Abstract
The karst regions of southwest China are rich in biodiversity and have critically threatened ecosystems, harboring unique species that could be new to science. During the investigations of arthropods associated-fungi, several fungal strains were collected. Among these, three new species, Conoideocrella tiankengensissp. nov. (Clavicipitaceae), Ovicillium zunyiensesp. nov. (Bionectriaceae) and Trichothecium sinensesp. nov. (Myrotheciomycetaceae), isolated from a dead scale insect, larva and spider, respectively, were introduced as novel taxa, based on the morphological characteristics and DNA-based phylogenetic analyses. This is the first time that a species from Myrotheciomycetaceae is reported from the karst habitats. In addition, the genus Myrotheciomyces is treated as a synonym of Trichothecium based on the phylogenetic analysis, and the type species of the former is transferred to the latter genus.
Key words: Insect, karst, morphology, phylogenetic analysis, spider
Introduction
Karst regions, particularly those in southwest China, harbor vast tracts of well-preserved primary forests with exceptionally high biodiversity (Wijayawardene et al. 2021; Sun et al. 2023, 2024). The intricate ecosystems and unique geological conditions of these areas serve as important microhabitats for numerous ancient species (Özkan et al. 2010; Su et al. 2017). Moreover, the region is now recognized as one of the most critically threatened biodiversity hotspots globally due to the unique and highly fragile nature of its ecosystem and anthropogenic activities (Long et al. 2024). Hence, urgent conservation measures are needed to protect these vulnerable ecosystems (Wu and Zhang 2020; Duan et al. 2021).
Guizhou Province, a quintessential karst region in China, is characterized by its crisscrossing mountain ranges and dramatic elevation variations. These topographical contrasts have fostered diverse microenvironments, shaping intricate ecosystems that support a wide array of species across distinct habitats (Liu et al. 2018). As a key hub of biodiversity, Guizhou Province hosts exceptional ecological richness (Xu et al. 2017).
Wijayawardene et al. (2021) regarded the Guizhou and Yunnan Provinces as mycological hotspots. Annually, a large number of novel fungal species are introduced from different substrates, including arthropods, and these taxa could be parasitic or saprobes of insects and spiders (e.g. Chen et al. 2024a, b, d). Recent studies reported new arthropod-associated fungi that are accommodated in nine families (For a list of the species, see Suppl. material 1), viz., Bionectriaceae (Chen et al. 2024a; Wang et al. 2025a), Calcarisporiaceae (Chen et al. 2024b), Clavicipitaceae (Chen et al. 2022a), Cordycipitaceae (Chen et al. 2023; Bu et al. 2025), Hypocreaceae (Tarafder et al. 2024), Nectriaceae (Wang et al. 2024), Ophiocordycipitaceae (Chen et al. 2024c; Peng et al. 2024; Xu et al. 2025), Polycephalomycetaceae (Chen et al. 2024c), Tilachlidiaceae (Liang et al. 2016) from Guizhou Province.
During a survey of arthropod-associated species in Hypocreales from southwestern China, several specimens were collected, and fungal strains were isolated and purified. Isolated strains were identified based on the multigene phylogeny and morphological characteristics, and three new species introduced, i.e. Conoideocrella tiankengensis sp. nov., Ovicillium zunyiense sp. nov. and Trichothecium sinensesp. nov., which belong to the families Clavicipitaceae, Bionectriaceae and Myrotheciomycetaceae, respectively. This is the first report of a taxon from the family Myrotheciomycetaceae reported in the Guizhou karst habitats. Moreover, the type species of Myrotheciomyces, M. corymbiae resided in Trichotheciums. str. Thus, Myrotheciomyces is regarded as a synonym of Trichothecium.
Materials and methods
Specimen collection and isolation
The specimens were collected from Monkey-Ear Tiankeng (27°5'12.138"N, 107°40'48.42"E), Kaiyang County, Guiyang City, Mayao River Valley (26°21'24.71"N, 107°22'48.22"E), Duyun City, Qiannan Buyi and Miao Autonomous Prefecture and Dabanshui National Forest Park (27°46'35.904"N, 106°48'30.89"E), Honghuagang District, Zunyi City, Guizhou Province, on 6th April 2024, 1st May 2022 and 2nd September 2023, respectively. The samples were placed in sterile bags, kept separately on ice, and transported to the laboratory. Specimens were preserved in the refrigerator at 4 °C until further processing.
The surface of each arthropod body was rinsed with sterile water, followed by sterilization with 75% ethanol for 3–5 s and rinsing again three times with sterilized water. After drying on sterilized filter paper, a piece of the mycelium or sclerotium was cut from the specimen and placed on plates of potato dextrose agar (PDA) (Potato powder 6%, Agar 20%, Glucose 20%, Beijing Solarbio Technology Co., Ltd., China) or PDA modified by the addition of 1% w/v peptone (Beijing Solarbio Technology Co., Ltd., China) containing 0.1 g/l streptomycin (Beijing Solarbio Technology Co., Ltd., China) and 0.05 g/l tetracycline (Beijing Solarbio Technology Co., Ltd., China) (Chen et al. 2019). After fungal colonies emerged from the plated samples, a piece of mycelium from the colony edge was transferred onto new agar plates and cultured at 25 °C for 14 days under 12 h light/12 h dark conditions (Zou et al. 2010).
Morphological study
Colony characteristics were determined on PDA cultures incubated at 25 °C for 14 days, and growth rate, presence of octahedral crystals and colony colors (surface and reverse) were observed. To investigate microscopic characteristics, a little of the mycelia was picked up from the colony and mounted in lactophenol cotton blue or 20% lactic acid solution and the asexual morphological characteristics (e.g., conidiophores, phialides or conidiogenous cells, and conidia) were observed and measured using a Leica DM4 B microscope.
Maintenance and deposition of type materials and registration of novel taxa
The holotypes and ex-type cultures were deposited at the Institute of Fungus Resources, Guizhou University (formerly Herbarium of Guizhou Agricultural College; code, GZAC), Guiyang City, Guizhou, China. MycoBank numbers were obtained for novel taxa as outlined in MycoBank (http://www.MycoBank.org) (Crous et al. 2004).
DNA extraction, polymerase chain reaction amplification (PCR) and nucleotide sequencing
DNA extraction was carried out using a fungal genomic DNA extraction kit (DP2033, BioTeke Corporation) according to Liang et al. (2011). The extracted DNA was stored at −20 °C. Polymerase chain reaction (PCR) was used to amplify genetic markers using the following primer pairs: ITS5/ITS4 for the internal transcribed spacer (ITS) region (White et al. 1990), LR0R/LR5 for 28S large subunit ribosomal RNA gene (LSU) (Vilgalys and Hester 1990), fRPB2-5F/fRPB2-7cR for RNA polymerase II second largest subunit (RPB2) (Liu et al. 1999) and 983F/2218R for translation elongation factor 1 alpha (tef-1α) (Castlebury et al. 2004). The thermal cycle conditions of PCR amplification for these phylogenetic markers were set up following the procedure described by Chen et al. (2021) (Table 1). The PCR products were purified and sequenced at Sangon Biotech (Shanghai) Co. All newly generated sequences were deposited in GenBank and accession numbers were obtained (Table 2).
Table 1.
List of primer information used in this study.
| Locus | Primer | Length | Direction | Sequence 5’-3’ | Optimised PCR protocols | References |
|---|---|---|---|---|---|---|
| ITS | ITS5 | 22 | forward | GGAAGTAAAAGTCGTAACAAGG | (95 °C: 30 s, 51 °C: 50 s, 72 °C:45 s) × 33 cycles | White et al. 1990 |
| ITS4 | 20 | reverse | TCCTCCGCTTATTGATATGC | |||
| LSU | LROR | 17 | forward | ACCCGCTGAACTTAAGC | (94 °C: 30 s, 51 °C: 1 min,72 °C: 2 min) × 33 cycles | Vilgalys and Hester 1990 |
| LR5 | 17 | reverse | TCCTGAGGGAAACTTCG | |||
| RPB2 | RPB2-5F3 | 20 | forward | GACGACCGTGATCACTTTGG | (94 °C: 30 s, 54 °C: 40 s, 72 °C:1 min 20 s) × 33 cycles | Liu et al. 1999 |
| RPB2-7Cr2 | 20 | reverse | CCCATGGCCTGTTTGCCCAT | |||
| tef-1α | 983F | 23 | forward | GCYCCYGGHCAYCGTGAYTTYAT | (94 °C: 30 s, 58 °C: 1 min 20 s,72 °C: 1 min) × 33 cycles | Castlebury et al. 2004 |
| 2218R | 23 | reverse | ATGACACCRACRGCRACRGTYTG |
Table 2.
List of strains and GenBank accession numbers of sequences used in this study.
Note. New strains or species are in bold type. “T” denotes ex-type. Abbreviations: ATCC, American Type Culture Collection, USA; BCC, BIOTEC Culture Collection, Klong Luang, Thailand; CBS, Westerdijk Fungal Biodiversity Institute (previously Centraal bureau voor Schimmelcultures), Utrecht, the Netherlands; CGMCC, China General Microbiological Culture Collection Center, China; DAOM, Department of Agriculture, Ottawa, Mycological Collections, Ottawa, Canada; EFCC, Entomopathogenic Fungal Culture Collection, Chuncheon, Korea; GMBC, Guizhou Medical University Culture Collection, Guiyang, China; NHJ, Nigel Hywel-Jones personal collection; OSC, Oregon State University Herbarium, Corvallis, OR; YHH, Yunnan Herbal Herbarium, Kunming, China.
