Design and optimization of a multiplex real-time PCR assay for detection of Hepatitis C virus (HCV), Human immunodeficiency virus-1 (HIV-1) and Human hepegivirus-1 (HHpgV-1)

Abstract

Aim:

The objective of this study was to develop a real-time PCR method to detect hepatitis C virus (HCV), human immunodeficiency virus-1 (HIV-1), and also recently discovered human hepegivirus-1 (HHpgV-1) through melting curve analysis using SYBR Green dye in a single reaction.

Background:

It is estimated that chronic viral infections affect millions of people worldwide, and a significant number of these individuals are unaware of their infection. In addition, infection with newly discovered and emerging viruses may put public health at potential risks. Precise and early detection is a primary and important task for controlling infections and helping patients.

Methods:

A set of specific primers were designed for detection of HCV, HIV-1, and HHpgV-1 in a single tube. The real-time polymerase chain reaction was performed and melt curves were analyzed. Specificity was assessed by cross-reaction tests with other common blood-borne pathogens. The established assay was evaluated for the detection of viruses in clinical samples.

Results:

The three viruses were clearly distinguished by their respective melting temperature values. The detection limits of this assay were 10² copies/ml for each virus. The clinical evaluation of this assay was demonstrated by analyzing 134 patients’ serum samples. The specificity of the developed assay considered as 100%.

Conclusion:

The developed multiplex real-time PCR based on SYBR Green dye is a well-suited detection assay of single or co-infections of HCV, HIV, and HHpgV-1 in clinical and research laboratories. It can be used as a cost-effective, rapid tool for routine diagnostic in-house tests.

Introduction

Many patients throughout the world require a blood transfusion to survive, such as those with thalassemia, hemophilia, or those who lose large amounts of blood through surgery or accidents (1). Blood transfusions predispose people to exposure to a variety of blood-borne pathogens. Therefore, it is critical to identify and detect blood-borne pathogens to ensure the safety of blood transfusions. Several viruses are transmitted through blood and its derivatives; thus, these biological products should be tested for the presence of viruses such as HIV-1, HCV, and HBV (2). There are also growing concerns on transmission of other emerging viruses including hepatitis E virus and Zika virus throughout blood transfusion (3, 4). In 2015, a new virus was discovered in recipients of blood products in the United States by Kapoor et al., termed human hepegivirus 1 (HHpgV-1) or human pegivirus 2 (HpgV-2) (5). This new RNA virus belongs to the H genus Pegivirus and the family Flaviviridae (6-9). The pathogenesis of the virus has not yet been determined (10, 11). However, the impact of HHpgV-1 infection in at risk populations including AIDS patients, immunosuppressed transplant recipients or cancer patients should be carefully investigated. In addition, numerous studies have been conducted on the prevalence and significance of viral co-infections (12-18). It is commonly known that HIV negatively affects the natural history of HCV, leading to a higher HCV RNA load, a quicker progression to liver fibrosis, and death (19, 20). Nevertheless, possible coinfection effects of HHpgV-1 on blood borne viruses such as HCV and HIV have not been studied adequately. Therefore, accurate detection and diagnosis of HHpgV-1 in individuals and also blood and blood products are necessary (21-23). Melting curve analysis is a real time polymerase chain reaction (real time PCR)-based technique which is dependent on intercalating dyes. High resolution melt analysis (HRM) is a sensitive and accurate method used in detecting polymorphisms, screening nucleotide substitutions, single-nucleotide substitution, differentiating various microbial pathogens and identifying viral genotypes. The advantage and superiority of melt curve analysis over other molecular detection methods lie in its shorter test time and relatively lower cost (24, 25). Furthermore, the real time PCR can be applied as a quantification method for viral load determination using known template concentrations.

The current study aimed to develop a fast, cost-effective, and accurate real time PCR assay based on SYBR Green dye that would allow simultaneous identification and differentiation of three viruses (HIV-1, HCV, HHpgV-1) in serum samples.

Methods

Clinical samples

Serum samples were gathered from 57 HIV-1, 23 HCV and 4 HHpgV-1 positive samples and 50 HIV, HCV and HHPgV-1 negative participants. HIV-1, HCV, and HHpgV-1 samples as well as the negative samples were evaluated by confirmatory assays based on serological tests for HIV and HCV and molecular tests for these three viruses.

