCM460 cells were co-cultured with or without Fn for 24 h before the qPCR. In line with the sequencing results, PVT1 was overexpressed in Fn-infected colon cancer cells, while no such upregulation was observed in Fn-infected normal cells. Among them, the upregulation degree was the highest in HCT116 and SW480, and these two cell lines were selected for subsequent experiments (Fig. 2B). In the GEPIA database, PVT1 expression was increased in colon tumor tissues relative to normal neighboring tissues (Fig. 2C). To assess the clinical importance of Fn and PVT1 in colon cancer patients, qPCR measured PVT1 levels in colon tumor tissues and neighboring tissues. The findings indicated that PVT1 was elevated in colon tumor tissues (Fig. 2D) and positively correlated with Fn abundance (Fig. 2E). Furthermore, in patients with stage III tumors, we found that patients with high abundance of Fn had higher relative expression levels of PVT1 than those with low abundance of Fn (Fig. 2F). Moreover, high PVT1 expression is linked to poor clinical outcomes. KM plotter database analysis shows that colon cancer patients with elevated PVT1 levels have significantly shorter OS and RFS compared to those with lower levels, suggesting a poor prognosis for patients with high PVT1 expression (Fig. 2G–H). We then used FISH (Fig. 2I) and a subcellular fractionation assay (Fig. 2J) showed that PVT1 is predominantly cytoplasmic. Following a 24-hour incubation with Fn or PBS, FISH analysis indicated an upregulation of PVT1 expression in cells treated with Fn (Fig. 2K). These data indicate that Fn can elevate PVT1 expression in colon cancer cells.

Fig. 2.

(A) A heatmap was generated to show representative differentially expressed lncRnas in HCT116 cells co-cultured with fn compared to untreated ones. Each group consisted of n = 3 samples, with selection criteria of |log2fc| ≥ 1 and p<0.05. (B) The levels of PVT1 were analyzed by qPCR in HCT116, HCT29, SW480, and SW620 and NCM460 24 h post-infection with Fn (n = 3). (C) In the GEPIA database, PVT1 is upregulated in colon cancer tissues. (D) The expression of PVT1 in 80 colon cancer tissues was compared with that in the adjacent non-cancerous tissues. (E) Evaluation of the relationship between the level of fn and PVT1 expression. (F) The levels of PVT1 were compared between patients with high abundance of fusobacterium nucleatum and those with low abundance in stage III patients. (G-H) The RFS and OS survival curves of PVT1 in colon cancer were analyzed online according to the KM-plot website. (I-J) FISH and nuclear-cytosolic RNA analyses indicated that PVT1 is primarily localized in the cytoplasm of cells. (scale bar = 50 μm). (K) The cells were co-cultured with fn for 24 h. fish was performed to detect PVT1 in the cells (scale bar = 50 μm). *p< 0.05, **p<0.01, ***p< 0.001

Results 3. fn promotes oxa resistance in colon cancer cells by regulating PVT1

Prior research have shown that PVT1 is elevated in Fn-treated HCT116 cells. We speculate that Fn may enhance colon cancer cell resistance to oxaliplatin by upregulating PVT1. To investigate if PVT1 mediates Fn’s effect on oxaliplatin resistance in colon cancer cells, we transfected the cells with PVT1 siRNA and identified si-1 as having the highest knockdown efficiency (Fig. 3A). To validate the function of PVT1 in Fn-induced OXA chemoresistance, colon cancer cells were transfected with PVT1-siRNA-1. Colon cancer cells were co-cultured either with or without Fn and subsequently treated with OXA at its IC50 value. In the colony formation assay, Fn mitigated the inhibitory impact of oxaliplatin on colorectal cancer cell colony formation by upregulating the expression of PVT1 (Fig. 3B). EdU assays showed that Fn weakened the inhibitory impact of OXA on colon cancer cell proliferation by increasing PVT1 expression (Fig. 3C). Flow cytometry was employed to evaluate the apoptosis rate across all groups under identical conditions.Silencing PVT1 eliminated the Fn-induced chemosensitivity of cells to oxaliplatin (Fig. 3D). These data suggest PVT1 is crucial for Fn-induced chemoresistance to oxaliplatin in colon cancer cells in vitro.