Sequence alignments and phylogenetic analyses
DNASTAR™ Lasergene (v.6.0) was used to edit DNA sequences in this study. The ITS, LSU, RPB2 and tef-1α sequences for this analysis were downloaded from GenBank based on recent, related studies (e.g. Hou et al. 2023; Lin et al. 2025; Zhao et al. 2025; Wang et al. 2025b), and other sequences were selected based on BLASTn similarity searches. All the sequences were aligned by MAFFT v.7.037b (Katoh and Standley 2013) and alignments edited with MEGAv. 6 (Tamura et al. 2013).
We carried out four phylogenetic analyses to confirm the placement of the strains in different taxonomic hierarchies.
Analyses 1: Analyses based on ITS, LSU, RPB2 and tef-1α gene regions to confirm the familialplacement of the new strains.
Analysis 2: Analyses based on ITS, LSU, RPB2 and tef-1α gene regions to show the placement of new strains in Ovicilliums. str.
Analysis 3: Analyses based on ITS, LSU, RPB2 and tef-1α gene regions to show the placement of new strains in Conoideocrellas. str.
Analysis 4: Analyses based on ITS, LSU, RPB2 and tef-1α gene regions to show the placement of new strains in Trichotheciums. str.
The combined datasets of ITS, LSU, RPB2 and tef-1α gene regions were obtained using SequenceMatrixv.1.7.8 (Vaidya et al. 2011). The model for each data partition was selected for Bayesian analysis by ModelFinder (Kalyaanamoorthy et al. 2017) in the PhyloSuite v. 1.2.2 software (Zhang et al. 2020).
The datasets 1–4 were analyzed using Bayesian inference (BI) and maximum likelihood (ML) methods, respectively. For BI, a Markov chain Monte Carlo (MCMC) algorithm was used to generate phylogenetic trees with Bayesian probabilities for the combined sequence datasets using MrBayes v.3.2 (Ronquist et al. 2012). The Bayesian analysis resulted in 20,001 trees after 10,000,000 generations. The first 4,000 trees, representing the burn-in phase of the analysis, were discarded, while the remaining 16,001 trees were used to calculate posterior probabilities in the majority rule consensus tree. After the analysis was finished, each run was examined to see if it was greater than 200 using the program Tracer v.1.5 (Drummond and Rambaut 2007) to determine burn-in and confirm that both runs had converged. The ML analyses were constructed with IQ-TREE v. 2.0 (Nguyen et al. 2015; Trifinopoulos et al. 2016), using the ML+rapid bootstrap setting with 1,000 replicates and an automatic selection of the model according to BIC.
Results
Phylogenetic analyses
Analysis 1
The familial placements of the new strains are confirmed in this analysis (Fig. 1). Gelasinospora tetrasperma Dowding (AFTOL-ID 1287), Neurospora crassa Shear & B.O. Dodge (ICMP 6360) and Sordariafimicola (Roberge ex Desm.) Ces. & De Not. (AFTOL-ID 216) were used as the outgroup taxa in the analysis. The dataset included 79 taxa, and consisted of 3,235 (ITS, 686; LSU, 842; RPB2, 882, and tef-1α, 825) characters with alignment gaps.
Figure 1.
Phylogram retrieved from IQ-TREE to confirm the familial placements of the new strains using the combined dataset of ITS, LSU, RPB2 and tef-1α gene regions. The statistical values are provided at nodes as ML/PP (ML value above 70% and BI value above 0.70). The tree is rooted with Gelasinospora tetrasperma (AFTOL-ID 1287), Neurospora crassa (ICMP 6360) and Sordaria fimicola (AFTOL-ID 216). Ex-types and new strains are indicated by the superscript “T” and in bold, respectively.
The selected model for the ML analysis was TIM2+F+G4. The final value of the highest scoring tree was –55,119.994, which was obtained from the ML analysis of the dataset. The parameters of the GTR model used to analyze the dataset were estimated based on the following frequencies: A = 0.236, C = 0.272, G = 0.276, T = 0.215; substitution rates AC = 1.27070, AG = 2.13314, AT = 1.27070, CG = 1.00000, CT = 5.12614 and GT = 1.00000, as well as the gamma distribution shape parameter α = 0.468. The selected model of the dataset for BI analysis was GTR+F+I+G4 (ITS), GTR+F+G4 (LSU, tef-1α) and SYM+I+G4 (RPB2). The phylogenetic tree (Fig. 1) constructed using ML and BI analyses was largely congruent and strongly supported in most branches.
Strains KY04071 and KY04072 clustered sister to Conoideocrella luteorostrata (Zimm.) D. Johnson et al. (NHJ 11343 and NHJ 12516) and formed a stable clade in the family Clavicipitaceae.
Strains DY05461, DY05462, DY05591 and DY05592 clustered sister to Trichothecium roseum (Pers.) Link (DUCC 502) and Myrotheciomyces corymbiae Crous (CPC 33206) in the family Myrotheciomycetaceae.
Strains ZY09271 and ZY09272 clustered sister to Ovicillium asperulatum (Giraldo et al.) L.W. Hou et al. (CBS 130362) and O. attenuatum Zare & W. Gams (CBS 399.86) in the family Bionectriaceae.
Analysis 2
Phylogenetic trees were generated in analysis 2for establishing the new species in the genus Ovicillium (Fig. 2). Acremonium alternatum Link (CBS 407.66) and A. egyptiacum (J.F.H. Beyma) W. Gams (CBS 114785) were used as the outgroup taxa in the analysis. The dataset included 20 taxa and consisted of 2,872 (ITS, 517; LSU, 777; RPB2, 767, and tef-1α, 811) characters with alignment gaps.
Figure 2.
Phylogram retrieved from IQ-TREE for establishing the new species in the genus Ovicilliums. str. using the combined dataset of ITS, LSU, RPB2 and tef-1α gene regions. The statistical values are provided at nodes as ML/PP (ML value above 70% and BI value above 0.70). The tree is rooted with Acremonium alternatum (CBS 407.66) and A. egyptiacum (CBS 114785). Ex-types and new strains are indicated by the superscript “T” and in bold, respectively.
The selected model for the ML analysis was TN+F+I+G4. The final value of the highest scoring tree was –12,780.840, which was obtained from the ML analysis of the dataset. The parameters of the GTR model used to analyze the dataset were estimated based on the following frequencies: A = 0.235, C = 0.276, G = 0.268, T = 0.220; substitution rates AC = 1.00000, AG = 2.52675, AT = 1.00000, CG = 1.00000, CT = 5.98208 and GT = 1.00000, as well as the gamma distribution shape parameter α = 0.800. The selected model of the dataset for BI analysis was GTR+F+I+G4 (ITS, LSU, tef-1α) and SYM+I+G4 (RPB2). The phylogenetic tree (Fig. 2) constructed using ML and BI analyses was largely congruent and strongly supported in most branches. Strains ZY09271 and ZY09272 formed an independent clade with high statistical support (100% ML/1 PP) and were clustered with Ovicillium oosporum Zare & W. Gams, O. subglobosum Zare & W. Gams, O. theobromae Lin Zhao bis & Crous, O. variecolor (Giraldo et al.) L.W. Hou et al. in a clade with high statistical support in ML and BI analysis (98% ML/1 PP).
Analysis 3
Phylogenetic trees were generated in analysis 3 for establishing the new species in the genus Conoideocrella (Fig. 3). Pleurocordyceps aurantiaca (Y.P. Xiao et al.) Y.H. Wang et al. (MFLUCC 17-2113) and P. marginaliradians (Y.P. Xiao et al.) Y.H. Wang et al. (MFLU 17-1582) were used as the outgroup taxa in the analysis. The dataset included 20 taxa and consisted of 3,279 (ITS, 642; LSU, 819; RPB2, 917, and tef-1α, 901) characters with alignment gaps.
Figure 3.
Phylogram retrieved from IQ-TREE of the placement of new strains in Conoideocrellas. str. using the combined dataset of ITS, LSU, RPB2 and tef-1α gene regions. The statistical values are provided at nodes as ML/PP (ML value above 70% and BI value above 0.70). The tree is rooted with Pleurocordyceps aurantiaca (MFLUCC 17-2113) and P. marginaliradians (MFLU 17-1582). Ex-types and new strains are indicated by the superscript “T” and in bold, respectively.
The selected model for the ML analysis was TN+F+I+G4. The final value of the highest scoring tree was –14,463.202, which was obtained from the ML analysis of the dataset. The parameters of the GTR model used to analyze the dataset were estimated based on the following frequencies: A = 0.236, C = 0.271, G = 0.276, T = 0.217; substitution rates AC = 1.00000, AG = 2.83420, AT = 1.00000, CG = 1.00000, CT = 8.61744 and GT = 1.00000, as well as the gamma distribution shape parameter α = 0.591. The selected model of the dataset for BI analysis was HKY+F+G4 (ITS), GTR+F+I+G4 (LSU, tef-1α) and SYM+I+G4 (RPB2). The phylogenetic tree (Fig. 3) constructed using ML and BI analyses was largely congruent and strongly supported in most branches. Strains KY04071 and KY04072 formed an independent clade with high statistical support (100% ML/1 PP) and clustered with Conoideocrella luteorostrata in a clade with high statistical support in ML and BI analysis (100% ML/1 PP).
Analysis 4
Phylogenetic trees were generated in analysis 4 for establishing the new species in the genus Trichothecium (Fig. 4). Clonostachys phyllophila Schroers (CBS 921.97) and Clonostachys spinulosispora Lechat & J. Fourn. (CBS 133762) were used as the outgroup taxa in the analysis. The dataset included 25 taxa, and consisted of 2,994 (ITS, 569; LSU, 779; RPB2, 780, and tef-1α, 866) characters with alignment gaps.