For serological confirmation of HCV and HIV, the HCV Ab ELISA Kit (Dia.pro- Diagnostics, Italy), HIV Ab&Ag ELISA Kit (Dia.pro-Diagnostics, Italy) were used, respectively, and for molecular evaluation for HCV, Altostar HCV RT PCR Kit (Altona Diagnostics, Hamburg, Germany) and QIAGEN Artus HIV-1 Kit (Hilden, Germany) were utilized. For HHpgV-1 analysis, conventional RT-PCR with HHpgV-ak1, HHpgV-ak2, and HHpgV-ak3 primers was performed (5). Ethical consent was obtained from all those who entered the project, and the volunteers were consulted by a specialist and made aware of the possible goals and outcomes of the research project.

The study protocols were reviewed and authorized by the ethical committees of the Gastroenterology and Liver Diseases Research Institute, Shahid Beheshti University of Medical Sciences, Tehran.

All samples were transferred from gastroenterology clinic of Taleghani Hospital and Shahid Jafari HIV Reference Laboratory to the RIGLD laboratory (the Virology Department of the Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University, Tehran) in compliance with all biosafety regulations.

RNA extraction

RNA was extracted using a QIAamp Viral RNA Mini Kit (Qiagen) under completely sterile and RNAase-free conditions, and extracted RNAs were stored at -80 °C for further study. The cDNA was synthesized from extracted RNA using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) and was stored at -20 °C until use.

Primer design

To design the appropriate primers, several nucleotide sequences of HIV, HCV, and HHPgV isolates were retrieved from the GenBank and aligned using CLUSTAL X software (26). The pair primers designed for the conserved area at the beginning of the genome (5’UTR), the nucleotide sequences to be multiplied, and the primers were examined using BLAST. The primers were also tested using GeneRunner software (V4.0.9) for temperature and the presence of dimmer and loop in the interaction between primers.

Preparation of DNA plasmid standard

The specific target regions of HCV, HIV-1, and HHpgV-1 were amplified, cloned into a vector (pCR-2.1-TOPO, Invitrogen, USA), and propagated in E.coli DH5α. Plasmids were purified with a QIAamp plasmid Midi Kit (Qiagen). Plasmid DNA was eluted and stored at -80 °C; concentrations were measured by UV absorbance at 260 nm and 280 nm using an ultraviolet spectrophotometer.

Multiplex real-time RT-PCR assay

The multiplex real-time RT-PCR assay was performed using a multi-channel platform (RotorGene Q, QIAGEN, Germany). The test reaction contained 12.5 μL master mix (Amplicon Denmark) containing PCR buffer, dNTPs, MgCl2, and Taq Hotstart DNA polymerase; the primers of HHpgV-1, HCV and HIV-1 were used at 0.25, 0.3, and 0.4μM; and 5 μL cDNA as a template was also added; distilled water was used to bring the final volume to 25 μL in an RNase-free PCR tube.

Cycling conditions were as follows: PCR activation at 95 °C for 15 min, and 45 cycles of amplification at 95 °C for 30 s, 57 °C for 35 s, and 72 °C for 35 s. Negative controls were included in each test. All reactions in the present study were performed in triplicates. The threshold fluorescence level used to derive Ct values was determined automatically by the Rotor-Gene Q series software. Melt curve analysis was performed at the end of the amplification program.

Standard curves of multiplex real-time RT-PCR assay

To construct standard curves, 10-fold serial dilutions of the standard plasmids spanning 1×10⁶ to 1x10¹ copies/mL were used. To determine the analytical sensitivity further than 100 copies/mL, 2-fold dilutions were prepared (for 50 and 25 copies/mL). Standard curves were plotted as the mean Ct values versus the log copy numbers.

Sensitivity and specificity

To determine the detection limit, 1x10⁶ to 1x10¹ copies/ml of standards and 50 and 25 copies/mL were amplified under optimal conditions. The specificity of this method was evaluated by measuring three other main viral pathogens, including HBV, TTV, and HAV, that would show any cross-reactivity or false positive result.

Primer	Sequence (5̀ˊ→3ˊ)	Size (nt)	Tm ( ° C)	Amplicon length (base pairs)
primer pairs of HHPgV-1HHpgV-1 F1HHpgV-1 R1	CCACTCCGTACAGCCTGATAAGCCCGAGGAGGTATTATAGT	2021	62.361.8	133
primer pairs of HIV-1HIV-1 FHIV-1 R	AARACAGCAGTACARATGGCTATTCTTTCCCCTGCACTGT	2020	59.261.3	84
primer pairs of HCVHCV FHCV R	CTAGCCGAGTAGYGTTGGGTCATGDTGCACGGTCTACGA	2019	61.661.3	94

