Abstract
Background
Inflammatory bone diseases are characterized by persistent immune activation and progressive bone destruction, posing significant barriers to spontaneous repair. Current treatments for inflammatory bone diseases seldom achieve both inflammation control and bone regeneration, underscoring the need for dual-action strategies. Epigenetic regulation via histone deacetylases (HDACs) has emerged as a pivotal mechanism linking immune responses to osteogenesis. In this study, we evaluated the therapeutic potential of the HDAC inhibitors Trichostatin A (TSA), PXD-101 (PXD), and MGCD-0103 (MGCD) to suppress inflammation, promote bone regeneration, and elucidate the underlying molecular mechanisms.
Methods
The osteoimmunomodulatory effects of three HDAC inhibitors, Trichostatin A(TSA), PXD-101 (PXD), and MGCD-0103 (MGCD), were investigated under lipopolysaccharide (LPS)-induced inflammatory conditions. RAW264.7 and MC3T3-E1 cells were co-cultured under LPS stimulation and osteogenic differentiation was induced. Macrophage polarization, cytokine secretion, osteogenic differentiation, and MAPK signaling were analyzed by qPCR, ELISA, western blotting, alkaline phosphatase and Alizarin Red S staining. In vivo, an LPS-induced calvarial osteolysis model was established in male C57BL/6 mice, and TSA, PXD, or MGCD was locally administered after significant bone erosion. Bone resorption, new bone formation, and macrophage polarization were evaluated by micro-computed tomography and immunohistochemistry.
Results
TSA, PXD, and MGCD promoted M2 macrophage polarization, suppressed pro-inflammatory cytokine production, and restored osteogenic differentiation under inflammatory conditions. These effects were mediated by selective modulation of the MAPK pathway, whereby inhibition of LPS-induced NF-κB/p38/JNK phosphorylation and enhancement of ERK activation generated a pro-regenerative osteoimmune microenvironment. In vivo, HDAC inhibitor treatment significantly shifted macrophage polarization toward M2 dominance, reduced bone resorption, and promoted new bone formation.
Conclusions
TSA, PXD, and MGCD function as dual-action therapeutics by regulating macrophage polarization and enhancing osteogenesis, thereby establishing a pro-regenerative microenvironment and reversing inflammatory bone loss. These findings provide mechanistic insight into the epigenetic control of immune-bone crosstalk and support a drug-repurposing strategy that utilizes clinically available HDAC inhibitors to accelerate the development of osteoimmunomodulatory therapies.
Keywords: Histone deacetylase, Trichostatin A, PXD-101, MGCD-0103, Drug repurposing, Osteoimmunology, Macrophage polarization, Bone regeneration, Epigenetic therapy, MAPK signaling
Background
Inflammatory bone diseases, such as periodontitis, osteomyelitis, and rheumatoid arthritis, are major clinical challenges characterized by chronic immune activation and progressive bone loss [1–3]. These disorders not only compromise structural integrity but also impair regenerative capacity, often resulting in irreversible bone loss [4, 5]. Current anti-inflammatory or anti-resorptive therapies rarely achieve simultaneous inflammation control and bone regeneration, emphasizing the need for novel therapeutic strategies.
Osteoimmunology has revealed that bone homeostasis is tightly regulated by the crosstalk between immune and skeletal cells [6]. In particular, macrophages play a central role in this process due to their high plasticity and ability to coordinate both immune responses and tissue repair [7]. Pro-inflammatory M1 macrophages contribute to disease progression by releasing cytokines such as TNF-α, IL-1β, and IL-6, thereby promoting osteoclastogenesis and suppressing osteoblast activity [8, 9]. In contrast, M2 macrophages secrete anti-inflammatory and pro-regenerative mediators including IL-10, IL-4, and TGF-β that facilitate inflammation resolution and support bone repair [8, 9]. A sustained M1-dominant state disrupts osteoimmune balance and impairs bone repair [10].
Epigenetic regulation, particularly through histone deacetylases (HDAC), has recently emerged as a critical mechanism controlling both immune responses and osteogenic differentiation [11–14]. HDACs are classified into four groups: class Ⅰ (HDAC1, 2, 3, and 8), class Ⅱ (HDAC4, 5, 6, 7, 9, and 10), class Ⅲ (sirtuins), and class Ⅳ (HDAC11) [15]. Aberrant HDAC activity promotes pro-inflammatory gene expression and suppresses osteogenesis [16–18]. Thus, targeting HDACs represents a promising therapeutic strategy to modulate cellular fate and restore osteoimmune homeostasis.