Figure 4.
Phylogram retrieved from IQ-TREE of the placement of new strains in Trichotheciums. str. using the combined dataset of ITS, LSU, RPB2 and tef-1α gene regions. The statistical values are provided at nodes as ML/PP (ML value above 70% and BI value above 0.70). The tree is rooted with Clonostachys phyllophila (CBS 921.97) and Clonostachys spinulosispora (CBS 133762). Ex-types, new strains are indicated by the superscript “T” and in bold, respectively.
The selected model for the ML analysis was TIM2+F+I+G4. The final value of the highest scoring tree was –17,969.800, which was obtained from the ML analysis of the dataset. The parameters of the GTR model used to analyze the dataset were estimated based on the following frequencies: A = 0.228, C = 0.283, G = 0.280, T = 0.209; substitution rates AC = 1.39668, AG = 2.51979, AT = 1.39668, CG = 1.00000, CT = 6.81690 and GT = 1.00000, as well as the gamma distribution shape parameter α = 0.586. The selected model of the dataset for BI analysis was GTR+F+I+G4 (ITS, LSU, tef-1α) and SYM+I+G4 (RPB2). The phylogenetic tree (Fig. 4) constructed using ML and BI analyses was largely congruent and strongly supported in most branches. Strains DY05461, DY05462, DY05591 and DY05592 formed an independent clade with high statistical support (100% ML/1 PP) and were clustered with Trichothecium crotocinigenum (Schol-Schwarz) Summerb. et al. in a clade with high statistical support in ML and BI analysis (99% ML/1 PP).
In addition, the type strain of Myrotheciomyces corymbiae Crous (CPC 33206), the type species of Myrotheciomyces and another strain of the same species (i.e. CBS144420) (Crous et al. 2018) reside in the Trichotheciums. str. clade. This placement agrees with Hou et al. (2023), hence, we propose to regard the younger, asexual typified name as a synonym of the older, asexual typified name, i.e. Trichothecium over Myrotheciomyces.
Taxonomy
Bionectriaceae Samuels & Rossman, Stud. Mycol. 42: 15, 1999
Ovicillium Zare & W. Gams, Mycol. Progr. 15: 1020, 2016
. Ovicillium zunyiense
W.H. Chen, Y.F. Han, J.D. Liang & J.H. Zhao sp. nov.
1F975BCF-52A7-52F4-95CB-441F5A8098C2
859496
Figure 5.
Ovicillium zunyiense A. Infected larva; B, C. PDA culture plate showing the top (B) and reverse (C) sides of the colony; D–J. Phialides and conidia. Scale bars: 10 mm (B, C) and 10 μm (D–J).
Etymology.
Referring to its location, Zunyi City, where the fungus was first discovered.
Type.
China • Guizhou Province, Zunyi City, Honghuagang District, Dabanshui National Forest Park (27°46'35.904"N, 106°48'30.89"E). On a dead larva (Lepidoptera), on the leaf litter, 2 September 2023, Wanhao Chen, GZAC ZY0927, holotype; ZY09271, ex-type.
Diagnosis.
Differs from Ovicillium oosporum by its shorter conidiophore, smaller conidia and its insect substrate. Differs from O. subglobosum by its shorter phialides, smaller ovoid to subglobose conidia and insect substrate. Differs from O. theobromae by its shorter conidiophores, shorter phialides and insect substrate. Differs from O. variecolor by its shorter conidiophores, shorter phialides, absence of sessile conidia and insect substrate.
Description.
Colonies on PDA, attaining a diameter of 42–45 mm after 14 days at 25 °C, grayish-white to light brown, consisting of a basal felt, floccose hyphal overgrowth; reverse light brown to brown. Hyphae septate, hyaline, smooth-walled, 1.6–1.7 μm wide. Conidiophores hyaline, smooth-walled, with single phialide or whorls of 2–4 phialides or verticillium-like from hyphae directly, 17.4–26.2 × 2.3–3.0 μm (x̄= 20.8 × 2.6 μm, n = 30). Phialides cylindrical, somewhat inflated base, 21.6–33.3 × 1.2–2.6 μm (x̄= 28.2 × 1.7 μm, n = 30), tapering to a thin neck. Conidia hyaline, smooth-walled, ovoid to subglobose, 2.3–3.7 × 1.7–2.6 μm (x̄= 2.7 × 2.1 μm, n = 30). Sexual state not observed.
Host.
Larva (Lepidoptera).
Habitat.
Near the road, located on the leaf litter.
Additional strain examined.
China • Guizhou Province, Zunyi City, Honghuagang District, Dabanshui National Forest Park (27°46'35.904"N, 106°48'30.89"E). On a dead larva (Lepidoptera),on the leaf litter, 2 September 2023, Wanhao Chen, ZY09272 (living culture).
Remarks.
Based on BLASTn results, strains ZY09271 and ZY09272 were identified as members of Ovicilliums. str., and the phylogenetic analysis of the combined datasets 1 and 2 (Figs 1, 2). It clustered into an independent clade with a close relationship with Ovicillium oosporum, O. subglobosum, O. theobromae and O. variecolor with a high support value (98% ML/1 PP). Compared with the typical characteristics, Ovicillium zunyiense can be distinguished from O. oosporum by its shorter conidiophores (17.4–26.2 × 2.3–3.0 μm vs. 20–50 × 1.2–2.2 μm), smaller conidia (2.3–3.7 × 1.7–2.6 μm vs. 4–6 × 2.5–4.0 μm) and its substrates (insect vs. plant). Ovicillium zunyiense can be distinguished from O. subglobosum by its short phialides (21.6–33.3 × 1.2–2.6 μm vs. 25–55 × 1.5–2.2 μm), smaller ovoid to subglobose conidia (2.3–3.7 × 1.7–2.6 μm vs. 3.5–5.5 × 3.5–4.5 μm) and its substrates (insect vs. soil). Ovicillium zunyiense can be distinguished from O. theobromae by its short conidiophores (17.4–26.2 × 2.3–3.0 μm vs. 460 × 1.5–3.2 μm), short phialides (21.6–33.3 × 1.2–2.6 μm vs. 28.4–65.5 × 1.2–1.8 μm) and its substrates (insect vs. plant). Ovicillium zunyiense can be distinguished from O. variecolor by its short conidiophores (17.4–26.2 × 2.3–3.0 μm vs. 290 μm long), short phialides (21.6–33.3 × 1.2–2.6 μm vs. 18–95 × 1–2 μm), absence of sessile conidia and its substrates (insect vs. soil). Thus, the morphological characteristics and molecular phylogenetic results support to establishment of O. zunyienseas a new species.
Taxonomic key to distinguish the species of Ovicillium
| 1 | Chlamydospores present | 2 |
| – | Chlamydospores absent | 3 |
| 2 | Chlamydospores abundant, Conidia globose | Ovicillium asperulatum |
| – | Scarce chlamydospores may be present, Conidia subglobose, oval to broadly oval | Ovicillium oosporum |
| 3 | The sessile conidia absent | 4 |
| – | The sessile conidia present | Ovicillium variecolor |
| 4 | Conidia oval, subglobose or globose | 5 |
| – | Conidia ellipsoidal to cylindrical | Ovicillium pseudoattenuatum |
| 5 | Conidiophore smooth | 6 |
| – | Conidiophore near the base roughened | Ovicillium attenuatum |
| 6 | Soil or plant substrates | 7 |
| – | Insect substrates | 8 |
| 7 | Soil substrates, conidia subglobose, 3.5–5.5 × 3.5–4.5 μm | Ovicillium subglobosum |
| – | Plant substrates, conidia subglobose or ellipsoid, (2.8–)3.0–3.7(–4.4) × (2.2–)2.3–2.9(–3.1) μm | Ovicillium theobromae |
| 8 | Conidia globose to ovoid, 2.1–2.9 × 1.1–1.7 μm | Ovicillium sinense |
| – | Conidia ovoid to subglobose, 2.3–3.7 × 1.7–2.6 μm | Ovicillium zunyiense |
Clavicipitaceae Rogerson, Mycologia 62(5): 900, 1970
Conoideocrella D. Johnson, G.H. Sung, Hywel-Jones & Spatafora, Mycol. Res. 113(3): 286, 2009
. Conoideocrella tiankengensis
W.H. Chen, Y.F. Han, J.D. Liang & J.H. Zhao sp. nov.
017EFA6B-2088-5863-AB71-BE30D258DEB2
859499
Figure 6.
Conoideocrella tiankengensis A. Infected scale insect; B, C. PDA culture plate showing the top (B) and reverse (C) sides of the colony; D–J. Conidiogenous structures and conidia. Scale bars: 10 mm (B, C) and 10 μm (D–J).
Etymology.
Referring to its location, Monkey-Ear Tiankeng, where the fungus was first discovered.
Type.
China • Guizhou Province, Guiyang City, Monkey-Ear Tiankeng (27°5'12.138'’ N, 107°0'48.42'’ E). On a dead scale insect (Coccoidea),on the leaf, 6 April 2024, Wanhao Chen, GZAC KY0407, holotype; KY04071, ex-type.
Diagnosis.
Differs from Conoideocrella luteorostrata by its shorter and hyaline conidiophore, two types of phialides and fusiform to filiform conidia.
Description.