Fig. 3.

(A) Following the knockdown of PVT1 in cells, the rna level of PVT1 was determined via qRT-PCR (n = 3). (B) Cells were transfected with specific siRNA for 24 h. Subsequently, they were co-cultured for 48 h in a medium containing IC50 oxa, either in the presence or absence of Fn, and cells in each group were detected by colony formation assay (n = 3). (C) Cells were transfected with specific siRNA for 24 h. Subsequently, they were co-cultured for 48 h in a medium containing IC50 oxa, either in the presence or absence of Fn, cell proliferation in each group was measured by the edu assay (n = 3). (D) Cells were transfected with specific siRNA for 24 h. Subsequently, they were co-cultured for 48 h in a medium containing IC50 oxa, either in the presence or absence of Fn. Flow cytometry was employed to detect cell apoptosis (n = 3). *p<0.05, **p < 0.01, ***p < 0.001

Results 4. fn induces chemoresistance of colon cancer cells to oxaliplatin via PVT1–ATAD3A/HSPA5 -PERK/eIF2α

To explore the specific mechanism by which Fn induces colon cancer cell resistance to oxaliplatin chemotherapy by upregulating PVT1, we performed ChIRP pull-down experiments Utilizing a biotin-labeled nucleic acid probe specific for PVT1 to identify PVT1-interacting proteins in HCT116 and SW480 cells. A distinct band was particularly enriched in probe 1 and probe 2 pull-downs, with a size of 60–80 kDa (Fig. 4A). Mass spectrometry was used to analyze the proteins pulled down by probe 1 and probe 2, and then the intersection was obtained. Proteins with counts greater than 60 and less than 80 were screened at the same time, and a total of 21 proteins were pulled down (Fig. 4B). The CatRAPID database was used to predict correlations with PVT1-binding proteins (Fig. 4C). Based on the GEPIA and CPTAC datasets, the level of ATAD3A was notably elevated in colon cancer tissues. Previous studies have identified a link between ATAD3A and OXA resistance in colorectal cancer, leading to the selection of ATAD3A as the final target protein (Fig. 4D–E). Western blotting analysis of RNA-pulldown products confirmed that PVT1 could specifically pull down ATAD3A protein (Fig. 4F). In line with these observations, the RIP assay also validated the interplay between PVT1 and ATAD3A (Fig. 4G). Notably, ATAD3A protein levels were significantly decreased when cells were transfected with PVT1 siRNA, and significantly increased when PVT1 was overexpressed in cells (Fig. 4H). Similarly, immunofluorescence and FISH experiments revealed that PVT1 and ATAD3A were both localized to the cytoplasm and that PVT1 knockdown also reduced ATAD3A expression (Fig. 4I).

Fig. 4.

(A) PVT1-interacting proteins were identified using a ChIRP pulldown assay, separated by SDS-PAGE, and showed with silver staining. (B) The intersection of the proteins from probe 1 and probe 2 was obtained by mass spectrometry analysis. (C) The binding sites of these 21 proteins and PVT1 were predicted using the CatRAPID database. (D-E) The transcriptional and protein-level expressions of ATAD3A in colon cancer were retrieved by accessing the GEPIA database and the CPTAC database. (F) Western blot analysis of ATAD3A in HCT116 and SW480 proteins obtained from PVT1 rna pull-down assays. (G) RIP assays verified the ATAD3A-PVT1 association, and qPCR detected PVT1 enrichment (n = 3). (H) Western blotting assessed ATAD3A protein levels in colon cancer cells with PVT1 overexpression or knockdown，the quantitative results are shown on the right (n = 3). (I) By immunofluorescence and fish experiments, knockdown of PVT1 reduced the expression of ATAD3A，the quantitative results are shown on the right (n = 3). *p<0.05, **p<0.01, ***p<0.001

