Abstract
Background
Campylobacter jejuni, commonly present in the intestinal tract of poultry, is a major causative agent of human gastroenteritis. To successfully colonize the chicken gut, C. jejuni needs to have access to certain amino acids. However, the amino acid profile and its availability in the gut is dependent on the type of ingested protein and its digestibility. Therefore, manipulating the digestibility of different protein sources, using an exogenous protease, may be a promising way to control Campylobacter colonization in chickens.
Results
Chickens were fed with an exclusive vegetarian protein source diet (veggy diet) or a diet also containing animal proteins (animal diet), with or without exogenous protease from one day of age. At 14 days of age, all chickens were inoculated with two C. jejuni strains. At 7 days post infection (dpi) and 21 dpi, liver, ileal, and cecal contents were collected and used to enumerate C. jejuni by bacterial culture. Ileal and cecal contents were also used to analyze intestinal microbiota through 16S rRNA gene sequencing. The protease supplementation of the vegetarian protein source diet reduced cecal colonization levels of C. jejuni, increased its ileal amounts, and inhibited its hepatic dissemination. The addition of exogenous protease to the vegetarian protein source diet also altered alpha and beta diversities of the cecal microbiota but not of the ileal microbiota. The protease supplementation of the animal protein-based diet had no effect on Campylobacter colonization or on alpha diversity, unlike the beta diversity of the cecal content. Moreover, protease addition to the plant protein diet increased the cecal abundance of several genera such as UBA1819, Faecalibacterium, and Anaerostipes. In contrast, this supplementation decreased the cecal abundance of genera such as Tuzzerella, Monoglobus, and Fournierella. Using microbial co-occurrence networks, we observed that Campylobacter was positively linked to Negativibacillus in the vegetarian protein source diet group, while it was positively linked to Anaerotruncus and Tuzzerella and negatively linked to Faecalibacterium in the supplemented vegetarian protein diet group.
Conclusions
Adding a commercially available protease to a vegetarian protein source diet appears to reduce C. jejuni colonization of the intestine, inhibit its translocation to the liver, and modify the cecal microbiota. These findings lead to further research questions on the interplay between C. jejuni strains, feed protein types, and commercial protease feed supplementation.
Supplementary Information
The online version contains supplementary material available at 10.1186/s13099-025-00760-x.
Keywords: Campylobacter jejuni, Broiler chickens, Intestinal colonization, Hepatic dissemination, Exogenous protease, Gut microbiota analysis, Co-occurrence network, Microbial pathways.
Background
Gastroenteritis in humans is often caused by Campylobacter jejuni, a Gram-negative microaerophilic bacterium [1]. Due to a high load of Campylobacter in chickens and a low infectious dose required for transmission to humans, campylobacteriosis in humans is mainly attributed to the consumption and handling of contaminated poultry products such as different meat cuts and livers. In some cases, infection may lead to chronic disorders such as Guillain-Barré syndrome, which causes neuromuscular paralysis and even death in 4%–15% of patients [2]. To mitigate the risk of campylobacteriosis for human health, one strategy is to reduce the concentration of C. jejuni in the guts of broilers before slaughter [3].
To successfully colonize the chicken gut, C. jejuni has adapted by harboring virulence factors essential for diverse functions, including chemotaxis, motility, adhesion, and invasion [4]. The bacterium also needs to have access to nutrients for its metabolic requirements. Due to its asaccharolytic characteristic (although certain strains can catabolize fucose [5]), C. jejuni metabolism depends mainly on amino acid utilization [6]. Once these amino acids are taken up by surface transporters, they are deaminated into intermediates to fuel the tricarboxylic acid cycle, a carbon and energy source essential for a successful colonization of Campylobacter [7]. According to in vivo studies, Campylobacter requires the ability to utilize serine, glutamine, asparagine, aspartate, and proline to colonize the chicken and mouse gut [8–11].
In chicken intestine, amino acids are formed in the digestion process of dietary proteins derived from either plant or animal sources [12]. Therefore, amino acid availability in the gut depends on the nutrient digestibility of chicken feed. To modulate this availability, Wealleans et al. [13] and Gibbs et al. [14] added a cocktail of exogenous enzymes, including a protease, to broiler feed to increase nutrient digestion and absorption in order to modulate intestinal colonization and hepatic translocation of C. jejuni. Wealleans et al. showed a significant reduction of Campylobacter by PCR, whereas Gibbs et al. observed only an inhibition of C. jejuni translocation to the liver. Protein sources also have an impact on C. jejuni colonization. Indeed, animal proteins have a higher digestibility and higher content of essential amino acids than plant proteins [15, 16], favoring growth of beneficial bacteria as well as enteric pathogens such as Campylobacter [17].
Given the metabolic requirements of C. jejuni colonization, modulating the digestibility of animal and plant proteins may hold promise in controlling Campylobacter colonization and translocation to the liver in chickens. Therefore, the aim of this study was to evaluate C. jejuni colonization in broiler chickens when fed either animal or vegetarian protein source supplemented or not with an exogenous protease. We also examined the impact of this supplementation on the chicken gut microbiota.
Results
Effects on intestinal colonization and hepatic dissemination of Campylobacter jejuni in broiler chickens
No statistical differences in the C. jejuni colonization level in the caecum and ileum were observed between experimental conditions at 7 dpi (Fig. 1). At 21 dpi, no significant differences in the caecum and ileum were noted between the animal protein source diet (AN) and vegetarian protein source diet (VG). However, at the same time, we found that the cecal colonization of C. jejuni was significantly reduced when chickens were maintained on the protease-supplemented vegetarian protein source diet (VG + P median = 5.70 log10 CFU/g) compared to those maintained on the animal protein source diet (AN median = 7.79 log10 CFU/g, p < 0.0001) or on the protease-supplemented animal protein source diet (AN + P median = 7.12 log10 CFU/g, p < 0.05). In the ileum, the protease supplementation (VG + P) in the vegetarian protein source diet (VG) led to a significant increase of 1.75 log10 CFU/g in the C. jejuni colonization level at 21 dpi (p < 0.01).
Fig. 1.
Campylobacter jejuni counts in caecum (A), ileum (B), and liver (C) of broiler chickens. Horizontal bars represent median values and horizontal dotted lines denote the detection limit. *, **, and **** indicate p < 0.05, p < 0.01, and p < 0.0001, respectively. AN means animal protein source diet, AN + P means animal protein source diet supplemented with an exogenous protease, VG means vegetarian protein source diet, and VG + P means vegetarian protein source diet supplemented with an exogenous protease
Interestingly, at 7 dpi, the protease supplementation (VG + P) in the vegetarian protein source diet (VG) resulted in an inhibition of C. jejuni translocation to the liver (p < 0.01) (Fig. 1). We also performed statistical analysis on C. jejuni load in livers between treatments. Taking into account the detection limit, this supplementation (VG) of the vegetarian protein-based diet (VG + P) significantly decreased the C. jejuni count in broiler liver at 7 dpi (p < 0.01).