HDAC inhibitors such as Trichostatin A (TSA), PXD-101 (PXD), and MGCD-0103 (MGCD) were originally developed as anticancer agents and have well-established clinical safety profiles from oncology trials [19–21]. TSA is a pan-HDAC inhibitor with activity against class Ⅰ and Ⅱ HDACs [22], PXD inhibits HDAC1, 2, 3, 6, and 9 [23], and MGCD exhibits high selectivity for class Ⅰ HDACs, particularly HDAC1–3 [24]. TSA has been shown to induce M2 macrophage polarization via autophagy [25] and enhance osteogenesis through runt-related transcription factor 2 (Runx2) upregulation [26]. However, the osteoimmunomodulatory funtions of TSA, PXD, and MGCD have not been previously reported, representing a drug-repurposing opportunity for inflammatory bone diseases.
In this study, we investigate the osteoimmunomodulatory properties of TSA, PXD, and MGCD using in vitro and in vivo models of LPS-induced inflammatory bone loss. We investigated their ability to regulate macrophage polarization, modulate MAPK signaling, and restore osteogenesis. Since osteogenic differentiation is central to stem cell-based bone regeneration, the use of MC3T3-E1 pre-osteoblasts as a surrogate model representing mesenchymal stem cell (MSC)-derived osteogenesis situates our findings in the context of stem cell and regenerative biology. These findings provide new insights supporting an epigenetic drug-repurposing strategy to prevent inflammatory bone loss and promote bone regeneration.
Methods
Cell culture
MC3T3-E1 cells were maintained in Minimum Essential Medium Alpha Modification (α-MEM; Welgene, Daegu, Korea) supplemented with 10% fetal bovine serum (FBS; Welgene) and 1% antibiotic-antimycotic solution (AA; Welgene). RAW 264.7 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Welgene) supplemented with 10% FBS (Welgene) and 1% AA (Welgene). All cells were incubated at 37℃ in a humidified atmosphere containing 5% CO2.
Cell viability assay
Cell viability was assessed using the WST Plus-8 (GenDEPOT, Baker, TX, USA) according to the manufacturer’s instructions. MC3T3-E1 cells were seeded in 96-well plates at a density of 1 × 103 cells per cm2, and different concentrations of drugs were applied for 3 days. Cell viability was measured daily. After 1, 2, and 3 days of incubation, 10 µL of WST-8 solution was added to each well, followed by incubation for 1 h at 37℃. Absorbance was measured at 450 nm using an EMax Plus Microplate Reader (Molecular Devices, San Jose, CA, USA).
Transwell indirect co-culture system for osteogenic differentiation in an inflammatory microenvironment
RAW 264.7 cells were seeded at 2 × 104 cells per well onto a transwell insert with a 0.4 μm pore size. MC3T3-E1 cells were seeded at a density of 1 × 105 cells per well onto the bottom of a 12-well plate. An inflammatory response was induced by treatment with 10 µg/mL of lipopolysaccharide (LPS; InvivoGen; San Diego, CA, USA). Osteogenic differentiation was promoted using osteogenic differentiation medium containing α-MEM (Welgene) supplemented with 10% FBS (Welgene), 10 mM β-glycerophosphate (Sigma-Aldrich, St. Louis, MO, USA), and 50 µM ascorbic acid 2-phosphate (Sigma-Aldrich) in the presence of Trichostatin A (TSA), PXD-101 (PXD), or MGCD-0103 (MGCD), respectively. The culture medium was replaced every 2–3 days.
Alkaline phosphatase (ALP) staining
After 7 days of osteogenic differentiation, ALP staining was conducted using the StemAb Alkaline Phosphatase Staining Kit Ⅱ (Reprocell, Yokohama, Japan). Cells were fixed with 4% paraformaldehyde for 2 min, washed with distilled water, and incubated with ALP staining solution for 30 min at room temperature. Stained cells were visualized using an inverted microscope (Carl Zeiss, Jena, Germany).
Alizarin red S (ARS) staining
After 21 days of osteogenic differentiation, ARS staining was performed to evaluate calcium deposition. Cells were fixed with 4% paraformaldehyde for 20 min, washed with PBS, and stained with alizarin red solution (Sigma-Aldrich) for 30 min. Calcium nodules were visualized as red under an inverted microscope (Carl Zeiss). After ARS staining, stained cells were incubated with 10% (w/v) cetylpyridinium chloride for 30 min, and the absorbance of the supernatant was measured at 570 nm using an EMax Plus Microplate Reader (Molecular Devices).