Previous studies have shown that the ATAD3A/HSPA5 axis is involved in mediating chemotherapy resistance in CRC. When ATAD3A expression increases, HSPA5 binding to ATAD3A increases. In addition an enhanced interaction between ATAD3A and HSPA5 was detected in cells treated with OXA. When ATAD3A expression level is low, its binding to HSPA5 is reduced. Under the action of oxaliplatin, HSPA5 binds to PERK protein, promoting PERK phosphorylation and downstream eIF2α phosphorylation, thereby inducing endoplasmic reticulum stress-mediated cell death [21]. Co-IP experiments showed that Fn increased the expression of ATAD3A, which in turn increased the expression of HSPA5, and enhanced interaction between ATAD3A and HSPA5 was also detected in cells treated with OXA (Fig. 5A). This suggests that Fn increases the expression of ATAD3A, which can directly bind to HSPA5 and precipitate it under endoplasmic reticulum (ER) stress conditions.

Fig. 5.

(A) HCT116 cells were incubated with IC50-OXA for a duration of 24 h or with fn for 24 h. Subsequently, cell lysates were collected for the purpose of immunoprecipitation. (B) Transfect HCT116 cells with siRNA targeting PVT1 and a plasmid targeting ATAD3A. The expression levels of each protein were detected by immunoblotting. The level of PVT1 was detected by qPCR. The quantitative results are shown in the figure on the right (n = 3). (C) Transfect HCT116 cells with siRNA targeting PVT1 and a plasmid targeting ATAD3A and incubated with IC50-OXA for 24 h. The expression levels of each protein were detected by immunoblotting. The level of PVT1 was detected by qPCR. The quantitative results are shown in the figure on the right (n = 3). (D) Transfect HCT116 cells with siRNA targeting PVT1 and a plasmid targeting ATAD3A and incubated with IC50-OXA and fn for 24 h. The expression levels of each protein were detected by immunoblotting. The level of PVT1 was detected by qPCR. The quantitative results are shown in the figure on the right (n = 3). *p< 0.05, **p< 0.01, ***p<0.001

Next, in order to explore the specific mechanism by which Fn mediates colon cancer resistance by upregulating PVT1. After knocking down PVT1 in HCT116 cells, it was found that ATAD3A expression was reduced, HSPA5 expression is reduced, and there was no obvious change in PERK/eIF2α phosphorylation because there was no oxaliplatin induction (Fig. 5B). Under the induction of oxaliplatin, the phosphorylation of PERK/eIF2α increased overall. When PVT1 decreased, resulting in a decrease in ATAD3A, HSPA5 decreased its binding to ATAD3A and increased its binding to PERK, which led to an increase in the phosphorylation of PERK and eIF2α (Fig. 5C). Under the action of oxaliplatin, the phosphorylation of PERK/eIF2α increased overall, but the expression of ATAD3A increased due to the action of Fn, the binding of HSPA5 to ATAD3A increased, and the binding to PERK decreased, which reduced the phosphorylation level of PERK and eIF2α induced by oxaliplatin (Fig. 5D). In conclusion, Fn upregulates ATAD3A through PVT1, leading to increased binding of ATAD3A to HSPA5, thereby reducing the phosphorylation levels of PERK and eIF2α and alleviating ER stress-related cell death.