Effects on the microbiota diversity in the cecum and ileum of broiler chickens at 21 dpi
In order to examine within-sample richness and community diversity, alpha diversity analyses were performed using the Observed, Shannon, and Inverse Simpson indexes, as shown in Fig. 2. Regarding the cecal microbiota, Kruskal-Wallis tests revealed that all three indices were significantly higher in vegetarian protein source-fed birds (VG) than in animal protein source-fed birds with (AN + P) or without protease supplementation (AN) (Table 1). Furthermore, we observed that a protease supplementation (VG + P) in the vegetarian protein source diet (VG) altered the alpha diversity of the cecal microbiota, resulting in a value close to the animal protein source diet group (AN). No statistical differences of alpha diversity were found for the ileal microbiota between conditions (p > 0.05).
Fig. 2.
Alpha diversity indexes of the cecal microbiota (A) and the ileal microbiota (B) at 21 dpi. Analyses were performed using the Observed, Shannon, and Inverse Simpson (InvSimpson) indexes. AN means animal protein source diet, AN + P means animal protein source diet supplemented with an exogenous protease, VG means vegetarian protein source diet, and VG + P means vegetarian protein source diet supplemented with an exogenous protease
Table 1.
Statistical comparisons (p values) of the alpha diversity indexes of the cecal microbiota between conditions
| AN | AN + P | VG | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Obsa | Shannb | InvSimc | Obsa | Shannb | InvSimc | Obsa | Shannb | InvSimc | |
| AN + P | 0.863 | 0.194 | 0.075 | - | - | - | - | - | - |
| VG | 0.032 | 0.002 | 0.005 | 0.025 | 0.002 | 0.021 | - | - | - |
| VG + P | 0.404 | 0.094 | 0.021 | 0.464 | 0.605 | 0.190 | 0.323 | 0.008 | 0.075 |
a Obs means Observed, b Shann means Shannon, and c InvSim means Inverse Simpson. AN means animal protein source diet, AN + P means animal protein source diet supplemented with an exogenous protease, VG means vegetarian protein source diet, and VG + P means vegetarian protein source diet supplemented with an exogenous protease
For beta diversity which compares the microbiota structure based on the Bray-Curtis dissimilarity distance, we found statistical differences between all conditions in the cecal microbiota (p < 0.001) but not in the ileal microbiota (Fig. 3).
Fig. 3.
Non-metric multidimensional scaling plot (NMDS) illustrating the beta diversity of the cecal microbiota (A) and the ileal microbiota (B) of broiler chickens at 21 dpi. Analyses were performed using Bray-Curtis dissimilarity distances. AN means animal protein source diet, AN + P means animal protein source diet supplemented with an exogenous protease, VG means vegetarian protein source diet, and VG + P means vegetarian protein source diet supplemented with an exogenous protease
Next, we used Multivariate Association with Linear Models (MaAsLin2) to find relevant genera associated with the greatest reduction in the C. jejuni colonization level. Bacterial markers associated with protease supplementation of the vegetarian protein source diet were then identified. These markers are listed in Table 2 (see Additional File 1 for more details).
Table 2.
Cecal genera associated with protease supplementation of the vegetarian protein source diet
| Taxa | Coefficient | pvalue | |
|---|---|---|---|
| Positively associated | UBA1819 | 4.545 | < 0.0001 |
| Erysipelatoclostridiaceae_unclassified | 1.271 | < 0.0001 | |
| Turicibacter | 0.998 | < 0.0001 | |
| Merdibacter | 1.054 | 0.0001 | |
| Anaerostipes | 0.941 | 0.0002 | |
| Faecalibacterium | 0.444 | 0.011 | |
| GCA.900,066,575 | 0.701 | 0.002 | |
| Harryflintia | 0.896 | 0.025 | |
| Acetanaerobacterium | 1.307 | 0.044 | |
| Negatively associated | Butyricoccaceae_UCG.009 | -0.983 | < 0.0001 |
| Anaerovoracaceae_unclassified | -0.833 | < 0.0001 | |
| Proteus | -1.119 | < 0.0001 | |
| Tuzzerella | -0.825 | < 0.0001 | |
| Monoglobus | -0.742 | < 0.0001 | |
| Fournierella | -1.683 | 0.0003 | |
| Lachnospiraceae_ASF356 | -1.592 | 0.0003 | |
| Intestinimonas | -1.386 | 0.001 | |
| Ruminococcaceae_unclassified | -0.615 | 0.005 | |
| Oscillospirales_ge | -0.651 | 0.006 | |
| Oscillospiraceae_unclassified | -0.390 | 0.006 | |
| Oscillospiraceae.uncultured | -0.515 | 0.008 | |
| Oscillospirales_unclassified | -0.372 | 0.010 | |
| Oscillospira | -0.733 | 0.012 | |
| Subdoligranulum | -1.409 | 0.018 | |
| Campylobacter | -0.738 | 0.039 | |
| Oscillospiraceae_UCG.005 | -0.508 | 0.040 |
According to MaAsLin2 analysis, the positively associated genera were significantly more abundant with the protease-supplemented vegetarian protein source diet (VG + P) than the vegetarian protein source diet (VG), and negatively associated genera were significantly less abundant
Effects on the microbial pathways in the caecum of broiler chickens at 21 Dpi
To predict the effect of these microbiota modifications on microbial pathways, PICRUSt2 software was used. Unfortunately, due to sample-to-sample variations for each experimental condition, we were not able to conclude if the protease supplementation of the vegetarian protein source diet in the context of C. jejuni colonization could have modulated microbial pathways of the cecal microbiota (see Additional File 2). A more precise method, such as shotgun sequencing, might have revealed some differences.
Effects on the microbial association networks in the caecum of broiler chickens at 21 Dpi
To investigate the microbial community structures, co-occurrence network analysis was carried out using the SPIEC-EASY method. Analysis was performed on the caecum of birds fed the vegetarian protein source diet (VG) and the supplemented vegetarian protein source diet (VG + P). Firstly, we compared the structure of each network using several topological properties, as shown in Table 3. Globally, the protease supplementation (VG + P) of the vegetarian protein source diet (VG) in the context of C. jejuni colonization had no major effect on the topology of the avian caecal microbiota. We also identified hubs that represent highly associated genera within the network that control microbiota structure and functioning [18]. In this study, we observed that hubs changed depending on feed conditions. Hubs found belonged to either the phylum Firmicutes or the phylum Actinobacteriota, to which Corynebacterium and Leucobacter belong.
Table 3.