Real-time PCR
Total RNA was extracted using the TaKaRa MiniBEST Universal RNA Extraction Kit (Takara Bio, Kusatsu, Japan). Complementary DNA (cDNA) was synthesized using the PrimeScript™ Ⅱ 1st Strand cDNA Synthesis Kit (Takara Bio) for real-time PCR analysis. Real-time PCR was performed using TB Green® Premix Ex Taq™ Ⅱ (Takara Bio) with a StepOnePlus™ Real-Time PCR system (Applied Biosystems, Waltham, MA, USA). The primers used in this study are listed in Table 1. The PCR reaction conditions were as follows: initial denaturation at 95℃ for 30 s, followed by 40 cycles of amplification (95℃ for 5 s and 60℃ for 30 s). Gene expression.
Table 1.
Primer sequence.
| Gene | Forward primer (5’-3’) | Reverse primer (5’-3’) |
|---|---|---|
| Runx2 | CAGACCAGCAGCACTCCATA | TTCAATATGGTCGCCAAACA |
| Col1a1 | GCGAGAGCATGACCGATGGA | GCGGATCTCGATCTCGTTGGA |
| Bsp | CAGGGAGGCAGTGACTCTTC | AGTGTGGAAAGTGTGGCGTT |
| Ocn | CTGACCTCACAGATCCCAAGC | TGGTCTGATAGCTCGTCACAAG |
| Alp | CCAACTCTTTTGTGCCAGAGA | GGCTACATTGGTGTTGAGCTTTT |
| Opn | AGCAAGAAACTCTTCCAAGCAA | GTGAGATTCGTCAGATTCATCCG |
| Gapdh | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
Levels were quantified using the comparative Ct method. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene for normalization.
Western blot analysis
Total proteins were collected after 7 and 14 days of osteogenic differentiation. Cells were lysed using a cell lysis buffer (Thermo Fisher Scientific, Waltham, MA, USA) containing a protease inhibitor (GenDEPOT, Barker, TX, USA) and a phosphatase inhibitor (GenDEPOT). Protein concentration was determined using BCA Protein Assay Kit (Thermo Fisher Scientific), and 20 µg of protein were loaded per lane for western blot analysis. The proteins were separated using 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes. Then the membranes were incubated overnight at 4℃ with primary antibodies against RUNX2 (Cell Signaling Technology, Danvers, MA, USA), ALP (Bioss Antibodies, Woburn, MA, USA), bone sialoprotein (BSP) (Cell Signaling Technology), extracellular signal-regulated kinase (ERK) (Cell Signaling Technology), phospho-ERK (Cell Signaling Technology), c-Jun N-terminal kinase (JNK) (Cell Signaling Technology), phospho-JNK (Cell Signaling Technology), p38 (Cell Signaling Technology), phospho-p38 (Cell Signaling Technology), and GAPDH (FineTest, Palm Coast, FL, USA). GAPDH was used as an internal control for normalization. The intensity of the protein bands was quantified using ImageJ software (U.S. National Institutes of Health, Bethesda, MD, USA). Full length blots are presented in Supplementary Figure.
Enzyme linked immunosorbent assay (ELISA)
MC3T3-E1 and RAW 264.7 cells were indirectly co-cultured, and the culture media were collected after LPS treatment. The concentrations of IL-1β, TNF-α, IL-6, IL-4, and IL-10 in the cell supernatant were measured using ELISA kits (Cell Signaling Technology) according to the manufacturer’s instructions. Absorbance was measured at 450 nm using a microplate reader.
In vivo calvarial osteolysis model
An LPS-induced calvarial osteolysis model was used to investigate the in vivo effects of HDAC inhibitors on bone formation under inflammatory conditions. The animal experiments were conducted with the approval of the Institutional Animal Care and Use Committee of Seoul National University (IACUC, approval number SNU-230918-4). All animals were housed in sterile cages with clean bedding, and provided with sterilized food and water. Before experiments commenced, they were acclimatized for one week in a controlled SPF barrier facility maintained under a 12-hour light/dark cycle. Group allocation was performed using randomization procedures, with experimental units assigned within each cage by the researcher responsible for randomization. During allocation, one researcher was aware of group assignments to perform the randomization; however, all personnel responsible for administering treatments, assessing outcomes, and analyzing data were blinded to group allocation. All treatments were administered in a random order to prevent experimenter bias. No animals were excluded from the study. All animals enrolled at the start of the experiment were included in the final data analysis without omission. The sample size was calculated a priori using the GRANMO online calculator, based on standard deviation and effect size estimated from previous experimental data in similar studies. The work has been reported in line with the ARRIVE guidelines 2.0.