Results 5. PVT1 regulates ATAD3A through ubiquitination

Next, we attempted to identify the site of interaction between PVT1 and ATAD3A. The CatRAPID website predicts that the 151–202 region of ATAD3A binds to the 41–120 region of PVT1 (Fig. 6A). On the basis of this prediction, we constructed four truncated ATAD3A fragments (Fig. 6B). Subsequent biotin-based PVT1 pull-down experiments confirmed that the 151–202 region of ATAD3A was an independent domain that mediates the physical interaction between ATAD3A and PVT1 (Fig. 6C). According to the NCBI database, the full length of the PVT1 public transcript is 1952 nt. The RNAfold website was utilized to predict the secondary structure of PVT1 (Fig. 6D), four truncated PVT1 fragments were designed, and RNA-pulldown experiments were performed. The findings showed that the interaction between PVT1 and ATAD3A was related to the 1–210 nt region of PVT1 (Fig. 6E). To investigate how PVT1 regulates ATAD3A, plasmids were used to overexpress PVT1 in cells, allowing observation of its impact on ATAD3A transcription levels. According to the results of the qPCR experiments, PVT1 overexpression in HCT116 cells had no effect on ATAD3A transcription levels (Fig. 6F–G). After PVT1 overexpression, ATAD3A protein levels increased (Fig. 4H), indicating that PVT1 regulation of ATAD3A may occur at the posttranscriptional level. To test this hypothesis, we used the protein synthesis inhibitor cycloheximide (CHX) to evaluate PVT1’s effect on ATAD3A degradation. The overexpression of PVT1 in colon cancer cells prolonged the ATAD3A half-life (Fig. 6H–I). The inhibition of proteasome activity with MG132 revealed that overexpression of PVT1 in cells prevented the ubiquitin-mediated degradation of ATAD3A (Fig. 6J).

Fig. 6.

(A) CatRAPID Website online predicted the Interaction sites for PVT1 and ATAD3A. (B-C) Immunoblotting was performed to analyze the full-length or truncated His-ATAD3A in the lysates of HEK293T cells transfected with the specified vectors. Additionally, the retrieved proteins by the biotinylated PVT1 probe from the lysates of the same transfected HEK293T cells were also examined through immunoblotting. (D) The truncated PVT1 probe was designed based on its secondary structure using the RNAfold website. (E) The P1 probe (1-210nt) of PVT1 successfully pulled down the ATAD3A protein. (F) PVT1 expression was increased in cells after transfection of PVT1-targeting plasmids (n = 3). (G) After cells were transfected with PVT1 targeting plasmid, the expression of ATAD3A did not change significantly at the transcriptional level (n = 3). (H-I) In PVT1-overexpressing colon cancer cells treated with 50 μg/ml CHX, ATAD3A degradation decreased (n = 3). (J) The proteasome inhibitor MG132 (25μM) further prevented ATAD3A degradation in PVT1-overexpressing colon cancer cells (n = 3). (K) LncRNA PVT1 expression vector or control vector was transfected into colon cancer cells. Cells were exposed to 25 μM MG132 for 8 h or left untreated, followed by immunoprecipitation of ATAD3A using anti-ATAD3A. The ubiquitination of ATAD3A was showed using Western blotting. *p < 0.05, **p < 0.01, ***p < 0.001

These findings suggest that PVT1 may control the expression of ATAD3A via ubiquitination. To further verify this hypothesis, we performed immunoprecipitation experiments to extract the ATAD3A protein from cells and measure its ubiquitination level. We found that ATAD3A protein ubiquitination was reduced in colon cancer cells overexpressing PVT1 (Fig. 6K). These findings support our previous hypothesis that PVT1 overexpression leads to increased expression of ATAD3A, which may be caused by ubiquitination. In summary, these findings show that PVT1 regulates ATAD3A through ubiquitination, thereby affecting the stability of the ATAD3A protein. However, its specific mechanism of action is still unclear.

Results 6. The TLR4/NF -κB signaling pathway modulates the expression of PVT1 in colon cancer cells undergoing co-culture with fn