Topological properties and hubs of microbial networks
| Parameters | Average edge density | Average connectivity | Average clustering coefficient | Modularity index | Hubs |
|---|---|---|---|---|---|
| VG | 0.029 | 0.014 | 0.074 | 0.702 |
Candidatus_Arthromitus Corynebacterium Leucobacter Staphylococcus Weissella |
| VG + P | 0.026 | 0.013 | 0.073 | 0.721 |
Candidatus_Soleaferrea Clostridia_UCG-014_g DTU089 Fournierella Oscillospirales_g |
VG means vegetarian protein source diet and VG + P means vegetarian protein source diet supplemented with an exogenous protease
Microbial association networks were then visualized using Cytoscape (Fig. 4). We observed that hubs were grouped together within the network and established positive or negative relationships between each other, whereas the Campylobacter genus was located outside the network core. Additionally, we identified genera directly (negatively or positively) associated with Campylobacter within networks. These genera varied depending on the treatments, but all belonged to the Firmicutes phylum and to the Ruminococcaceae (Negativibacillus, Anaerotruncus, and Faecalibacterium) or Lachnospiraceae (Tuzzerella)families. Data on AN and AN + P groups, topological properties, hubs, and microbial association networks are provided in the supplementary data (see Additional File 3).
Fig. 4.
Effects of protease addition to the vegetarian protein source diet on the microbial association networks in the caecum of broiler chickens at 21 dpi A and B: Comparison of microbial network structures between conditions. Nodes representing genera are scaled by relative abundance and colored according to phylum. Hubs are highlighted with bold borders. Campylobacter is represented by a yellow diamond with a bold border. The thickness of connecting lines indicates the strength of association between two individual nodes. The thicker the line, the greater the strength of association between two genera. Green lines indicate positive associations, while red lines indicate negative associations. C and D: Comparison of direct relationships between Campylobacter and genera. From each network shown in A and B, we isolated direct associations between Campylobacter and genera. Numeric values of association strength are displayed above each line. VG means vegetarian protein source diet, and VG + P means vegetarian protein source diet supplemented with an exogenous protease
Discussion
Over the years, campylobacteriosis has become an increasing concern for public health [19–21]. One of the strategies to protect human health is to reduce the concentration of C. jejuni in the broiler gut before slaughter, in particular by targeting its metabolic requirements for successful colonization. Therefore, the present study examined how protease supplementation of different feed protein sources affects C. jejuni colonization and its hepatic translocation and how it affects gut microbiota diversity and structure in broiler chickens.
In ileal content, protease supplementation (VG + P) of the vegetarian protein (VG) source diet resulted in a higher colonization level by Campylobacter at 21 dpi. However, at the same time, protease supplementation (VG + P) of the vegetarian protein source diet (VG) resulted in a lower level of C. jejuni colonization in caecum than animal protein-based diets with (AN + P) or without exogenous protease (AN). In caecum, similar results were reported by Wealleans et al., who showed a significant reduction in C. jejuni colonization levels for birds fed a diet supplemented with a cocktail of exogenous enzymes, including a protease [13]. The addition of protease to the plant-based diet increases protein digestibility in the ileum, as has been previously observed [22, 23], thereby increasing the amount of amino acids in the ileum that are absorbed or potentially available to be used by C. jejuni for its growth. This means that fewer amino acids move to the caecum, thereby reducing Campylobacter colonization. Interestingly, protein hydrolysis by protease was proven to reduce intestinal digesta viscosity [24], which could also be at play in our study. Indeed, Fernandez et al. observed that the reduction in jejunal viscosity was associated with a decrease in C. jejuni numbers in cecal content [25]. According to the authors, reduction of intestinal digesta viscosity decreases feed transit time, thereby reducing the establishment time of C. jejuni in the caecum and consequently leading to its elimination. Furthermore, based on the present results, protease supplementation (VG + P) of the vegetarian protein source diet (VP) inhibited C. jejuni extra-intestinal dissemination. Similar results were also obtained by Gibbs et al. [14] who showed an inhibition of C. jejuni liver translocation in chickens fed a diet supplemented with a cocktail of probiotics and exogenous enzymes, including a protease. This inhibition could be explained by a decrease in digesta viscosity [26], by the Th17 immune response [14], and/or by the expression levels of tight junction proteins [27, 28]. According to studies in mice, it could also be hypothesized that increased digestibility and consequently amino acid absorption through protease supplementation might restrict the availability of serine, glutamate, aspartate, and asparagine required for extra-intestinal dissemination of C. jejuni [6, 10, 11]. In contrast, in our study, protease supplementation (AN + P) of the animal protein source diet (AN) had no effect on C. jejuni colonization levels in the ileum and caecum. As noticed by Cowieson et al. [29] and Bertechini et al. [30], the profile of released amino acids from hydrolyzed proteins due to protease supplementation can vary among protein sources since proteases show affinity for specific amino acid sequences. Thus, differences in circulating or available amino acid profiles in intestines between animal and vegetarian protein source diets could explain this observation.
To investigate the effect of protease supplementation of vegetarian and animal protein source diets on the diversity, composition, and structure of chicken gut microbiota in the context of C. jejuni colonization, analysis of alpha and beta diversities was first carried out. Since most of the time C. jejuni has no effect on the alpha diversity of the cecal microbiota [31–33], we hypothesize that the observed differences in this work were not due to C. jejuni colonization levels but rather to diet composition. In the present study, chickens fed the vegetarian protein source diet (VG) had a more diverse (higher alpha diversity) cecal microbiota compared to ones fed the animal protein-based diet (AN), which is consistent with findings in humans [34]. In addition, the protease addition (VG + P) to the vegetarian protein source diet (VG) reduced alpha diversity indexes. Similar findings were previously reported in broiler chickens [35] and pigs [36]. A decrease in amino acid content in the caecum due to the increased digestibility by the exogenous protease might affect the growth of some bacterial populations, which could reduce the diversity of the cecal microbiota. In contrast, the protease addition (AN + P) to the animal protein source diet (AN) had no effect on alpha diversity of the cecal content, which could be due to the differences in available amino acid profiles between the two feed protein sources. The structure (beta diversity) of the cecal microbiota was significantly different between conditions. As reported by several authors, C. jejuni modifies the beta diversity of the cecal microbiota [31, 32]. Therefore, differences of C. jejuni colonization levels between conditions in caecum could differently affect the microbiota structure. In addition, beta diversity could also be affected by feed protein sources [34, 37] and protease supplementation [35, 36]. In contrast, no significant difference in indexes of alpha and beta diversities in the ileum was observed between experimental conditions.