Colonies grow slowly on PDA at 25 ◦C, attaining a diam. of 26–39 mm in 14 days, white to cream-white mycelium at first, turning pale yellow with age. Colonies loose on the edge and compact in the middle. Hyphae smooth, septate, hyaline, 1.7–2.4 μm wide. Conidiophores hyaline, smooth-walled, with single phialide or whorls of 2–4 phialides or verticillium-like from hyphae directly, 13.6–23.2 × 1.6–2.6 μm (x̄= 17.2 × 2.0 μm, n = 30). Two types of conidiogenous structures were present. Hirsutella-like asexual state arises from hyphae, conidiogenous structures with slender base tapering more or less evenly to a neck, hyaline, produced directly on the hyphae, 15.1–27.1 × 1.6–1.8 μm (x̄= 21.4 × 1.7 μm, n = 30). Isaria-like conidiogenous structures also arises from hyphae, cylindrical to ellipsoidal, somewhat inflated base, tapering to a thin neck, 9.8–13.5 × 1.4–1.8 μm (x̄= 10.8 × 1.7 μm, n = 30). Conidia hyaline, smooth, fusiform to filiform, forming short divergent and basipetal chains, 5.3–6.7 × 1.6–2.2 μm (x̄= 5.9 × 1.8 μm, n = 30).
Host.
Scale insect (Coccoidea).
Habitat.
Near the road, located on the leaf.
Additional strain examined.
China • Guizhou Province, Guiyang City, Monkey-Ear Tiankeng (27°5'12.138'’ N, 107°0'48.42'’ E). On a dead scale insect (Coccoidea), on the leaf, 6 April 2024, Wanhao Chen, KY04072 (living culture).
Remarks.
Conoideocrella tiankengensis was identified as Conoideocrella, based on the BLASTn result in NCBI and the phylogenetic analysis of the combined datasets 1 and 3 (Figs 1, 3). It clustered into an independent clade with a close relationship with C. luteorostrata with high statistical values (100% ML/1 PP). Compared with the typical characteristics, C. tiankengensis can be distinguished from C. luteorostrata by its shorter and hyaline conidiophore (13.6–23.2 × 1.6–2.6 μm vs. 150–240 × 2.0–3.0 μm), two types of phialides and fusiform to filiform conidia (Hywel-Jones 1993). Thus, the morphological characteristics and molecular phylogenetic results support C. tiankengensis as a new species.
Taxonomic key to distinguish the species of Conoideocrella
| 1 | The sexual morphabsent | 2 |
| – | The sexual morph present | 3 |
| 2 | Spider host, Hirsutella-like conidiogenous structure, 12.7–89.9 × 0.4–1.3 μm | Conoideocrella gongyashanensis |
| – | Scale insect host, Hirsutella-like and isaria-like conidiogenous structure, 15.1–27.1 × 1.6–1.8 μm and 9.8–13.5 × 1.4–1.8 μm, respectively | Conoideocrella tiankengensis |
| 3 | Stromata flattened pulvinate to discoid, planar, pulvinate, almost planar | 4 |
| – | Stromata scutate or hemi-globose | Conoideocrella fenshuilingensis |
| 4 | Perithecia < 600 μm long | 5 |
| – | Perithecia > 600 μm long | Conoideocrella luteorostrata |
| 5 | Stromata pale yellow, orange to reddish brown; Asci < 180 μm long; Conidia 8–15 × 2–4 μm | Conoideocrella krungchingensis |
| – | Stromata white to orangish-pink; Asci > 180 μm long; Conidia 6.1–12.5 × 1.3–2.3 μm | Conoideocrella tenuis |
Myrotheciomycetaceae Crous, Persoonia 40: 351, 2018
. Trichothecium
Link, Mag. Gesell. naturf. Freunde, Berlin 3(1-2): 18, 1809
2A2908FC-8F51-5BBF-ABB1-F0509EA65772
=Myrotheciomyces Crous, Persoonia 40: 351, 2018; MycoBank no.: 825409
Note.
The family Myrotheciomycetaceae was introduced by Crous et al. (2018) with four genera, Emericellopsis J.F.H. Beyma, Leucosphaerina Arx, Myrotheciomyces Crous and Trichothecium Link. Bao et al. (2023) exclude Emericellopsis from Myrotheciomycetaceae based on the phylogenetic analysis and showed that the type strain of Myrotheciomyces corymbiae (CPC 33206) is accommodated in Trichotheciums. str. In the present study, the type strain of Myrotheciomyces corymbiae clustered in the Trichothecium clade (Fig. 4). Thus, we propose to synonymize Myrotheciomyces with Trichothecium as the latter is the older generic epithet.
. Trichothecium sinense
W.H. Chen, Y.F. Han, J.D. Liang & J.H. Zhao sp. nov.
63D9201E-C3F2-5C2F-89B4-D026E3EC23C3
859500
Figure 7.
Trichothecium inense A. Infected spider; B, C. PDA culture plate showing the top (B) and reverse (C) sides of the colony; D–L. Phialides and conidia. Scale bars: 10 mm (B, C) and 10 μm (D–L).
Etymology.
Referring to its location, China, where the fungus was first discovered.
Type.
China • Guizhou Province, Qiannan Buyi and Miao Autonomous Prefecture, Duyun City, Mayao River Valley (26°21'24.71"N, 107°22'48.22"E). On a dead spider (Araneae),on or under rocks, 1 May 2022, Wanhao Chen, GZAC DY0546, holotype;DY05461, ex-type.
Diagnosis.
Differs from Trichothecium crotocinigenum by its shorter phialides, larger conidia and spider host.
Description.
Colonies on PDA, attaining a diameter of 86–90 mm after 14 days at 25 °C, white, consisting of a basal felt, floccose hyphal overgrowth; reverse light yellow. Conidiophores solitary, (sub-)erect, arising directly from submerged or superficial hyphae, 14.3–23.1 × 1.4–2.6 μm (x̄= 17.7 × 1.8 μm, n = 30). Phialides lateral or terminal, cylindrical, occasionally swollen in the lower part, hyaline, thick-, smooth-walled, 32.8–55.1 × 1.9–3.0 μm (x̄= 46.9 × 2.6 μm, n = 30). Conidia aseptate, cylindrical, oblong or ovoid, rounded at both ends, hyaline, thin-, smooth-walled, 4.8–5.8 × 1.2–2.9 μm (x̄= 5.5 × 2.4 μm, n = 30), arranged in slimy heads. Chlamydospores not observed. Sexual morph not observed.
Host.
Spider (Araneae).
Habitat.
Near the road, located on or under rocks.
Additional material examined.
China • Guizhou Province, Qiannan Buyi and Miao Autonomous Prefecture, Duyun City, Mayao River Valley (26°21'24.71"N, 107°22'48.22"E). On a dead spider (Araneae),on or under rocks, 1 May 2022, Wanhao Chen, DY05462 (living culture); GZAC DY0559 (specimen), DY05591, DY05592 (living culture).
Remarks.
Trichothecium sinensewas identified as Trichothecium, based on the BLASTn result in NCBI and the phylogenetic analysis of the combined datasets 1and 4 (Figs 1, 4). It clustered into an independent clade with a close relationship with Trichothecium crotocinigenum with high statistical values (99% ML/1 PP). Compared with the typical microscopic characteristics, Trichothecium sinense can be distinguished from T. crotocinigenum by its shorter phialides (32.8–55.1 × 1.9–3.0 μm vs. 168 μm long), larger conidia [4.8–5.8 × 1.2–2.9 μm vs. 3–8(–11) × 2–3 μm] and its substrates (mushroom vs. spider). Thus, the morphological characteristics and molecular phylogenetic results support T. sinense as a new species.
New combination
. Trichothecium corymbiae
(Crous) W.H. Chen &Wijayaw. comb. nov.
51AEDE40-1F26-5931-98A3-64285DD743F1
859678
= Myrotheciomyces scorymbiae Crous, Persoonia 40: 351, 2018.
Note.
We proposed to treat Myrotheciomyces as a synonym of Trichothecium based on the phylogenetic analyses (Figs 1, 4) and therefore transferred Myrotheciomyces corymbiae to the genus Trichothecium as Trichothecium corymbiae.
Discussion
Guizhou Province, as a typical karst region, exhibits exceptional habitat diversity, including plains, mountains, hills, caves, valleys, and forests. Hypocrealean fungi in this region have been extensively studied and current research reveal a significant concentration of Clavicipitaceae, Cordycipitaceae, and Ophiocordycipitaceae (Chen et al. 2022b, 2024d, 2025; Zhang et al. 2023; Bu et al. 2025; Xu et al. 2025). At the same time, other families remain understudied or poorly known. Moreover, these investigations have been predominantly limited to soil and forest ecosystems. Previous studies have revealed a remarkably high species diversity of Hypocrealean fungi in karst tiankengs and valley habitats, warranting further scientific investigation (Chen et al. 2022b, 2023, 2024d; Jiang et al. 2025). Recent taxonomic assessments highlight the need for expanded biodiversity surveys in karst ecosystems, particularly in under-characterized microhabitats (Wijayawardene et al. 2021).
In the present study, three new species, Conoideocrella tiankengensis, Ovicillium zunyiense and Trichothecium sinense were collected from Tiankeng, a karst forest and valley; the three species belong to the families Clavicipitaceae, Bionectriaceae and Myrotheciomycetaceae respectively. All three aforementioned fungal species demonstrate obligate associations with arthropod hosts. Notably, species in the genus Conoideocrella D. Johnson, G.H. Sung, Hywel-Jones & Spatafora all parasitize scale insects, with the exception of C. gongyashanensis (L.B. Lin & J.Z. Qiu), which parasitizes spiders (Hywel-Jones 1993; Mongkolsamrit et al. 2016; Wang et al. 2024; Lin et al. 2025). Conoideocrella species had only been documented in Yunnan and Fujian Province (Wang et al. 2024; Lin et al. 2025), and the new species was introduced from a karst habitat for the first time.