Subsequently, we endeavored to explore the underlying mechanisms through which Fn upregulates PVT1 expression. Previous research has indicated that Fn infection initiates the Stimulation of the TLR4/NF-κB way within colon cancer cells [7, 26]. Gene set enrichment analysis (GSEA) of the RNA - sequencing data showed that the NF-κB signaling pathway was activated by Fn infection (Fig. 7A). Correspondingly, elevated nuclear translocation of p65 was observed in colon cancer cells treated with Fn (Fig. 7B). The levels of p-p65 in cells increased in relation to the duration of Fn treatment, reaching a peak at 480 min. Meanwhile, the levels of total p65 did not exhibit a significant alterations (Fig. 7C). Silencing NF-κB p65 at the mRNA level eliminated the Fn-induced increase in PVT1 in the cells (Fig. 7D). Western blotting analysis revealed that infection with Fn triggered the stimulation of p65 and upregulated the level of ATAD3A, while NF-κB p65 silencing eliminated the Fn-induced ATAD3A upregulation in cells (Fig. 7E). To examine the potential roles of TLR4 and MyD88 in Fn-induced PVT1 and ATAD3A upregulation, siRNA (si-TLR4 and si-NC) was delivered to cells for 24 h. Subsequently, cells were co-cultured with Fn for 24-h duration. TLR4 silencing reduced the Fn-induced increase in PVT1 expression at the mRNA level (Fig. 7F). Western blot analysis revealed that TLR4 silencing reduced the Fn-induced increase in ATAD3A expression (Fig. 7 G). Overexpression of PVT1 itself did not significantly alter the expression levels of TLR4 and MYD88 or the phosphorylation level of NF-κB, suggesting that PVT1 may function primarily as a downstream effector molecule in the TLR4/NF-κB pathway, rather than forming a clear positive feedback loop to amplify TLR4 signaling (Fig. S1). We utilized the JASPAR database to identify potential transcription factors that regulate PVT1. Notably, p65 may function as a transcription factor for PVT1, with a potential binding sequence of GGGGATTCCC. Moreover, luciferase reporter plasmids were constructed. These plasmids contained either WT or MT p65-binding site sequences in the PVT1 promoter region, aimed at exploring the direct interaction between NF-κB and the PVT1 promoter (Fig. 7 H). HEK293T cells were transfected with p65 siRNA and luciferase reporter constructs (pGL3-WT and pGL3-MT). The luciferase reporter assay revealed that co-transfection of pGL3-WT with p65 siRNA significantly decreased PVT1 promoter activity. In contrast, knockdown of p65 exerted no influence on the promoter activity of the mutant PVT1 (Fig. 7I), which indicates that NF-κB modulates the promoter activity of PVT1 in colon cancer. Overall, these results demonstrate that Fn induces PVT1 expression in colon cancer cells through the TLR4/NF-κB pathway.

Fig. 7.

(A) GSEA revealed the differentially expressed gene clusters associated with the NF-κB pathway in HCT116 cells that were either treated with Fn or left untreated. (B) cells were incubated together with either Fn or a control for 24 h. Subsequently, an immunofluorescence experiment was conducted to observe the nuclear localization of p65. Next, the cell nuclei were stained using DAPI. (scale bar = 50 μm). (C) The expression levels of p65 and phosphorylated p65 in colon cancer cells co-incubated with Fn for 0, 60, 120, 240, and 480 min were analyzed using Western blotting (n = 3). (D-E) Cells were treated with si-p65 or si-NC for 24 h, then co-cultured with Fn for 6 h or 24 h. Next, qPCR quantified PVT1 levels, and Western Blot measured ATAD3A, p-p65 and p65 protein expression (n = 3). (F-G) Cells underwent a 24 h transfection with siRNA (si-TLR4 or si-NC), followed by a 24 h co-culture with Fn. qPCR was employed to analyze PVT1 expression, and Western blotting was used to evaluate protein levels of TLR4, MyD88 and ATAD3A (n = 3). (H-I) We constructed wild-type (WT) or mutant (MT) luciferase reporter plasmids containing the p65 binding site on the PVT1 promoter. HEK293T cells were transfected with p65 siRNA or luciferase constructs (pGL3-WT and pGL3-MT) (n = 3). *p<0.05, **p<0.01, ***p<0.001

Results 7. fn promotes oxaliplatin resistance in colon cancer cells under in vivo