To identify relevant genera associated with the greatest reduction in the caecal C. jejuni colonization level, we next identified microbial markers associated with the protease supplementation of the vegetarian protein source diet. Protease addition (VG + P) to the plant-based diet (VG) moderately increased the abundance of several genera, including UBA1819, Erysipelatoclostridiaceae_unclassified, Turicibacter, Anaerostipes, and Faecalibacterium genera. Turicibacter is a well-known colonizer of chickens [38], but its involvement in animal health is still elusive. UBA1819 is a beneficial bacterium positively correlated with non-diarrhea status in calves [39]. Faecalibacterium abundance is also increased in the intestine of pigs [40] and laying hens [41] fed a plant-based diet supplemented with a protease. Erysipelatoclostridiaceae, UBA1819, Anaerostipes, and Faecalibacterium produce butyrate [42], a main short-chain fatty acid (SCFA) resulting from the fermentation of indigestible non-starch polysaccharides contained in plant cell walls. Interestingly, butyrate exerts a protective effect on the intestinal epithelial barrier by reducing C. jejuni invasion [43]. Therefore, the increase in the abundance of these genera could explain the decrease in C. jejuni amounts in the cecum of birds fed a supplemented vegetarian protein source diet. In contrast, protease addition (VG + P) to the plant-based diet (VG) moderately decreased the abundance of several genera, such as Tyzzerella. Recently, in human endometrium, it was reported that disrupted Tuzzerella abundance is closely related to a significant decrease of various metabolite levels, such as glutamine [44]. Interestingly, glutamine is known to promote the growth of certain C. jejuni strains [6] and contribute to their colonization in the chicken cecum [9]. Therefore, the decrease in Tyzzerella abundance resulting from the protease supplementation of the vegetarian protein source diet could reduce glutamine levels in chicken cecum, thereby reducing C. jejuni colonization levels. Furthermore, these moderate modifications of the microbiota composition could explain the microbial pathway abundance found.
To visualize relationships between Campylobacter and other genera, we constructed microbial association networks. Campylobacter genus was located outside the network core and did not interact with hubs, meaning that C. jejuni had no effect on network structures. Campylobacter was directly positively associated with genera belonging to anaerobe families Ruminococcaceae and Lachnospiraceae. Since the Campylobacter genome contains hydrogenases [45], the positive associations seen in our study further support the hypothesis made in previous studies [46], including a previously published paper by our group [31] that showed that Campylobacter likely acts as an hydrogen sink in the gut in order to promote anaerobe growth. In the cecal content of the plant-based diet group (VG), Campylobacter was positively linked to Negativibacillus, a bacterium associated with gut dysbiosis in pigs [47] and in cattle [48]. Interestingly, Campylobacter established a positive relationship with Anaerotruncus and Tyzzerella in the cecal content of supplemented plant-based diet group (VG + P), whereas it was negatively linked to Faecalibacterium. As previously mentioned, the presence of Faecalibacterium – a butyrate-producing genus – could negatively affect the intestinal colonization of C. jejuni. This hypothesis could also explain the negative link between Faecalibacterium and Campylobacter genera observed in the microbial network. Additionally, the presence of Tyzzerella could increase the caecum’s levels of glutamine, which is beneficial for C. jejuni growth, as previously mentioned. This hypothesis could also explain the positive relationship between Tyzzerella and Campylobacter genera. No genera interacting with Campylobacter identified in our work was found in other articles [49, 50]. These differences could be attributed to diet composition, rearing environment, C. jejuni strain, age of birds, and/or method of network analysis.
Conclusions
Overall, this study demonstrated that the protease supplementation of a vegetarian protein-based diet reduced the C. jejuni colonization levels in caecum and increased it in ileum compared to traditional feed using animal-based proteins. Interestingly, the supplementation of the vegetarian protein source diet also inhibited the C. jejuni translocation to the liver. In the caecum, the protease addition to the vegetarian protein source diet reduced alpha diversity indexes, altered the beta diversity, and affected the microbiota composition in the context of C. jejuni colonization. In addition, protease supplementation changed genera that were directly associated with Campylobacter in microbial networks.
Therefore, adding an exogenous protease to a vegetarian protein source feed appears to reduce C. jejuni colonization of the intestine, inhibit translocation to the liver, and modify cecal microbiota. Further in vivo experiments are needed to confirm the universality of these results. First, the effect should be tested on different C. jejuni strains as strain-to-strain variations may change the outcome. It is also important in the future to elucidate the exact mechanism involved (amino acid profile changes, earlier absorption of amino acids, intestinal translocation time, etc.). It is also worth noting that proteases that are commercially available as chicken feed supplements do not all possess the same mechanisms of action, so results could vary from one supplier to the next. It would also be interesting to validate the impact of various proteases on different vegetal protein-based diet formulations. Nevertheless, this study’s results open the way to a new paradigm for influencing intestinal colonization of chickens by the foodborne pathogen Campylobacter jejuni.
Methods
Animal experiment and sample collection
This animal experiment was conducted after the approval by the ethics committee (Comité d’Éthique sur l’Utilisation des Animaux) of the Faculté de Médecine Vétérinaire of the Université de Montréal (certificate number: 20-Rech-2069). A total of 72 one-day-old Ross 308 male broiler chickens were randomly divided into four individual pens of the same experimental room of the Centre de Recherche Avicole of the Faculté de Médecine Vétérinaire. From day one, birds were fed with an exclusive vegetarian protein source diet (VG) or a diet containing animal proteins (AN), with or without protease supplementation (0.125 g/kg diet) (AN + P, VG + P) (Jefo Nutrition Inc., QC, Canada). Diet formulations are presented in Tables 4 and 5. No antibiotics or coccidiostats were added to the diets. Throughout the experiment, chickens had access to feed and water ad-libitum. At 14 days of age, all birds were orally inoculated with 103 CFU of an equal mix of two C. jejuni strains, D2008b and G2008b, used previously [51]. Nine chickens per group were euthanized at 7 dpi (days post inoculation) and 21 dpi, as previously described [51]. The same lobe of liver, distal ileum, and caeca were collected from each bird after euthanasia and used fresh for Campylobacter jejuni counts. Furthermore, about 1 g of ileal and cecal contents were frozen and stored at − 80 °C for the purpose of microbiota analysis.
Table 4.