The genus Trichothecium Link was introduced with the type species Trichothecium roseum (Pers.) Link. Summerbell et al. (2011) revised Trichothecium and restricted this genus into five species: Trichothecium crotocinigenum, T. indicum (Arx, Mukerji & N. Singh) Summerbell, Seifert, & Schroers, T. ovalisporum (Seifert & Rehner) Seifert & Rehner, T. roseum and T. sympodiale Summerbell, Seifert, & Schroers. Hou et al. (2023) introduced a new species Trichothecium hongkongense L.W. Hou, L. Cai & Crous. These species have been mainly reported from covers manure, living leaves, mushroom, cereal silage and leaf-cutter bee (MycoBank, https://www.mycobank.org/). In this study, anarthropod-associated species, T. sinense, is introduced for the first time. Further research is needed to elucidate the environmental adaptation mechanisms in these species. Moreover, a new species in the family Myrotheciomycetaceae was introduced from Guizhou karst habitat for the first time.
The genus Ovicillium Zare & W. Gams was introduced with the type species, O. attenuatum Zare & W. Gams (Zare and Gams 2016). Chen et al. (2024a) summarized that the genus Ovicillium consists of five species and reported a new species Ovicillium sinense Wan H. Chen, Y.F. Han & J.D. Liang. Two new species Ovicillium pseudoattenuatum Y. Wang & D.X. Tang and O. theobromae Lin Zhao & Crous, were isolated from soil and plant by Wang et al. (2025c) and Zhao et al. (2025). Among these, only two species, Ovicillium sinense and O. zunyiense were arthropod-associated species. Whether this correlates with their ambient environment warrants further investigation.
Fungi in the order Hypocreales exhibit an evolutionary progression of trophic modes, transitioning from plant-based nutrition (including both living tissues and plant debris) to animal hosts (particularly insects), and ultimately to fungal substrates (Spatafora et al. 2007). This stepwise adaptation reflects an ecological optimization strategy for acquiring optimal nutrient resources (Behie et al. 2013; Behie and Bidochka 2014; Moonjely et al. 2016; Vidhate et al. 2023). Our study introduced two arthropod-associated species, Ovicillium zunyiense and Trichothecium sinense, which are seldom reported in the genera Ovicillium and Trichothecium. How environmental factors drive host-specific adaptations in these fungi is worthy of further research.
Supplementary Material
Citation
Chen W-H, Shu H-L, Li D, Liang J-D, Ren X-X, Wijayawardene NN, Han Y-F, Zhao J-H (2025) Morphological and phylogenetic evidence reveals three new arthropod-associated species of Hypocreales (Clavicipitaceae, Bionectriaceae, and Myrotheciomycetaceae) from karst habitats in Guizhou, China. MycoKeys 123: 319–353. https://doi.org/10.3897/mycokeys.123.164334
Funding Statement
This work was funded by National Natural Science Foundation of China (31860002), Science and Technology Foundation of Guizhou Province (No. qiankehejichu-ZK [2022] general 482), Construction Program of Key Laboratory of Guizhou Province (Qiankehepingtairencai-ZDSYS[2023]004), Guizhou Province Science and Technology Innovation Leading Talent Workstation for Traditional Chinese Medicine and Ethnic Medicine (QiankehepingtaiKXJZ[2024]034), Central Guidance for Local Science and Technology Development Fund Projects (Qiankehezhongyindi〔2025〕024), Research Center Project of Guizhou University of Traditional Chinese Medicine (Guizhongyi ZX hezi [2024]021).
Contributor Information
Yan-Feng Han, Email: swallow1128@126.com.
Jie-Hong Zhao, Email: zhaojiehong020@gzy.edu.cn.
Additional information
Conflict of interest
The authors have declared that no competing interests exist.
Ethical statement
No ethical statement was reported.
Use of AI
No use of AI was reported.
Funding
No funding was reported.
Author contributions
This work was funded by National Natural Science Foundation of China (31860002), Science and Technology Foundation of Guizhou Province (No. qiankehejichu-ZK [2022] general 482), Construction Program of Key Laboratory of Guizhou Province (Qiankehepingtairencai-ZDSYS[2023]004), Guizhou Province Science and Technology Innovation Leading Talent Work-station for Traditional Chinese Medicine and Ethnic Medicine (QiankehepingtaiKXJZ [2024] 034), Central Guidance for Local Science and Technology Development Fund Projects (Qianke-hezhongyindi [2025] 024), Research Center Project of Guizhou University of Traditional Chi-nese Medicine (Guizhongyi ZX hezi [2024] 021).
Author ORCIDs
Wan-Hao Chen https://orcid.org/0000-0001-7240-6841
Jian-Dong Liang https://orcid.org/0000-0002-3939-3900
Nalin N. Wijayawardene https://orcid.org/0000-0003-0522-5498
Yan-Feng Han https://orcid.org/0000-0002-8646-3975
Data availability
All of the data that support the findings of this study are available in the main text or Supplementary Information.
Supplementary materials
List of recent studies reported new arthropods-associated fungi in nine families
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
docx
Aligement of ITS for dataset 1
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of LSU for dataset 1
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of RPB2 for dataset 1
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of tef-1a for dataset 1
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Dataset 1 for analysis 1
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
nxs
Aligement of ITS for dataset 2
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of LSU for dataset 2
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of RPB2 for dataset 2
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of tef-1a for dataset 2
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Dataset 2 for analysis 2
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
nxs
Aligement of ITS for dataset 3
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of LSU for dataset 3
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of RPB2 for dataset 3
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of tef-1a for dataset 3
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Dataset 3 for analysis 3
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
nxs
Aligement of ITS for dataset 4
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of LSU for dataset 4
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of RPB2 for dataset 4
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of tef-1a for dataset 4
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Dataset 4 for analysis 4
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
nxs
References
- Bao DF, Hyde KD, Maharachchikumbura SS, Perera RH, Thiyagaraja V, Hongsanan S, Wanasinghe DN, Shen HW, Tian XG, Yang LQ, Luo ZL. (2023) Taxonomy, phylogeny and evolution of freshwater Hypocreomycetidae (Sordariomycetes). Fungal Diversity 121(1): 1–94. 10.1007/s13225-023-00521-8 [DOI] [Google Scholar]
- Behie SW, Bidochka MJ. (2014) Nutrient transfer in plant–fungal symbioses. Trends in Plant Science 19(11): 734–740. 10.1016/j.tplants.2014.06.007 [DOI] [PubMed] [Google Scholar]
- Behie SW, Padilla-Guerrero IE, Bidochka MJ. (2013) Nutrient transfer to plants by phylogenetically diverse fungi suggests convergent evolutionary strategies in rhizospheric symbionts. Communicative & Integrative Biology 6(1): e22321. 10.4161/cib.22321 [DOI] [PMC free article] [PubMed]
- Bu J, Wei DP, Liu ZH, Yang Y, Liu ZL, Kang JC, Peng XC, Xie SW, Zhang HG, He ZJ, Huang SK, Zhang X, Hyde KD, Wijayawardene NN, Wen TC. (2025) Molecular phylogeny and morphology reveal four novel species in Cordycipitaceae in China. MycoKeys 116: 91–124. 10.3897/mycokeys.116.147006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cabral A, Rego C, Nascimento T, Oliveira H, Groenewald JZ, Crous PW. (2012) Multi-gene analysis and morphology reveal novel Ilyonectria species associated with black foot disease of grapevines. Fungal Biology 116(1): 62–80. 10.1016/j.funbio.2011.09.010 [DOI] [PubMed] [Google Scholar]
- Cai L, Jeewon R, Hyde KD. (2006) Phylogenetic investigations of Sordariaceae based on multiple gene sequences and morphology. Mycological Research 110(2): 137–150. 10.1016/j.mycres.2005.09.014 [DOI] [PubMed] [Google Scholar]
- Castlebury LA, Rossman AY, Sung GH, Hyten AS, Spatafora JW. (2004) Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycological Research 108(8): 864–872. 10.1017/S0953756204000607 [DOI] [PubMed] [Google Scholar]