A subcutaneous xenograft model was utilized to explore the role of Fn in enhancing chemoresistance in colon cancer cells and to evaluate the contribution of PVT1 to this process under in vivo conditions. In accordance with the study objectives, the experiments were divided into four groups. The findings indicated that treatment with oxaliplatin substantially inhibited tumor growth. However, infection with Fn attenuated this inhibitory effect (Fig. 8A-C). Notably, the downregulation of PVT1 partially reversed the Fn-induced chemoresistance of tumors to oxaliplatin in the in-vivo setting (Fig. 8A–C). A TUNEL assay further validated these findings (Fig. 8D). To explore the relationship between Fn infection and the expression levels of TLR4 and ATAD3A in vivo, IHC was performed in tumor sections. We observed that Fn infection significantly upregulated the expression levels of TLR4 and ATAD3A (Fig. 8D). Ki-67 staining also further demonstrated that Fn weakened the inhibitory effect of oxaliplatin on transplanted tumor proliferation by increasing PVT1 (Fig. 8D). These results indicate that PVT1 is pivotal in Fn-induced chemoresistance of colon cancer cells in vivo.

Fig. 8.

(A) After a 14-day treatment period, mice in each group were euthanized and tumors were removed for imaging. (B) Statistical assessment of tumor volumes was carried out for each of the different experimental groups, with five mice included in each group (n = 5/group). (C) Statistical assessment of tumor weight was carried out for each of the different experimental groups, with five mice included in each group (n = 5/group). (D) Immunohistochemical staining was used to assess TLR4, ATAD3A, and ki-67 protein levels, while a tunel assay detected cell apoptosis in xenograft tissues (n = 5/group) (immunohistochemical scale bars = 50 µm. Tunel scale bars = 100 µm). (E) Diagram illustrating how fusobacterium nucleatum enhances oxaliplatin resistance in colon cancer by increasing PVT1 expression. *p<0.05, **p<0.01, ***p<0.001

Discussion

In recent years, with changes in lifestyle, such as reduced exercise and increased intake of high-fat diets, the incidence of CRC has increased among young adults, posing a serious threat to human health [27, 28]. Recurrence, metastasis, and resistance to chemotherapy are key determinants influencing the prognosis of CRC patients [29]. The underlying mechanisms of developing resistance to chemotherapy drugs, such as oxaliplatin, remain incompletely elucidated. Emerging evidence suggests that gut microbiota influence cancer drug efficacy [30] and facilitate tumor metastasis [19]. Identifying specific cancer-promoting microorganisms holds great significance for researching CRC resistance. Fn, a natural oral bacterium, extensively colonizes the digestive tract, particularly the intestines [31, 32]. Numerous studies have demonstrated a significant abundance of Fn in colon cancer tissues in comparison to adjacent normal tissues [19, 26]. Our study found that Fn abundance correlates with the TNM stage of colon cancer patients and is higher in colon cancer samples than in matched noncancerous samples, aligning with previous research findings [7, 26]. Moreover, we discovered that patients with higher Fn abundance experienced shorter recurrence-free survival (RFS). Additionally, the Fn abundance was higher in relapsed patients. This indicates that an increase in the level of Fn may play a role in the development of chemoresistance in colon cancer. Meanwhile, our research showed that Fn enhanced the resistance of colon cancer cells to OXA chemotherapy. It also weakened the suppressing effect of OXA on the proliferation and colony formation of colon cancer cells.

LncRNA plays a key role in tumor drug resistance [33–35]. In this study, the results demonstrated that PVT1 was significantly upregulated subsequent to Fn infestation in colon cancer cell lines. lncRNA PVT1 is a noncoding RNA exceeding 200 nucleotides in length. Research indicates that PVT1 overexpression is linked to chemoresistance in malignant tumor treatment. In gastric cancer, the overexpression of PVT1 exerts anti-apoptotic functions. It also upregulates the level of MDR-related genes in cisplatin-resistant gastric cancer cells [36]. Furthermore, PVT1 facilitates the development of gemcitabine resistance in pancreatic cancer by regulating autophagy [15]. Therefore, we speculated that Fn colonization and upregulation of PVT1 may contribute to oxaliplatin resistance in colon cancer. To examine this hypothesis, we initially demonstrated that the presence of Fn reduces the chemosensitivity of colon cancer cells to oxaliplatin in both an in vitro experimental setting and in vivo models. Previous studies have shown that PVT1 influences various biological processes through interactions with functional proteins, including enhancing the stability of HIF2α [37]. To further elucidate the specific mechanism of action, we used ChIRP-MS and found that PVT1 can specifically bind to ATAD3A and hinder its ubiquitination. In addition, studies have shown that the ATAD3A/HSPA5 axis is involved in regulating chemotherapy resistance in tumor cells [21]. Our investigations revealed that in response to oxaliplatin, Fn increased the expression of ATAD3A and HSPA5 through PVT1, alleviated the phosphorylation of PERK, eIF2α, inhibited ER stress-mediated cell death, and enhanced the drug resistance of colon cancer. Furthermore, we endeavored to elucidate the specific mechanism through which Fn modulates PVT1. Our RNA sequencing-based GSEA revealed NF-κB pathway activation following Fn infection, aligning with previous studies confirming this activation in Fn-infected cells [7, 18, 19, 26]. Activated NF-κB p65 may upregulate PVT1 by enhancing transcriptional activity upstream of the PVT1 promoter.