Formulation of animal protein source diet (AN)
| Ingredients (%) | Starter phase (0–21 d)b | Grower phase (21–35 d) |
|---|---|---|
| Corn | 37.51 | 42.40 |
| Soybean meal | 12.70 | 4.25 |
| Wheat | 37.80 | 41.37 |
| Meat Meal | 7.5 | 7.5 |
| Fat | 1.10 | 1.75 |
| NaCl | 0.12 | 0.12 |
| Limestone | 1.36 | 0.96 |
| Phosphate | 0.30 | 0.32 |
| L-threonine | 0.15 | 0.10 |
| L-tryptophane | 0.05 | 0.05 |
| L-lysine-HCl | 0.45 | 0.46 |
| DL-methionine | 0.32 | 0.26 |
| L-valine | 0.31 | 0.13 |
| Choline chloride | 0.08 | 0.08 |
| Phytase | 0.05 | 0.05 |
| Premixa | 0.20 | 0.20 |
| Total | 100 | 100 |
aNutrients per kg of premix: vitamin A, 4,749,929 IU; vitamin D, 2,374,965 IU; vitamin E, 14,500 IU; vitamin K, 1,501 mg; vitamin B12, 8,500 µg; riboflavin, 3,504 mg; niacin, 25,004 mg; folic acid, 902 mg; pyridoxine, 1,753 mg; thiamin, 999 mg; pantothenic acid, 6001 mg; biotin, 74,999 µg; Fe, 21,937 mg; Mn, 50,202 mg; Zn, 51,064 mg; Cu, 7,685 mg; I, 504 mg; Se, 150 mg; S, 2.4%; Ca, 19.2%; P, 0.05%; Na, 0.03%; Ash, 83%; Mg, 0.3%; K, 0.2%
bThe diet phase was changed after the 7-dpi necropsy
Table 5.
Formulation of vegetarian protein source diet (VG)
| Ingredients (%) | Starter phase (0–21 d)b | Grower phase (21–35 d) |
|---|---|---|
| Corn | 34.30 | 38.26 |
| Soybean meal | 24.50 | 15.75 |
| Wheat | 34.20 | 38.00 |
| Fat | 2.10 | 3.75 |
| NaCl | 0.29 | 0.28 |
| Limestone | 2.13 | 1.74 |
| Phosphate | 1.14 | 1.17 |
| L-threonine | 0.10 | 0.05 |
| L-tryptophane | 0.02 | 0.02 |
| L-lysine-HCl | 0.34 | 0.34 |
| DL-methionine | 0.29 | 0.23 |
| L-valine | 0.26 | 0.08 |
| Choline chloride | 0.08 | 0.08 |
| Phytase | 0.05 | 0.05 |
| Premixa | 0.20 | 0.20 |
| Total | 100 | 100 |
aNutrients per kg of premix: vitamin A, 4,749,929 IU; vitamin D, 2,374,965 IU; vitamin E, 14,500 IU; vitamin K, 1,501 mg; vitamin B12, 8,500 µg; riboflavin, 3,504 mg; niacin, 25,004 mg; folic acid, 902 mg; pyridoxine, 1,753 mg; thiamin, 999 mg; pantothenic acid, 6001 mg; biotin, 74,999 µg; Fe, 21,937 mg; Mn, 50,202 mg; Zn, 51,064 mg; Cu, 7,685 mg; I, 504 mg; Se, 150 mg; S, 2.4%; Ca, 19.2%; P, 0.05%; Na, 0.03%; Ash, 83%; Mg, 0.3%; K, 0.2%
bThe diet phase was changed after the 7-dpi necropsy
Campylobacter jejuni counts
One gram of ileal and cecal contents were serially diluted 10-fold in a tryptone salt solution (0.1% tryptone (w/v) and 0.85% NaCl (w/v)). Liver surfaces were sterilized by soaking in 70% ethanol for 5 s and burning to remove external contaminations and excess alcohol. To enumerate C. jejuni in hepatic internal tissue, livers were crushed, resuspended 5-fold in tryptone salt, and stomached for 1 min. One hundred microliters of each sample dilution were plated on Butzler agar plates (Oxoid, Ottawa, ON, Canada) and incubated for 48 h at 42 °C in a microaerobic environment using the CampyGen gas pack system (Oxoid) to enumerate C. jejuni.
DNA extraction
DNA extraction from ileal and cecal contents was performed as previously described [51]. Briefly, 300 mg of ileal content or 200 mg of cecal content were put in separate tubes containing 0.1 mm silica beads (MP Biomedical, Solon, OH, United States). A negative control containing sterile water and no intestinal content was added to confirm the absence of contamination during DNA isolation. A positive control ZymoBIOMICS® Microbial Community Standard (ZymoResearch, Irvine, CA, United States) was also used to assess bias in DNA isolation and to confirm microbiome profiling quality. The theoretical microbial composition of this positive control was: 18.4% Lactobacillus fermentum, 17.4% Bacillus subtilis, 15.5% Staphylococcus aureus, 14.1% Listeria monocytogenes, 10.4% Salmonella enterica, 10.1% Escherichia coli, 9.9% Enterococcus faecalis, and 4.2% Pseudomonas aeruginosa. After adding lysis buffer (500 mM Tris–HCl pH 8, 100 mM EDTA pH 8, 1% SDS and 100 mM NaCl) to the tubes, a FastPrep-24 5G Instrument (MP Biomedical) was used to perform a mechanical lysis, consisting of three runs of 60 s at 6 m/s. Samples were heated for 20 min at 95 °C then placed back on ice. After centrifugation, the supernatant was used for DNA purification by phenol/chloroform (Sigma Aldrich, St. Louis, MO, United States). DNA samples were quantified using a Qubit dsDNA BR assay kit (Fisher Scientific, Ottawa, ON, Canada) and stored at − 80 °C.
16S rRNA sequencing
To prepare the library, the hypervariable V4 region of the 16S rRNA gene was amplified by PCR using the following primers 515FP1-CS1F 5’ACACTGACGACATGGTTCTACAGTGCCAGC MGCCGCGGTAA3’ and 806RP1-CS2R 5’TACGGTAGCAGAGACTTGGTCTGGACTACH VGGGTWTCTAAT3’ [52]. For each sample of ileal and cecal contents, 12.5 ng of DNA was amplified in a final reaction volume of 30 µL containing 1X SuperfiBuffer (Invitrogen, Burlington, ON, Canada), 1X SuperFi™ GC Enhancer (Invitrogen), 0.3 µL of 2 U/µL Platinum SuperFi™ DNA Polymerase (Invitrogen), 20 mg/mL BSA (Fisher scientific), 20 µM of each primer (Invitrogen), and 10 mM dNTP (Bio Basic Inc., Markham, ON, Canada). The PCR program consisted of an initial denaturation step of 5 min at 95 °C followed by 23 cycles of 30 s at 95 °C, 30 s at 55 °C, and 180 s at 72 °C, and then by a final elongation step of 10 min at 72 °C. PCR was performed using a Mastercycler® Nexus (Eppendorf Canada, Mississauga, ON, Canada). The negative control from DNA extraction and another PCR control containing sterile water without DNA were included to confirm the absence of contamination. The positive control from DNA isolation and another control ZymoBIOMICS™ Microbial Community DNA Standard (ZymoResearch) containing genomic DNA from the same microbial composition were also added to assess sequencing error rate and to validate the data sequencing analysis. PCR products were then visualized by electrophoresis in a 1.5% agarose gel, before being sent on dry ice to Génome Québec (Montréal, QC, Canada) for sequencing using 250 bp paired-end reactions performed on the Illumina MiSeq platform.