- Chen WH, Liu C, Han YF, Liang JD, Tian WY, Liang ZQ. (2019) Three novel insect-associated species of Simplicillium (Cordycipitaceae, Hypocreales) from Southwest China. MycoKeys 58: 83–102. 10.3897/mycokeys.58.37176 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen W, Liang J, Ren X, Zhao J, Han Y, Liang Z. (2021) Cryptic diversity of Isaria-like species in Guizhou, China. Life 11(10): 1093. 10.3390/life11101093 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen WH, Liang JD, Ren XX, Zhao JH, Han YF, Liang ZQ. (2022a) Phylogenetic, ecological and morphological characteristics reveal two new spider-associated genera in Clavicipitaceae. MycoKeys 91: 49–66. 10.3897/mycokeys.91.86812 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen WH, Liang JD, Ren XX, Zhao JH, Han YF, Liang ZQ. (2022b) Species diversity of Cordyceps-like fungi in the Tiankeng karst region of China. Microbiology Spectrum 10(5): e01975–22. 10.1128/spectrum.01975-22 [DOI] [PMC free article] [PubMed]
- Chen WH, Liang JD, Ren XX, Zhao JH, Han YF. (2023) Two new species of Samsoniella (Cordycipitaceae, Hypocreales) from the Mayao River Valley, Guizhou, China. MycoKeys 99: 209–226. 10.3897/mycokeys.99.109961 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen WH, Li D, Wei YJ, Liang JD, Han YF. (2024a) Ovicillium sinense, a new species from Guizhou, China. Phytotaxa 662(2): 195–200. 10.11646/phytotaxa.662.2.8 [DOI] [Google Scholar]
- Chen WH, Li D, Liang JD, Ren XX, Zhao JH, Han YF. (2024b) Chlorocillium sinense sp. nov. (Clavicipitaceae) and Calcarisporium guizhouense sp. nov. (Calcarisporiaceae) in Hypocreales from China. MycoKeys 109: 91–107. 10.3897/mycokeys.109.128060 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen WH, Li D, Liang JD, Ren XX, Zhao JH, Han YF. (2024c) Two new Cordyceps-like species, Perennicordyceps zongqii sp. nov. (Polycephalomycetaceae) and Purpureocillium zongqii sp. nov. (Ophiocordycipitaceae), in Hypocreales from karst region of China. MycoKeys 110: 141–158. 10.3897/mycokeys.110.135724 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen WH, Li D, Shu HL, Liang JD, Han YF. (2024d) Taxonomic and phylogenetic characterizations reveal two new species and a new record of Simplicillium (Cordycipitaceae, Hypocreales) from the Mayao River Valley, Guizhou, China. Phytotaxa 677(3): 278–288. 10.11646/phytotaxa.677.3.7 [DOI] [Google Scholar]
- Chen WH, Li D, Shu HL, Liang JD, Zhao JH, Tian WY, Han YF. (2025) Four new araneogenous species and a new genus in Hypocreales (Clavicipitaceae, Cordycipitaceae) from the karst region of China. MycoKeys 112: 335–359. 10.3897/mycokeys.112.140799 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G. (2004) MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology 50(1): 19–22. [Google Scholar]
- Crous PW, Schumacher RK, Wingfield MJ, Lombard L, Giraldo A, Christensen M, Gardiennet A, Nakashima C, Pereira OL, Smith AJ, Groenewald JZ. (2015) Fungal systematics and evolution: FUSE 1. Sydowia 67: 81–118. 10.12905/0380.sydowia67-2015-0081 [DOI] [Google Scholar]
- Crous PW, Wingfield MJ, Burgess TI, Hardy GEStJ, Gené J, Guarro J, Baseia IG, García D, Gusmão LFP, Souza-Motta CM, Thangavel R, Adamčík S, Barili A, Barnes CW, Bezerra JDP, Bordallo JJ, Cano-Lira JF, de Oliveira RJV, Ercole E, Hubka V, Iturrieta-González I, Kubátová A, Martín MP, Moreau PA, Morte A, Ordoñez ME, Rodríguez A, Stchigel AM, Vizzini A, Abdollahzadeh J, Abreu VP, Adamčíková K, Albuquerque GMR, Alexandrova AV, Álvarez Duarte E, Armstrong-Cho C, Banniza S, Barbosa RN, Bellanger JM, Bezerra JL, Cabral TS, Caboň M, Caicedo E, Cantillo T, Carnegie AJ, Carmo LT, Castañeda Ruíz RF, Clement CR, Čmoková A, Conceição LB, Cruz RHSF, Damm U, da Silva BDB, da Silva GA, da Silva RMF, de Santiago ALCM, Déniel F, de Oliveira LF, de Souza CAF, Déniel F, Dima B, Dong G, Edwards J, Félix CR, Fournier J, Gibertoni TB, Hosaka K, Iturriaga T, Jadan M, Jany JL, Jurjević Ž, Kolařík M, Kušan I, Landell MF, Leite Cordeiro TR, Lima DX, Loizides M, Luo S, Machado AR, Madrid H, Magalhães OMC, Marinho P, Matočec N, Mešić A, Miller AN, Morozova OV, Neves RP, Nonaka K, Nováková A, Oberlies NH, Oliveira-Filho JRC, Oliveira TGL, Papp V, Pereira OL, Perrone G, Peterson SW, Pham THG, Raja HA, Raudabaugh DB, Řehulka J, Rodríguez-Andrade E, Saba M, Schauflerová A, Shivas RG, Simonini G, Siqueira JPZ, Sousa JO, Stajsic V, Svetasheva T, Tan YP, Tkalčec Z, Ullah S, Valente P, Valenzuela-Lopez N, Abrinbana M, Viana Marques DA, Wong PTW, Xavier de Lima V, Groenewald JZ. (2018) Fungal Planet description sheets: 716–784. Persoonia 40: 240–393. 10.3767/persoonia.2018.40.10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ding M, Li Y, Bai Y, Gai P, Wang J, Jiang ZZ, Hu YF, XU LJ. (2024) Albacillium hingganense gen. et sp. nov.(Clavicipitaceae) from forest litters in Northeast China. Phytotaxa 650(2): 157–168. 10.11646/phytotaxa.650.2.3 [DOI] [Google Scholar]
- Drummond A, Rambaut A. (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7(1): e214. 10.1186/1471-2148-7-214 [DOI] [PMC free article] [PubMed]
- Duan YF, Li M, Xu KW, Zhang L, Zhang LB. (2021) Protect China’s karst cave habitats. Science 374(6568): 699. 10.1126/science.abm5389 [DOI] [PubMed] [Google Scholar]
- Hou LW, Giraldo A, Groenewald JZ, Rämä T, Summerbell RC, Huang GZ, Cai L, Crous PW. (2023) Redisposition of acremonium-like fungi in Hypocreales. Studies in Mycology 105: 23–203. 10.3114/sim.2023.105.02 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hywel-Jones NL. (1993) Torrubiella luteorostrata: A pathogen of scale insects and its association with Paecilomyces cinnamomeus with a note on Torrubiella tenuis. Mycological Research 97(9): 1126–1130. 10.1016/S0953-7562(09)80514-5 [DOI] [Google Scholar]
- Jaklitsch WM, Voglmayr H. (2012) Phylogenetic relationships of five genera of Xylariales and Rosasphaeria gen. nov. (Hypocreales). Fungal Diversity 52: 75–98. 10.1007/s13225-011-0104-2 [DOI] [Google Scholar]
- James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ, Celio G, Gueidan C, Fraker E, Miadlikowska J, Lumbsch HT, Rauhut A, Valérie Reeb A, Arnold E, Amtoft A, Stajich JE, Hosaka K, Sung GH, Johnson D, O’Rourke B, Crockett M, Binder M, Curtis JM, Slot JC, Wang Z, Wilson AW, Schüßler A, Longcore JE, O’Donnell K, Mozley-Standridge S, Porter D, Letcher PM, Powell MJ, Taylor JW, White MM, Griffith GW, Davies DR, Humber RA, Morton JB, Sugiyama J, Rossman AY, Rogers JD, Pfister DH, Hewitt D, Hansen K, Hambleton S, Shoemaker RA, Kohlmeyer J, Volkmann-Kohlmeyer B, Spotts RA, Serdani M, Crous PW, Hughes KW, Matsuura K, Langer E, Langer G, Untereiner WA, Lücking R, Büdel B, Geiser DM, Aptroot A, Diederich P, Schmitt I, Schultz M, Yahr R, Hibbett DS, Lutzoni F, McLaughlin DJ, Joseph W, Spatafora JW, Vilgalys R. (2006) Reconstructing the early evolution of Fungi using a six̄gene phylogeny. Nature 443(7113): 818–822. 10.1038/nature05110 [DOI] [PubMed] [Google Scholar]
- Jiang C, Qiu C, Wu Y, Zhu S, Shui W. (2025) Karst Tiankeng is the refuge of microbial diversity in the degraded Karst Landscape. Land Degradation & Development 36: 3516–3526. 10.1002/ldr.5582 [DOI] [Google Scholar]
- Johnson D, Sung GH, Hywel-Jones NL, Luangsa-ard JJ, Bischoff JF, Kepler RM, Spatafora JW. (2009) Systematics and evolution of the genus Torrubiella (Hypocreales, Ascomycota). Mycological Research 113(3): 279–289. 10.1016/j.mycres.2008.09.008 [DOI] [PubMed] [Google Scholar]
- Kalyaanamoorthy S, Minh BQ, Wong TK, Von Haeseler A, Jermiin LS. (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. 10.1038/nmeth.4285 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Katoh K, Standley DM. (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lawrey JD, Etayo J, Dal-Forno M, Driscoll KE, Diederich P. (2015) Molecular data support establishment of a new genus for the lichenicolous species Neobaryausneae (Hypocreales). The Bryologist 118(1): 83–92. 10.1639/0007-2745-118.1.083 [DOI] [Google Scholar]
- Li DW, Cowles RS, Vossbrinck CR. (2008) Metarhiziopsis microspora gen. et sp. nov. associated with the elongate hemlock scale. Mycologia 100(3): 460–466. 10.3852/07-078R1 [DOI] [PubMed] [Google Scholar]
- Liang JD, Han YF, Zhang JW, Du W, Liang ZQ, Li ZZ. (2011) Optimal culture conditions for keratinase production by a novel thermophilic Myceliophthora thermophila strain GZUIFR-H49-1. Journal of Applied Microbiology 110(4): 871–880. 10.1111/j.1365-2672.2011.04949.x [DOI] [PubMed] [Google Scholar]