Thirty male C57BL/6 mice (7 weeks old) were purchased from Orient Bio (Seongnam, Gyeonggi-do, Korea) and were randomly assigned to five groups (n = 6 per group): [1] control [2], LPS + 0.01% DMSO vehicle [3], LPS + TSA [4], LPS + PXD, and [5] LPS + MGCD. LPS (25 mg/kg) was subcutaneously injected over the calvaria on day 0 to induce osteolysis. TSA, PXD, or MGCD were administered subcutaneously into the calvaria on day 7.
Mice were anesthetized by inhalation of 2% isoflurane (Hana Pharm Co., Ltd., Seoul, Korea), which was maintained throughout the procedure. Animals were monitored every three days for abnormal weight change, inability to consume food, or unusual behavioral signs, with experiments discontinued if any of these conditions were observed. No unexpected adverse events or mortality occurred during the study. Seven days after the administration of HDAC inhibitors, the mice were euthanized using CO2 asphyxiation, and calvarial bones were collected for micro-CT and histological analysis.
Micro-CT
All samples were scanned using a micro-CT scanner (SkyScan 1173; Bruker, Kontich, Belgium). A total of 800 micro-CT images were obtained under a tube voltage of 90 kV and a tube current of 88 µA. All 3D images were reconstructed using NRecon software (Bruker). Bone destruction areas were quantified using ImageJ.
Hematoxylin and Eosin staining
Calvarial bones were fixed and decalcified with 10% EDTA, dehydrated through a graded ethanol series, and embedded in paraffin. The tissues were sectioned into 3-µm slices using a Leica RM2255 microtome (Leica Microsystems, Wetzlar, Germany). After sectioning, hematoxylin and eosin staining was performed and the slides were examined under an Olympus BX51 microscope (Olympus, Tokyo, Japan). Images were captured using a PANNORAMIC 250 Flash Ⅲ digital slide scanner (3DHISTECH Ltd. Budapest, Hungary).
Immunohistochemistry
Three-micrometer-thick sections were deparaffinized and rehydrated, then treated with 3% hydrogen peroxide for 10 min. Antigen retrieval was performed at 97℃ for 10 min using citrate buffer. The sections were then blocked with 1% bovine serum albumin (BSA) and incubated with primary antibodies—anti-Cathepsin K (ab188604, Abcam, Cambridge, UK), anti-ARG1 (NBP1-32731, Novus Biologicals, CO, USA), anti-iNOS (NB300-605, Novus Biologicals), and anti-RUNX2 (PA5-87299, Invitrogen, Waltham, MA, USA) at 37℃ for 1 h. Subsequently, the slides were incubated at room temperature for 1 h with horseradish peroxidase-conjugated secondary antibodies. Staining was visualized using an Olympus BX51 microscope (Olympus), and images were captured using a PANNORAMIC 250 Flash Ⅲ digital slide scanner (3DHISTECH Ltd.).
Statistical analysis
Data distribution normality was assessed using the Shapiro-Wilk test. Statistical analyses were performed using one-way analysis of variance (ANOVA) to compare differences among groups, followed by Tukey’s post hoc test for pairwise comparisons. Data are expressed as mean ± standard deviation (SD). Analyses were conducted using GraphPad Prism version 5.0 (GraphPad Software, San Diego, CA, USA), with p-values < 0.05 considered statistically significant.
Results
Effect of TSA, PXD, or MGCD on MC3T3-E1 viability
To determine the appropriate concentrations of HDAC inhibitors for downstream experiments, WST-8 assays were performed with MC3T3-E1 cells treated with increasing concentrations of TSA (0–50 nM), PXD (0–1000 nM), or MGCD (0–1000 nM). Cell viability remained unaffected on day 1 across all groups. TSA significantly reduced cell viability at 50 nM, whereas PXD and MGCD decreased viability at ≥ 500 nM on day 2 and 3. Based on these results, concentrations below 50 nM for TSA (10 and 20 nM; Fig. 1A), below 500 nM for PXD (100 and 200 nM; Fig. 1B), and MGCD (100 and 200 nM; Fig. 1C) were selected for subsequent experiments.