Data sequencing analysis
Raw data were processed using Mothur software [53] on the Digital Research Alliance of Canada platform. Software settings used for raw data analysis were determined based on the microbial composition of positive controls. After removing primer sequences, paired-end reads were assembled for each control and sample. Sequences of inappropriate length and those containing ambiguous and/or too many consecutive identical bases were removed. The remaining sequences were aligned and classified using the SILVA reference database. After removal of chimeras, sequences were clustered into Operational Taxonomic Units (OTUs) based on a 3.0% dissimilarity. Data analyses were then carried out using RStudio 4.2.2. For the alpha diversity, the number of OTUs (Observed) and the evenness using the Shannon and the inverse Simpson indexes of each sample were measured [31, 54]. Regarding the beta diversity, non-metric multidimensional scaling (NMDS) analyses using Bray-Curtis dissimilarity distances were performed to visually compare the taxonomic composition between all samples. Based on relative abundances, Multivariate Association with Linear Models (MaAsLin2) method was also used to identify bacterial genera significantly associated with the protease supplementation of the vegetarian protein source diet in context of C. jejuni colonization. We next used the NetCoMi package to generate and analyze microbial association networks between genera for each condition [55]. The SPIEC-EASY method (SParse InversE Covariance Estimation for Ecological Association Inference) was used as an association measure [56]. We selected the glasso method with optimal sparsity parameter based on the Stability Approach to Regularization Selection (StARS), with the threshold set to 0.1 and random subsampling set to 0.8. Due to a high number of rare genera, we removed taxa with less than 20 total reads. Hubs, also known as keystone taxa, were identified as nodes with a centrality value higher than the empirical 95% quartile. The resulting networks were then visualized using Cytoscape (v3.10.0) [57]. From amplicon sequence variant (ASV) annotations, we explored the impact on the function of the microbiota by predicting microbial pathway abundance of the cecal microbiota from chickens fed the vegetarian protein source diet with or without the protease, using Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt2) software [58]. The EC database was employed and the MaAsLin2 method was used to analyze the prediction results.
Statistical analysis
Comparisons of C. jejuni colonization levels, its hepatic load, and rates of hepatic translocation between conditions were analyzed using GraphPad Prism 10.4.2 (GraphPad Software, La Jolla, CA, United States). A Kruskal-Wallis test followed by Dunn’s tests were performed to compare intestinal and hepatic loads of C. jejuni between treatments. The limit of detection was set to 105 CFU/g of cecal content for C. jejuni count, 102 CFU/g of ileal content, and 50 CFU/g of liver. Thus, in absence of detection, 9 × 104 CFU/g of cecal content, 9 × 101 CFU/g of ileal content, and 40 CFU/g of liver were used to compare C. jejuni counts. A Fisher’s test was used to compare rates of C. jejuni hepatic translocation between broiler groups. For microbiota analysis, statistical tests were performed using RStudio 4.2.2. Using Wilcoxon test, alpha indexes were compared between groups. An ADONIS PERMANOVA (permutational multivariate analysis of variance) test was used to analyze statistical differences between Bray-Curtis distances of chicken groups [59]. All statistical differences were significant when p < 0.05. Regarding the MaAsLin2 analysis, the default parameters were applied and an association was considered significant when p < 0.05 and q < 0.25 [60].
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
We would like to thank all the members of the Research Chair in Meat Safety for their help during necropsies and all the staff of the Centre de Recherche Avicole of the Faculté de Médecine Vétérinaire for their rigorous work and assistance.
Author contributions
S.C., E.S., L.L., and A.T. conceived and designed the experiments. S.C., M-L.G., and A.T. participated in conducting the in vivo experimentation, including bird inoculations, necropsies, and sample processing. S.C., E.N., and A.T performed all data sequencing analyses. S.C. wrote the manuscript. E.S., L.L., P.F. and A.T. contributed to the scientific edition of the manuscript. A.T. supervised the work. P.F. and A.T. acquired funding. All authors reviewed the manuscript.
Funding
This research was funded by the Natural Sciences and Engineering Research Council of Canada (grant number RDCPJ 520873-17), the Consortium de recherche et innovations en bioprocédés industriels au Québec, the Swine and Poultry Infectious Diseases Research Centre (CRIPA), the Groupe de Recherche sur les maladies infectieuses en production animale (GREMIP), and the Fonds du Centenaire of the Faculté de Médecine Vétérinaire of the Université de Montréal.
Data availability
Raw sequence data were deposited in the NCBI Sequence Read Archive (SRA) database under accession number PRJNA1222851.
Declarations
Ethics approval and consent to participate
This animal experiment was conducted after the approval by the ethics committee (Comité d’Éthique sur l’Utilisation des Animaux) of the Faculté de Médecine Vétérinaire of the Université de Montréal (certificate number: 20-Rech-2069).
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Sophie Chagneau, Email: sophie.chagneau@umontreal.ca.
Alexandre Thibodeau, Email: alexandre.thibodeau@umontreal.ca.
References
- 1.Kaakoush NO, Castano-Rodriguez N, Mitchell HM, Man SM. Global epidemiology of Campylobacter infection. Clin Microbiol Rev. 2015;28(3):687–720. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Poropatich KO, Walker CL, Black RE. Quantifying the association between Campylobacter infection and Guillain-Barré syndrome: a systematic review. J Health Popul Nutr. 2010;28(6):545–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Nauta M, Bolton D, Crotta M, Ellis-Iversen J, Alter T, Hempen M, et al. An updated assessment of the effect of control options to reduce Campylobacter concentrations in broiler Caeca on human health risk in the European union. Microb Risk Anal. 2022;21:100197. [Google Scholar]
- 4.Hermans D, Van Deun K, Martel A, Van Immerseel F, Messens W, Heyndrickx M, et al. Colonization factors of Campylobacter jejuni in the chicken gut. Vet Res. 2011;42(1):82. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Stahl M, Friis LM, Nothaft H, Liu X, Li J, Szymanski CM, et al. L-fucose utilization provides Campylobacter jejuni with a competitive advantage. Proc Natl Acad Sci U S A. 2011;108(17):7194–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Hofreuter D, Novik V, Galan JE. Metabolic diversity in Campylobacter jejuni enhances specific tissue colonization. Cell Host Microbe. 2008;4(5):425–33. [DOI] [PubMed] [Google Scholar]
- 7.Stahl M, Butcher J, Stintzi A. Nutrient acquisition and metabolism by Campylobacter jejuni. Front Cell Infect Microbiol. 2012;2:5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Velayudhan J, Jones MA, Barrow PA, Kelly DJ. L-Serine catabolism via an Oxygen-Labile L-Serine dehydratase is essential for colonization of the avian gut by Campylobacter jejuni. Infect Immun. 2004;72(1):260–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Barnes IH, Bagnall MC, Browning DD, Thompson SA, Manning G, Newell DG. Gamma-glutamyl transpeptidase has a role in the persistent colonization of the avian gut by Campylobacter jejuni. Microb Pathog. 2007;43(5–6):198–207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Novik V, Hofreuter D, Galán JE. Identification of Campylobacter jejuni genes involved in its interaction with epithelial cells. Infect Immun. 2010;78(8):3540–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Hofreuter D, Mohr J, Wensel O, Rademacher S, Schreiber K, Schomburg D, et al. Contribution of amino acid catabolism to the tissue specific persistence of Campylobacter jejuni in a murine colonization model. PLoS ONE. 2012;7(11):e50699. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Dai Z-L, Wu G, Zhu W-Y. Amino acid metabolism in intestinal bacteria: links between gut ecology and host health. FBL. 2011;16(5):1768–86. [DOI] [PubMed] [Google Scholar]
- 13.Wealleans AL, Walsh MC, Romero LF, Ravindran V. Comparative effects of two multi-enzyme combinations and a Bacillus probiotic on growth performance, digestibility of energy and nutrients, disappearance of non-starch polysaccharides, and gut microflora in broiler chickens. Poult Sci. 2017;96(12):4287–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Gibbs K, Lacharme-Lora L, Dersjant-Li Y, Evans C, Wigley P. A probiotic and mixed-enzymes combination reduces the inflammatory response, faecal shedding and systemic spread of Campylobacter jejuni in broilers. J Appl Anim Nutr. 2021.