In conclusion, this study preliminarily demonstrated that Fn is prevalent in colon cancer tissues. It has the capacity to mitigate the suppressive effects of OXA on the proliferation and colony formation of colon cancer cells. Fn mitigates ER stress-induced cell death by upregulating PVT1, thereby reducing the colon cancer cell sensitivity to OXA. The TLR4/NF-κB signaling pathway regulates PVT1 expression in colon cancer cells co-cultured with Fn.

Conclusions

This study delineates a pathway where Fusobacterium nucleatum infection promotes oxaliplatin resistance in colon cancer cells by upregulating PVT1 via the TLR4/NF-κB pathway. PVT1 subsequently stabilizes ATAD3A, suppressing cell death. PVT1 is a potential target to overcome the high abundance of Fusobacterium nucleatum leading to oxaliplatin resistance in colon cancer.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Abbreviations

ATAD3A

ATPase family AAA domain-containing protein

CCK8

Cell Counting Kit − 8

CHX

Cycloheximide

CRC

Colorectal cancer

Ct

Cycle threshold value

DNA

Deoxyribonucleic acid

DMEM

Dulbecco’s modified Eagle’s medium

eIF2α

Eukaryotic translation initiation factor 2 alpha

FBS

Fetal bovine serum

Fn

Fusobacterium nucleatum

GAPDH

Glyceraldehydes-3-phosphate dehydrogenase

HE

Hematoxylin-eosin staining

HSPA5

Heat Shock Protein Family A (Hsp70) Member 5

lncRNA

Long Non-Coding RNA

MS

Mass spectrometry

mRNA

Message RNA

NF-κB

Nuclear Factor Kappa - B

OS

Overall survival

OXA

Oxaliplatin

PCR

Polymerase chain reaction

PERK

PKR-like Endoplasmic Reticulum Kinase

PVT1

Plasmacytoma Variant Translocation 1

RFS

Relapse-Free Survival

RNA

Ribonucleic acid

RT-PCR

Reverse Transcription PCR

SDS

Sodium dodecyl sulfate

TLR4

Toll-like Receptor 4

WB

Western blot

Author contribution

KQG conceived the project, conducted and analyzed key experimental data, and wrote the manuscript. JQZ and LC contributed to in vivo experiments. JLW provided guidance on manuscript writing. JFZ participated in in vivo experiments and collected colorectal cancer tissue samples. JQZ、YY、HQM and FFW supervised cell culture and Western blot experiments, while GYW contributed to experimental design and oversaw the project. LMZ assisted in experimental design and manuscript preparation. All authors approved the final version for publication.

Funding

This research was supported by National Natural Science Foundation of China (82272909), Natural Science Foundation of Hebei Province (H2022206355).

Data availability

Any additional information required to reanalyze the data reported in this paper is available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

Methods The methods were performed in accordance with the approved guidelines, and all experimental protocols were approved by the Ethics Committee of the Fourth Affiliated Hospital of Hebei Medical University.

Consent for publication

All authors have read and approved the manuscript.

Competing interests

No potential competing interests was associated with this manuscript.