- Liang ZQ, Liang JD, Chen WH, Han YF, Zou X. (2016) Phenotypic polymorphism of the stilbellaceousentomogenous fungi in an ant nest of Ponera II. A cryptic new Tilachlidium species, Tilachlidium poneraticum. Microbiology China 43(2): 379–385. 10.13344/j.microbiol.china.150379 [DOI] [Google Scholar]
- Lin L, Lin Y, Keyhani NO, Pu H, Yang J, Xiong CJ, Shang JY, Mao YC, Yang LX, Zheng MH, Mu TC, Li Y, Liang HL, Fan LF, Ma XL, Xiong W, Qiu JZ, Guan XY. (2025) New entomopathogenic species in the Clavicipitaceae family (Hypocreales, Ascomycota) from the subtropical forests of Fujian, China. Frontiers in Microbiology 16: 1532341. 10.3389/fmicb.2025.1532341 [DOI] [PMC free article] [PubMed]
- Liu YJ, Whelen S, Hall BD. (1999) Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Molecular Biology and Evolution 16(12): 1799–1808. 10.1093/oxfordjournals.molbev [DOI] [PubMed] [Google Scholar]
- Liu JK, Lu YZ, Cheewangkoon R, To-Anun C. (2018) Phylogeny and morphology of Helicotubeufia gen. nov., with three new species in Tubeufiaceae from aquatic habitats. Mycosphere 9: 495–509. 10.5943/mycosphere/9/3/4 [DOI] [Google Scholar]
- Lombard L, Crous PW, Wingfield BD, Wingfield MJ. (2010) Phylogeny and systematics of the genus Calonectria. Studies in Mycology 66(1): 31–69. 10.3114/sim.2010.66.03 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lombard L, van der Merwe NA, Groenewald JZ, Crous PW. (2015) Generic concepts in Nectriaceae. Studies in Mycology 80(1): 189–245. 10.1016/j.simyco.2014.12.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Long MK, Bai XY, Li ZL, Xue YY, Chen F, Li CJ, Ran C, Zhang SR, Du ZC, Song FJ, Xiao BQ, Xiong L. (2024) Positive contribution and negative impact of karst rocky desertification control on biodiversity in southwest China. Acta Geographica Sinica 79(1): 97–113. 10.11821/dlxb202401007 [DOI] [Google Scholar]
- Luo J, Zhuang WY. (2010) Bionectria vesiculosa sp. nov. from Yunnan, China. Mycotaxon 113(1): 243–249. 10.5248/113.243 [DOI] [Google Scholar]
- Ma Y, Suo F, Wang AL, Huang LD, Ye X, Zhang L, Li P, Gong J. (2012) Segregation and bacteriostasis research of endophytes from Ophiocordyceps gracilis (Grev.) GH Sung, JM Sung, Hywel–Jones and Spatafora. Biotechnology 2: 107–111. 10.3969/j.issn.1004-311X.2012.02.045 [DOI] [Google Scholar]
- Mongkolsamrit S, Thanakitpipattana D, Khonsanit A, Promharn R, Luangsa-ard JJ. (2016) Conoideocrella krungchingensis sp. nov., an entomopathogenic fungus from Thailand. Mycoscience 57(4): 264–270. 10.1016/j.myc.2016.03.003 [DOI] [Google Scholar]
- Moonjely S, Barelli L, Bidochka MJ. (2016) Insect pathogenic fungi as endophytes. Advances in Genetics 94: 107–135. 10.1016/bs.adgen.2015.12.004 [DOI] [PubMed] [Google Scholar]
- Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ. (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. 10.1093/molbev/msu300 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Özkan K, Gulsoy S, Mert A, Ozturk M, Muys B. (2010) Plant distribution-altitude and landform relationships in karstic sinkholes of Mediterranean region of Turkey. Journal of Environmental Biology 31(1): 51–60. [PubMed] [Google Scholar]
- Park MJ, Hong SB, Shin HD. (2015) Lecanicillium uredinophilum sp. nov. associated with rust fungi from Korea. Mycotaxon 130(4): 997–1005. 10.5248/130.997 [DOI] [Google Scholar]
- Peng XC, Wen TC, Wei DP, Liao YH, Wang Y, Zhang X, Wang GY, Zhou Y, Tangtrakulwanich K, Liang JD. (2024) Two new species and one new combination of Ophiocordyceps (Hypocreales, Ophiocordycipitaceae) in Guizhou. MycoKeys 102: 245–266. 10.3897/mycokeys.102.113351 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sanjuan T, Tabima J, Restrepo S, Læssøe T, Spatafora JW, Franco-Molano AE. (2014) Entomopathogens of Amazonian stick insects and locusts are members of the Beauveria species complex (Cordyceps sensu stricto). Mycologia 106(2): 260–275. 10.3852/13-020 [DOI] [PubMed] [Google Scholar]
- Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W, Fungal Barcoding Consortium Fungal Barcoding Consortium Author List, Bolchacova E, Voigt K, Crous PW, Miller AN, Wingfield MJ, Aime MC, An KD, Bai FY, Barreto RW, Begerow D, Bergeron MJ, Blackwell M, Boekhout T, Bogale M, Boonyuen N, Burgaz AR, Buyck B, Cai L, Cai Q, Cardinali G, Chaverri P, Coppins BJ, Crespo A, Cubas P, Cummings C, Damm U, de Beer ZW, de Hoog GS, Del-Prado R, Dentinger B, Diéguez-Uribeondo J, Divakar PK, Douglas B, Dueñas M, Duong TA, Eberhardt U, Edwards JE, Elshahed MS, Fliegerova K, Furtado M, García MA, Ge ZW, Griffith GW, Griffiths K, Groenewald JZ, Groenewald M, Grube M, Gryzenhout M, Guo LD, Hagen F, Hambleton S, Hamelin RC, Hansen K, Harrold P, Heller G, Herrera C, Hirayama K, Hirooka Y, Ho HM, Hoffmann K, Hofstetter V, Högnabba F, Hollingsworth PM, Hong SB, Hosaka K, Houbraken J, Hughes K, Huhtinen S, Hyde KD, James T, Johnson EM, Johnson JE, Johnston PR, Jones EBG, Kelly LJ, Kirk PM, Knapp DG, Kõljalg U, Kovács GM, Kurtzman CP, Landvik S, Leavitt SD, Liggenstoffer AS, Liimatainen K, Lombard L, Luangsa-ard JJ, Lumbsch HT, Maganti H, Maharachchikumbura SSN, Martin MP, May TW, McTaggart AR, Methven AS, Meyer W, Moncalvo JM, Mongkolsamrit S, Nagy LG, Nilsson RH, Niskanen T, Nyilasi I, Okada G, Okane I, Olariaga I, Otte J, Papp T, Park D, Petkovits T, Pino-Bodas R, Quaedvlieg W, Raja HA, Redecker D, Rintoul TL, Ruibal C, Sarmiento-Ramírez JM, Schmitt I, Schüßler A, Shearer C, Sotome K, Stefani FOP, Stenroos S, Stielow B, Stockinger H, Suetrong S, Suh SO, Sung GH, Suzuki M, Tanaka K, Tedersoo L, Telleria MT, Tretter E, Untereiner WA, Urbina H, Vágvölgyi C, Vialle A, Vu TD, Walther G, Wang QM, Wang Y, Weir BS, Weiß M, White MM, Xu JP, Yahr R, Yang ZL, Yurkov A, Zamora JC, Zhang N, Zhuang WY, White DS, Schindel D. (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences 109(16): 6241–6246. 10.1073/pnas.1117018109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Spatafora JW, Sung GH, Johnson D, Hesse C, O’Rourke B, Serdani M, Spotts R, Lutzoni F, Hofstetter V, Miadlikowska J, Reeb V, Gueidan C, Fraker E, Lumbsch T, Lücking R, Schmitt I, Hosaka K, Aptroot A, Roux C, Miller AN, Geiser DM, Hafellner J, Hestmark G, Arnold AE, Büdel B, Rauhut A, Hewitt D, Untereiner WA, Cole MS, Scheidegger C, Schultz M, Sipman H, Schoch CL. (2006) A five-gene phylogeny of Pezizomycotina. Mycologia 98(6): 1018–1028. 10.1080/15572536.2006.11832630 [DOI] [PubMed] [Google Scholar]
- Spatafora JW, Sung GH, Sung JM, Hywel‐Jones NL, White Jr JF. (2007) Phylogenetic evidence for an animal pathogen origin of ergot and the grass endophytes. Molecular Ecology 16(8): 1701–1711. 10.1111/j.1365-294X.2007.03225.x [DOI] [PubMed] [Google Scholar]
- Su Y, Tang Q, Mo F, Xue Y. (2017) Karst tiankengs as refugia for indigenous tree flora amidst a degraded landscape in southwestern China. Scientific Reports 7(1): 1–10. 10.1038/s41598-017-04592-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- Summerbell RC, Gueidan C, Schroers HJ, de Hoog GS, Starink M, Rosete YA, Guarro J, Scott JA. (2011) Acremonium phylogenetic overview and revision of Gliomastix, Sarocladium, and Trichothecium. Studies in Mycology 68(1): 139–162. 10.3114/sim.2011.68.06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun JZ, Dong CH, Liu XZ, Liu JK, Hyde KD. (2016) Calcarisporium cordycipiticola sp. nov., an important fungal pathogen of Cordyceps militaris. Phytotaxa 268(2): 135–144. 10.11646/phytotaxa.268.2.4 [DOI]
- Sun JZ, Liu XZ, Hyde KD, Zhao Q, Sajeewa S, Maharachchikumbura N, Camporesi E, Bhat J, Nilthong S, Lumyong S. (2017) Calcarisporium xylariicola sp. nov. and introduction of Calcarisporiaceae fam. nov. in Hypocreales. Mycological Progress 16(4): 433–445. 10.1007/s11557-017-1290-4 [DOI] [Google Scholar]
- Sun YR, Jayawardena RS, Sun JE, Wang Y. (2023) Pestalotioid species associated with medicinal plants in southwest China and Thailand. Microbiology Spectrum 11(1): e03987–e22. 10.1128/spectrum.03987-22 [DOI] [PMC free article] [PubMed]
- Sun JE, Fu L, Norphanphoun C, Chen XJ, Yu LF, Hyde KD, McKenzie EHC, Wang Y, Yang ZF, Liu FQ. (2024) Study on the diversity of rust pathogens from different hosts in Guizhou Province, China. Mycosphere 15(1): 473–653. 10.5943/mycosphere/15/1/4 [DOI] [Google Scholar]