- 15.Recoules E, Sabboh-Jourdan H, Narcy A, Lessire M, Harichaux G, Labas V, et al. Exploring the in vivo digestion of plant proteins in broiler chickens. Poult Sci. 2017;96(6):1735–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Li P, Wu G. Composition of amino acids and related nitrogenous nutrients in feedstuffs for animal diets. Amino Acids. 2020;52(4):523–42. [DOI] [PubMed] [Google Scholar]
- 17.Udayamputhoor RS, Hariharan H, Van Lunen TA, Lewis PJ, Heaney S, Price L, et al. Effects of diet formulations containing proteins from different sources on intestinal colonization by Campylobacter jejuni in broiler chickens. Can J Vet Res. 2003;67(3):204–12. [PMC free article] [PubMed] [Google Scholar]
- 18.Banerjee S, Schlaeppi K, van der Heijden MGA. Keystone taxa as drivers of Microbiome structure and functioning. Nat Rev Microbiol. 2018;16(9):567–76. [DOI] [PubMed] [Google Scholar]
- 19.European Food Safety Authority (EFSA), European Centre for Disease Prevention and Control (ECDC). The European union one health 2021 zoonoses report. Efsa J. 2022;20(12):e07666. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Public health agency of Canada. FoodNet Canada annual report 2018. 2021 [Available from: https://www.canada.ca/en/public-health/services/surveillance/foodnet-canada/publications/foodnet-canada-annual-report-2018.html
- 21.Tack DM, Marder EP, Griffin PM, Cieslak PR, Dunn J, Hurd S, et al. Preliminary incidence and trends of infections with pathogens transmitted commonly through Food - Foodborne diseases active surveillance Network, 10 U.S. Sites, 2015–2018. MMWR Morb Mortal Wkly Rep. 2019;68(16):369–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Borda-Molina D, Zuber T, Siegert W, Camarinha-Silva A, Feuerstein D, Rodehutscord M. Effects of protease and phytase supplements on small intestinal microbiota and amino acid digestibility in broiler chickens. Poult Sci. 2019;98(7):2906–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Murugesan GR, Romero LF, Persia ME. Effects of protease, phytase and a Bacillus sp. direct-fed microbial on nutrient and energy digestibility, ileal brush border digestive enzyme activity and cecal short-chain fatty acid concentration in broiler chickens. PLoS ONE. 2014;9(7):e101888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Wang C, Yuan T, Yang J, Zheng W, Wu Q, Zhu K et al. Responses of combined Non-starch polysaccharide enzymes and protease on growth Performance, meat Quality, and nutrient digestibility of Yellow-Feathered broilers fed with diets with different crude protein levels. Front Veterinary Sci. 2022;9:946204. [DOI] [PMC free article] [PubMed]
- 25.Fernandez F, Sharma R, Hinton M, Bedford MR. Diet influences the colonisation of Campylobacter jejuni and distribution of mucin carbohydrates in the chick intestinal tract. Cell Mol Life Sci. 2000;57(12):1793–801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Tellez G, Latorre JD, Kuttappan VA, Kogut MH, Wolfenden A, Hernandez-Velasco X, et al. Utilization of Rye as energy source affects bacterial translocation, intestinal viscosity, microbiota composition, and bone mineralization in broiler chickens. Front Genet. 2014;5:339. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Liu T, Ma W, Wang J, Wei Y, Wang Y, Luo Z et al. Dietary protease supplementation improved growth performance and nutrients digestion via modulating intestine barrier, immunological response, and microbiota composition in weaned piglets. Antioxidants (Basel). 2024;13(7):816. [DOI] [PMC free article] [PubMed]
- 28.Huang Q, Yi W, Fan J, Chen R, Ma X, Chen Z, et al. Effects supplementation of novel multi-enzyme on laying performance, egg quality, and intestinal health and digestive function of laying hens. Poult Sci. 2024;103(12):104461. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Cowieson AJ, Lu H, Ajuwon KM, Knap I, Adeola O. Interactive effects of dietary protein source and exogenous protease on growth performance, immune competence and jejunal health of broiler chickens. Anim Prod Sci. 2017;57(2):252–61. [Google Scholar]
- 30.Bertechini AG, de Carvalho JCC, Carvalho AC, Dalolio FS, Sorbara JOB. Amino acid digestibility coefficient values of animal protein meals with dietary protease for broiler chickens. Transl Anim Sci. 2020;4(4):txaa187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Thibodeau A, Fravalo P, Yergeau E, Arsenault J, Lahaye L, Letellier A. Chicken caecal Microbiome modifications induced by Campylobacter jejuni colonization and by a Non-Antibiotic feed additive. PLoS ONE. 2015;10(7):e0131978. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Connerton PL, Richards PJ, Lafontaine GM, O’Kane PM, Ghaffar N, Cummings NJ, et al. The effect of the timing of exposure to Campylobacter jejuni on the gut Microbiome and inflammatory responses of broiler chickens. Microbiome. 2018;6(1):88. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Hankel J, Kittler S, Chuppava B, Galvez E, Strowig T, Becker A et al. Luminal and mucosa-associated caecal microbiota of chickens after experimental Campylobacter jejuni infection in the absence of Campylobacter-specific phages of group II and III. Microb Genom. 2022;8(10):mgen000874. [DOI] [PMC free article] [PubMed]
- 34.Losasso C, Eckert EM, Mastrorilli E, Villiger J, Mancin M, Patuzzi I, et al. Assessing the influence of Vegan, vegetarian and omnivore oriented Westernized dietary styles on human gut microbiota: A cross sectional study. Front Microbiol. 2018;9:317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Yi W, Liu Y, Fu S, Zhuo J, Wang J, Shan T. Dietary novel alkaline protease from Bacillus licheniformis improves broiler meat nutritional value and modulates intestinal microbiota and metabolites. Anim Microbiome. 2024;6(1):1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Peng X, Zhou Q, Wang CQ, Zhang ZM, Luo Z, Xu SY, et al. Dietary supplementation of proteases on growth performance, nutrient digestibility, blood characteristics and gut microbiota of growing pigs fed sorghum-based diets. Animal. 2024;18(1):101052. [DOI] [PubMed] [Google Scholar]