HIV-1 (copies/mL)	HCV (copies/mL)	HHpgV-1 (copies/mL)	Detected/replicates
106	106	106	10/10
105	105	105	10/10
104	104	104	10/10
103	103	103	10/10
100	100	100	10/10
50	50	50	5/10
25	25	25	0/10
10	10	10	0/10

Results

A total of 134 serum samples consisting of 57 HIV-1, 23 HCV and 4 HHpgV-1 positive samples and 50 HIV, HCV and HHPgV-1 negative were collected in the study. Of these samples, 82 (63.07%) were male and 48 (36.92%) were female, respectively. The mean age in all samples was 42.28±16.42 years. In addition, mean ALT and AST were 30.83±29.02 and 26.44±20.48, respectively. The mean HCV and HIV-1 viral loads were 5.18 ±1.57 log10 copies/mL (range, 1.88-7.21 log10 copies/mL) and 5.4 ± 0.4 log RNA copies/mL (range, 4.8–6.0 log RNA copies/mL), respectively.

The three designed primer pairs specifically amplified their target regions of HIV-1, HCV, and HHpgV-1 with product sizes of 84 bp, 94 bp, and 133 bp, respectively (Table 1). Analysis with BLAST showed that none of the three pairs of primer hybridization sites were homogenous to the genome of the pathogens under study nor to the human genome. The discriminatory power of all three initiating sets was examined on positive plasmids and negative samples. The primer pairs of HIV-1 clearly showed the greatest discriminatory power for differentiation. Rotor-Gene Q software was used to analyze the data. Based on the data obtained, the temperature was adjusted to obtain the data in Rotor-Gene Q. Fluorescent data was collected from 70 °C to 90 °C and raised 0.25 degrees (s) each step to avoid most of the background signals and facilitate interpretation. Distinctive melting temperature (Tm), caused by different lengths and compositions of HCV, HIV-1, and HHpgV-1 amplicons, particularly revealed the presence of these viruses’ genomes in samples. The derivative melting plot shows a mean + standard deviation melting temperature of 86.61+0.22 °C for HHpgv-1, 85.27+0.21 °C for HCV, and 77.42+0.49 °C for HIV-1 (Figure 1).

The sensitivity and specificity of this assay were assured by a meticulous selection of primer pairs. All 57 HIV-1 positive patients and 4 HHpgV-1 positive samples were determined positive with the developed assay. However, 21 of 23 HCV patients (91.3%) found positive with the multiplex assay. It seems that the two negative samples had low levels of HCV RNA genome.

Moreover, the specificity of the assay was confirmed by examining available negative controls comprising HBV, HAV, and TTV. In addition to these controls, negative samples obtained from healthy individuals (n=50) were also examined; none of them showed a cross-reactivity with those of the controls and samples. The clinical specificity of the assay considered 100%. To determine the detection limit of this assay, endpoint dilutions of the cloned positive plasmids were performed. In addition to positive and negative controls, a non-template control (NTC) was also examined by this assay.

Standardization and sensitivity of multiplex real-time PCR assay

The analytical sensitivity was determined to be 10² copies/mL for the assay (Table 2). The linear correlations (R2) between the threshold cycle and the copy logarithm were 0.982, 0.992, and 0.997. As expected, every 10-fold decrease in the copy number resulted in an approximately 3.3-unit increase in Ct value. Moreover, statistical analysis of each standard curve revealed a high correlation coefficient and a high PCR efficiency. These results suggest that the designed and developed multiplex real-time PCR assay is suitable for genome detection when these three pathogens are simultaneously present in the same tube.

The specificity of multiplex real-time PCR assay

This assay was highly specific for detecting HCV, HIV-1, and HHpgv-1. Three pathogens (Hepatitis B virus, Hepatitis A virus, and TTV) and the template-free control were not amplified (Figure 2). The clinical specificity of the assay considered 100%. However, HIV-1, HCV, and HHpgV-1 could all be detected by this assay.

There was no significant difference when the Ct values for the mix of HCV and of HIV-1 were measured and compared with their monoplex tests. These results confirm that the performance of the assay is very stable when measuring either 1 or 2 of these pathogens at the same time in a reaction. The number of HHpgV-1 positive clinical samples was low and this was one of the main limitations of this study.

Discussion

Risk of microorganisms’ transmission through blood transfusion and blood products and plasma derivatives has been reduced considerably by careful screening and effective monitoring by sensitive serological and molecular tests. However, recent decades have witnessed a dramatic appearance of novel viral agents. Therefore, constant improvement and updating diagnostic methods to accurately detect several major blood borne viruses and at the same time emerging viruses is a real necessity. In addition, lowering a laboratory test’s cost and improving response time are also two other important factors for developing new detection methods.