Fig. 1.
Effects of TSA, PXD, or MGCD on the viability of MC3T3-E1 cells. MC3T3-E1 cells were treated with increasing concentrations of HDAC inhibitors for 1–3 days, and cell viability was measured. A TSA treatment (0–50 nM) showed no cytotoxicity on day 1, whereas significant reduction in viability was observed at 50 nM on days 2 and 3. B PXD treatment (0–1000 nM) and C MGCD treatment (0–1000 nM) had no effect on day 1, but higher doses (≥ 500 nM) significantly reduced cell viability on days 2 and 3. Data are presented as mean ± SD (n = 3). ***P < 0.001 vs. 0 nM for each HDAC inhibitor
TSA, PXD, or MGCD restore osteogenic differentiation under inflammatory conditions
Under LPS-induced inflammatory conditions, osteogenic differentiation of MC3T3-E1 cells was impaired. Treatment with TSA (10 nM and 20 nM), PXD (100 nM and 200 nM), or MGCD (100 nM and 200 nM) dose-dependently increased the mRNA levels of Runx2, Col1a1, Bsp, Ocn, Alp, and Opn at both day 3 and day 5 (Fig. 2A–C). Western blot analysis demonstrated a dose-dependent upregulation of ALP, RUNX2, and BSP protein levels in response to HDAC inhibitor treatment (Fig. 2D–F). Furthermore, ALP and ARS staining confirmed that TSA, PXD, or MGCD restored osteogenic activity under inflammatory conditions, indicating effective rescue of osteogenic differentiation (Fig. 2G–I).
Fig. 2.
TSA, PXD, or MGCD rescue LPS-suppressed osteogenesis in a dose-dependent manner. MC3T3-E1 cells were co-cultured with RAW 264.7 macrophages under LPS stimulation and treated with TSA, PXD, or MGCD. qPCR analysis revealed that treatment with TSA (A), PXD (B), or MGCD (C) restored the expression of osteogenic marker genes, including Runx2, Col1a1, Bsp, Ocn, Alp, and Opn, at days 1, 3, and 5, expressed as fold change over the non-treated group. Western blog analysis further demonstrated changes in RUNX2, ALP, and BSP protein expression under the same treatment conditions at days 1, 5, and 10 (D–F), with GAPDH used as a loading control. G ALP staining and (H) ARS staining were performed to assess osteogenic activity and calcium deposition, respectively, following treatment with the TSA, PXD, or MGCD. I Quantification of ARS staining intensity from (H). All data are presented as the mean ± SD (n = 3). GAPDH was used for normalization. In A–C *p < 0.05 vs. negative control; #p < 0.05 vs. day 3 control; &p < 0.05 vs. day 5 control. In (E), *p < 0.05 vs. negative control; ap < 0.05 vs. day 10 control. In (H), bp < 0.05 vs. LPS-treated group. Scale bar = 200 μm
TSA, PXD, or MGCD modulate macrophage polarization toward an anti-inflammatory phenotype
To evaluate the immunomodulatory effects of HDAC inhibitors under inflammatory conditions, macrophage polarization markers were analyzed. TSA (20 nM), PXD (200 nM), and MGCD (200 nM) were used. LPS stimulation induced significant upregulation of M1-associated genes iNOS and Ccr7, indicative of a pro-inflammatory shift (Fig. 3A). Notably, treatment with any of the three HDAC inhibitors significantly suppressed these M1 markers, suggesting effective inhibition of LPS-driven macrophage activation (Fig. 3A).
Fig. 3.
HDAC inhibitors modulate macrophage polarization and suppress pro-inflammatory responses under LPS stimulation. RAW 264.7 macrophages were stimulated with LPS (100 ng/mL) and treated with TSA, PXD, or MGCD. A Gene expression of M1-associated markers (iNOS and Ccr7) and (B) M2-associated markers (Arg1 and Cd206), determined by qPCR. C Levels of pro-inflammatory cytokines (IL-1β, TNF-α, and IL-6) and (D) anti-inflammatory cytokines (IL-4 and IL-10) in culture supernatants, measured by ELISA. Data are presented as the mean ± SD (n = 3). *P < 0.05, **P < 0.01, and ***P < 0.001
In parallel, the expression of M2-associated genes Arg1 and Cd206, which was reduced by LPS, was significantly restored by TSA, PXD, or MGCD (Fig. 3B), indicating a phenotypic shift toward a tissue-reparative macrophage profile. Treatment with these inhibitors also significantly attenuated LPS-induced secretion of pro-inflammatory cytokines IL-1β, TNF-α, and IL-6 (Fig. 3C), while simultaneously enhancing levels of the anti-inflammatory cytokines IL-4 and IL-10 (Fig. 3D).