- 37.Wu GD, Compher C, Chen EZ, Smith SA, Shah RD, Bittinger K, et al. Comparative metabolomics in vegans and omnivores reveal constraints on diet-dependent gut microbiota metabolite production. Gut. 2016;65(1):63–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Abudabos AM, Al-Atiyat RM, Albatshan HA, Aljassim R, Aljumaah MR, Alkhulaifi MM, et al. Effects of concentration of corn distillers dried grains with solubles and enzyme supplementation on cecal microbiota and performance in broiler chickens. Appl Microbiol Biotechnol. 2017;101(18):7017–26. [DOI] [PubMed] [Google Scholar]
- 39.Chen H, Liu Y, Huang K, Yang B, Zhang Y, Yu Z, et al. Fecal microbiota dynamics and its relationship to diarrhea and health in dairy calves. J Anim Sci Biotechnol. 2022;13(1):132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Moturi J, Hosseindoust A, Kinara E, Mun J, Ha S, Park S, et al. Exogenous protease influences protein digestibility, growth performance, and gut microflora in weanling pigs on a limited protein diet. Arch Anim Nutr. 2023;77(5):342–62. [DOI] [PubMed] [Google Scholar]
- 41.Cai P, Liu S, Tu Y, Fu D, Zhang W, Zhang X et al. Effects of different supplemental levels of protease DE200 on the production performance, egg quality, and cecum microflora of laying hens. J Anim Sci. 2024;102;102:ske086. [DOI] [PMC free article] [PubMed]
- 42.Singh V, Lee G, Son H, Koh H, Kim ES, Unno T, et al. Butyrate producers, the Sentinel of gut: their intestinal significance with and beyond butyrate, and prospective use as microbial therapeutics. Front Microbiol. 2022;13:1103836. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Van Deun K, Pasmans F, Van Immerseel F, Ducatelle R, Haesebrouck F. Butyrate protects Caco-2 cells from Campylobacter jejuni invasion and translocation. Br J Nutr. 2008;100(3):480–4. [DOI] [PubMed] [Google Scholar]
- 44.Chen Y, Ye L, Zhu J, Chen L, Chen H, Sun Y, et al. Disrupted tuzzerella abundance and impaired l-glutamine levels induce Treg accumulation in ovarian endometriosis: a comprehensive multi-omics analysis. Metabolomics. 2024;20(2):32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Parkhill J, Wren BW, Mungall K, Ketley JM, Churcher C, Basham D, et al. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature. 2000;403(6770):665–8. [DOI] [PubMed] [Google Scholar]
- 46.Kaakoush NO, Sodhi N, Chenu JW, Cox JM, Riordan SM, Mitchell HM. The interplay between Campylobacter and Helicobacter species and other Gastrointestinal microbiota of commercial broiler chickens. Gut Pathog. 2014;6:18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Tang S, Zhong R, Yin C, Su D, Xie J, Chen L, et al. Exposure to high aerial ammonia causes hindgut dysbiotic microbiota and alterations of microbiota-Derived metabolites in growing pigs. Front Nutr. 2021;8:689818. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Larzábal M, Da Silva WM, Multani A, Vagnoni LE, Moore DP, Marin MS, et al. Early immune innate hallmarks and Microbiome changes across the gut during Escherichia coli O157: H7 infection in cattle. Sci Rep. 2020;10(1):21535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Yan W, Zhou Q, Yuan Z, Fu L, Wen C, Yang N, et al. Impact of the gut microecology on Campylobacter presence revealed by comparisons of the gut microbiota from chickens Raised on litter or in individual cages. BMC Microbiol. 2021;21(1):290. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Patuzzi I, Orsini M, Cibin V, Petrin S, Mastrorilli E, Tiengo A et al. The interplay between Campylobacter and the caecal microbial community of commercial broiler chickens over time. Microorganisms. 2021;9(2):221. [DOI] [PMC free article] [PubMed]
- 51.Chagneau S, Gaucher M-L, Thériault WP, Fravalo P, Thibodeau A. Observations supporting hypothetical commensalism and competition between two Campylobacter jejuni strains colonizing the broiler chicken gut. Front Microbiol. 2023;13:1071175. [DOI] [PMC free article] [PubMed]
- 52.Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Huntley J, Fierer N, et al. Ultra-high-throughput microbial community analysis on the illumina HiSeq and miseq platforms. Isme J. 2012;6(8):1621–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol. 2009;75(23):7537–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.McMurdie PJ, Holmes S. Phyloseq: an R package for reproducible interactive analysis and graphics of Microbiome census data. PLoS ONE. 2013;8(4):e61217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Peschel S, Müller CL, von Mutius E, Boulesteix AL, Depner M. NetCoMi: network construction and comparison for Microbiome data in R. Brief Bioinform. 2021;22(4):bbaa290. [DOI] [PMC free article] [PubMed]
- 56.Kurtz ZD, Müller CL, Miraldi ER, Littman DR, Blaser MJ, Bonneau RA. Sparse and compositionally robust inference of microbial ecological networks. PLoS Comput Biol. 2015;11(5):e1004226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13(11):2498–504. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Douglas GM, Maffei VJ, Zaneveld JR, Yurgel SN, Brown JR, Taylor CM, et al. PICRUSt2 for prediction of metagenome functions. Nat Biotechnol. 2020;38(6):685–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Oksanen J, Blanchet FG, Kindt R, Legendre P, Minchin P, O’Hara RB et al. Vegan: Community Ecology Package. R Package Version. 2.0–10 2013 [Available from: https://cran.r-project.org/web/packages/vegan/index.html
- 60.Mallick H, Rahnavard A, McIver LJ, Ma S, Zhang Y, Nguyen LH, et al. Multivariable association discovery in population-scale meta-omics studies. PLoS Comput Biol. 2021;17(11):e1009442. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Raw sequence data were deposited in the NCBI Sequence Read Archive (SRA) database under accession number PRJNA1222851.