Compared to traditional methods such as conventional RT-PCR, ELISA, IFA, and virus isolation, real-time PCR has the advantage of being faster and fairly more sensitive (27, 28). As a result, such measurements have recently been developed and have quickly become one of the most important methods of pathogen detection. Real-time PCR can be used to utilize several fluorophores in one tube, and a multiplex test can be performed. Therefore, it is possible to employ different target sequences simultaneously in a single reaction (29). Suitable analytical capacity is achievable, especially when several different pathogens must be identified in a short time. The ability to perform experiments in parallel rather than sequentially makes this technique a suitable alternative to traditional methods. The simultaneous diagnosis of different pathogens is often addressed by multiplex PCR (30, 31). The development of such a multiplex real-time PCR method was very challenging, as a combination of optimized primer pairs and optimal ion concentration was required for the detection of each target pathogen. In fact, more attention should be paid to system design and optimization. In this study, real-time PCR was established, developed, and evaluated for simultaneous detection of HCV, HIV-1, and HHpgV-1. Real-time PCR was sensitive enough to detect 100 copies of the pathogenic genome. Moreover, this method was highly reproducible.

The quantity of pathogenic nucleic acids is critical for determining the load of infection according to the pathogenic potential. In this study, standard curves were created based on the serial dilutions of cDNA standards related to HCV, HIV-1, and HHpgV-1, and this was the main step in mimicking the enumeration of nucleic acid in vitro. The primer pairs were designed for the conserved regions at the beginning of the genome (5'UTR) for HCV and HHpgV-1, and polymerase region of HIV-1 genome. This method is simple and convenient for measuring the transcripts of each virus in separate reactions (monoplex) using known template concentrations.

The entire detection period, including the extraction of the nucleic acid of the pathogen genome and the qPCR test, took approximately three to six hours, making it a quick and simple procedure.

The multiplex real-time PCR method was more sensitive and effective and had much higher specificity and coverage. It is important to note that mutations occur in the viral genome during the development of the disease, especially among RNA viruses. As a result, primers or probes need to be updated for real-time detection, especially based on the genome sequence of local viral isolates. This mutational issue was anticipated in this study, and a solution was provided by designing the primers based on the latest epidemiologic pathogen sequences in Genbank. Viral genome detection methods (nucleic acid tests) were able to detect pathogens from peripheral blood, even during the preseroconversion window period (PWP), making it more suitable for early clinical diagnosis.

The current study is not exempt from limitations, first, HIV, HCV and HHpgV-1 are RNA viruses and it is better to synthesize and use RNA transcribes for serial dilution preparation and also as a positive control instead of plasmid DNA. By using T7 transcription kit and producing RNA transcribes of these viruses and also applying one step real time RT-PCR master mix, the reverse transcription step can be checked during each run. However, switch to one step RT-PCR master mix can significantly increase the cost of the test. Second, as a consequence of relatively low prevalence of HHpgV-1 infection in general population, adequate numbers of HHpgV-1 positive clinical samples could not be found, therefore the evaluations performed mainly based on cloned DNA plasmid with HHpgV-1 sequence and a limited number of positive clinical samples. Third, only HBV, HAV and TTV were evaluates as the frequently observed viruses in blood, other than HIV-1 and HCV for the specificity tests. As HIV-1 shows a global distribution and is a main threat to public health and a major risk factor for blood transfusion, the primers were deliberately chosen from the conserved region of HIV-1 isolates and specifically designed for amplifying and detecting this virus. The primers sequences do not match HIV-2 isolates sequences, as HIV-2 mostly detected in West Africa. However, checking the developed test with HIV-2 positive samples, can be helpful and confirm lack of any probable cross-positivity. Nevertheless, HIV-2 infection cases have not been reported from Iran yet and the virus positive samples were not accessible for the specificity test evaluation in the present project.

Conclusion

The multiplex real-time PCR assay developed in this study is a fast, sensitive, and specific technique for the detection of specific blood-borne pathogens in blood. Compared to traditional methods, multiplex real-time PCR measurement can reduce concerns about false-negatives, significantly increase efficiency, and help reduce costs when processing large numbers of blood samples. This method provides a useful molecular detection tool for large-scale screening of clinical specimens, especially during the safety screening of blood and blood products for transfusion. As, HHPgV-1 is a novel virus and extremely limited knowledge is available about this virus, application of the present multiplex assay can provide valuable information on its epidemiology and pathogenesis, especially in high risk populations.

Conflict of interests

There is no conflict of interest for authors of this article.