- Sung GH, Spatafora JW, Zare R, Hodge KT, Gams W. (2001) A revision of Verticillium sect. Prostrata. II. Phylogenetic analyses of SSU and LSU nuclear rDNA sequences from anamorphs and teleomorphs of the Clavicipitaceae. Nova Hedwigia 72(3): 311–328. 10.1127/nova.hedwigia/72/2001/311 [DOI] [Google Scholar]
- Sung GH, Hywel-Jones NL, Sung JM, Luangsa-ard JJ, Shrestha B, Spatafora JW. (2007) Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Studies in Mycology 57: 5–59. 10.3114/sim.2007.57.01 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tarafder E, Zhang WJ, Karunarathna SC, Elgorban AM, Huilian M, Nan W, Zeng XY, Wang Y, Tian FH. (2024) Unveiling two new species of Trichoderma (Hypocreales, Hypocreaceae) that cause green mold disease on Stropharia rugosoannulata from Guizhou Province, China. MycoKeys 110: 361–383. 10.3897/mycokeys.110.134154 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Trifinopoulos J, Nguyen LT, von Haeseler A, Minh BQ. (2016) W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research 44(W1): W232–W235. 10.1093/nar/gkw256 [DOI] [PMC free article] [PubMed]
- Vaidya G, Lohman DJ, Meier R. (2011) SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics : The International Journal of the Willi Hennig Society 27(2): 171–180. 10.1111/j.1096-0031.2010.00329.x [DOI] [PubMed] [Google Scholar]
- Vidhate RP, Dawkar VV, Punekar SA, Giri AP. (2023) Genomic determinants of entomopathogenic fungi and their involvement in pathogenesis. Microbial Ecology 85: 49–60. 10.1007/s00248-021-01936-z [DOI] [PubMed] [Google Scholar]
- Vilgalys R, Hester M. (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172(8): 4238–4246. 10.1128/jb.172.8.4238-4246.1990 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang ZQ, Ma JM, Yang ZL, Zhao J, Yu ZY, Li JH, Yu H. (2024) Morphological and phylogenetic analyses reveal three new species of entomopathogenic fungi belonging to Clavicipitaceae (Hypocreales, Ascomycota). Journal of Fungi 10(6): 423. 10.3390/jof10060423 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang HY, Dong C, Zhang YW, Chen WH, Han YF. (2025a) Biconidium sinense gen. et sp. nov. (Hypocreales, Bionectriaceae) and Didymocyrtis shanxiensis sp. nov. (Phaeosphaeriaceae, Didymocyrtis) isolated from urban soil in China. MycoKeys 116: 327–344. 10.3897/mycokeys.116.146683 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang FH, Xu XL, Zeng Q, Liu LJ, Liu F, Deng Y, Sun QR, Yan YQ, Li XY, Xiang SS, Shui Q, Liu YG, Li SJ, Yang H, Han S, Liu L, Yang CL. (2025b) Microfungi associated with walnut trees in southwestern China. Mycosphere 16(1): 2002–2258. 10.5943/mycosphere/16/1/12 [DOI] [Google Scholar]
- Wang Y, Tang DX, Chen H, Li QR, Loinheuang C, Shen XC. (2025c) Phylogenetic evidence reveal a close relationship between Amphichorda and Ovicillium in Bionectriaceae (Hypocreales). MycoKeys 117: 337–352. 10.3897/mycokeys.117.151366 [DOI] [PMC free article] [PubMed] [Google Scholar]
- White TJ, Bruns T, Lee S, Taylor J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. (Eds) PCR protocols: a guide to methods and applications.Academic Press, New York, 315–322. 10.1016/B978-0-12-372180-8.50042-1 [DOI]
- Wijayawardene NN, Dissanayake LS, Li QR, Dai DQ, Xiao YP, Wen TC, Karunarathna SC, Wu HX, Zhang H, Tibpromma S, Kang JC, Wang Y, Shen XC, Tang LZ, Deng CY, Liu YX, Kang YQ. (2021) Yunnan–Guizhou Plateau: A mycological hotspot. Phytotaxa 523(1): 1–31. 10.11646/phytotaxa.523.1.1 [DOI] [Google Scholar]
- Wu J, Zhang CH. (2020) Research status and prospect of karst Tiankengs in Guizhou Province. Carsologica Sinica 39(1): 119–126. [Google Scholar]
- Xiao YP, Wen TC, Hongsanan S, Jeewon R, Luangsa-ard JJ, Brooks S, Wanasinghe DN, Long FY, Hyde KD. (2018) Multigene phylogenetics of Polycephalomyces (Ophiocordycipitaceae, Hypocreales), with two new species from Thailand. Scientific Reports 8(1): 18087. 10.1038/s41598-018-36792-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiao YP, Wang YB, Hyde KD, Eleni G, Sun JZ, Yang Y, Meng J, Yu H, Wen TC. (2023) Polycephalomycetaceae, a new family of clavicipitoid fungi segregates from Ophiocordycipitaceae. Fungal Diversity 120(1): 1–76. 10.1007/s13225-023-00517-4 [DOI] [Google Scholar]
- Xu Y, Shen ZH, Ying LX, Wang ZH, Huang JH, Zang RG, Jiang YX. (2017) Hotspot analyses indicate significant conservation gaps for evergreen broadleaved woody plants in China. Scientific Reports 7: 1859. 10.1038/s41598-017-02098-0 [DOI] [PMC free article] [PubMed]
- Xu ZS, Deng LP, Wang HY, Tian HL, Qu JJ, Dai YD, Zou X. (2025) Description of two new species of Ophiocordyceps: O. sinocampes and O. cystidiata (Ophiocordycipitaceae, Hypocreales) from typical karst landform forests in Guizhou, China. MycoKeys 114: 1–27. 10.3897/mycokeys.114.134323 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zare R, Gams W. (2016) More white verticillium-like anamorphs with erect conidiophores. Mycological Progress 15(10): 993–1030. 10.1007/s11557-016-1214-8 [DOI] [Google Scholar]
- Zhang N, Castlebury LA, Miller AN, Huhndorf SM, Schoch CL, Seifert KA, Rossman AY, Rogers JD, Kohlmeyer J, Volkmann-Kohlmeyer B, Sung GH. (2006) An overview of the systematics of the Sordariomycetes based on a four-gene phylogeny. Mycologia 98(6): 1076–1087. 10.1080/15572536.2006.11832635 [DOI] [PubMed] [Google Scholar]
- Zhang D, Gao F, Jakovlic I, Zou H, Zhang J, Li WX, Wang GT. (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 20(1): 348–355. 10.1111/1755-0998.13096 [DOI] [PubMed] [Google Scholar]
- Zhang ZY, Feng Y, Tong SQ, Ding CY, Tao G, Han YF. (2023) Morphological and phylogenetic characterisation of two new soil-borne fungal taxa belonging to Clavicipitaceae (Hypocreales, Ascomycota). MycoKeys 98: 113–132. 10.3897/mycokeys.98.106240 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao L, Groenewald JZ, Hou LW, Summerbell RC, Crous PW. (2025) Bionectriaceae: A poorly known family of hypocrealean fungi with major commercial potential. Studies in Mycology 111: 115–198. 10.3114/sim.2025.111.04 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhuang WY, Zeng ZQ. (2017) Cocoonihabitus sinensis gen. et sp. nov. on remaining leaf veins of cocoons in a new family (Cocoonihabitaceae fam. nov.) of Hypocreales. Mycosystema 36(12): 1591–1598. 10.13346/j.mycosystema.170176 [DOI] [Google Scholar]
- Zou X, Liu AY, Liang ZQ, Han YF, Yang M. (2010) Hirsutella libоensis, a new entomopathogenic species affecting Cossidae (Lepidoptera) in China. Mycotaxon 111(1): 39–44. 10.5248/111.39 [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
List of recent studies reported new arthropods-associated fungi in nine families
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
docx
Aligement of ITS for dataset 1
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of LSU for dataset 1
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of RPB2 for dataset 1
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of tef-1a for dataset 1
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Dataset 1 for analysis 1
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
nxs
Aligement of ITS for dataset 2
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of LSU for dataset 2
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of RPB2 for dataset 2
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of tef-1a for dataset 2
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Dataset 2 for analysis 2
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
nxs
Aligement of ITS for dataset 3
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of LSU for dataset 3
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of RPB2 for dataset 3
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of tef-1a for dataset 3
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Dataset 3 for analysis 3
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
nxs
Aligement of ITS for dataset 4
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of LSU for dataset 4
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of RPB2 for dataset 4
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Aligement of tef-1a for dataset 4
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
fas
Dataset 4 for analysis 4
This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Wan-Hao Chen, Hui-Lin Shu, Dan Li, Jian-Dong Liang, Xiu-Xiu Ren, Nalin N. Wijayawardene, Yan-Feng Han, Jie-Hong Zhao
Data type
nxs
Data Availability Statement
All of the data that support the findings of this study are available in the main text or Supplementary Information.