Collectively, these results demonstrate that TSA, PXD, or MGCD regulate macrophage polarization toward an M2-skewed, anti-inflammatory phenotype, which likely contributes to their osteoimmunomodulatory potential in inflammatory bone environments.
HDAC inhibitors suppress NF-κB/p38/JNK signaling while selectively activating ERK under inflammatory conditions
To elucidate the intracellular mechanisms underlying dual osteoimmunomodulatory effects, we examined the impact of TSA, PXD, or MGCD on canonical inflammatory and osteogenic pathways under LPS-induced inflammatory conditions. Western blot analysis revealed that LPS stimulation markedly increased phosphorylation of NF-κB, p38, and JNK, which are key mediators of pro-inflammatory signaling (Fig. 4A–F). Treatment with TSA, PXD, or MGCD significantly attenuated phosphorylation of these pathways.
Fig. 4.
TSA, PXD, or MGCD modulates MAPK and NF-κB signaling pathways during osteogenesis under inflammatory conditions. Western blot analysis revealed that TSA (A), PXD (C), and MGCD (E) reduced the phosphorylation of JNK, p38, and NF-κB, while enhancing ERK activation. Quantification of band intensities is shown in (B), (D), and (F), respectively, with protein levels normalized to total protein and loading controls. Data are presented as mean ± SD (n = 3), and statistical significance is indicated as *P < 0.05, **P < 0.01, and ***P < 0.001
In contrast, LPS treatment did not alter ERK phosphorylation levels. Notably, TSA, PXD, and MGCD each significantly enhanced ERK phosphorylation in a dose-dependent manner. Given that ERK signaling is closely linked to osteogenic commitment, its selective activation by HDAC inhibitors provides a potential mechanism for sustaining osteogenesis despite inflammatory stress.
Overall, HDAC inhibitors modulate intracellular signaling under inflammatory conditions by suppressing NF-κB/p38/JNK and selectively activating ERK, thereby creating a cellular environment favorable for both immune resolution and bone regeneration.
TSA, PXD, or MGCD ameliorate LPS-induced bone destruction in a calvarial osteolysis model
To evaluate the in vivo efficacy of HDAC inhibitors in suppressing inflammation-induced bone loss, an LPS-induced calvarial osteolysis model was used (Fig. 5A). No significant changes in body weight or adverse effects were observed in any treatment group during the 14-day study period (Fig. 5B). LPS stimulation induced evident bone erosion and resorption pits by day 7 as revealed by micro-CT (Fig. 5C).
Fig. 5.
TSA, PXD, or MGCD attenuates LPS-induced bone destruction in a mouse calvarial osteolysis model. A Schematic representation of the experimental protocol. B Body weight monitoring over 14 days showing no significant weight loss in any group. C Representative in vivo CT images on day 7 after LPS injection demonstrating evident bone erosion and resorption pits. D Micro-CT analysis of bone destruction after local administration of TSA, PXD, or MGCD. E Quantification of bone destruction area from (D). F The Bone volume versus tissue volume (BV/TV) within regions of interest were analyzed. Yellow arrows; bone destruction regions. Data are presented as mean ± SD (n = 6 per group). **P < 0.01, and ***P < 0.001
Treatment with TSA, PXD, or MGCD markedly reduced LPS-induced bone destruction, as evidenced by decreased resorption area (Fig. 5D, yellow arrows). Compared with the LPS group, all HDAC inhibitor-treated groups showed lower bone destruction area and higher BV/TV, indicating improved bone regeneration after the TSA, PXD, or MGCD treatment (Fig. 5E and F).
These results demonstrate that local administration of HDAC inhibitors exert protective effects against inflammatory bone loss in vivo, supporting their potential as therapeutic agents for osteolytic bone diseases.
TSA, PXD, or MGCD restore osteoimmune balance and reduce osteolytic activity
Histological evaluation via H&E staining revealed pronounced bone loss in the LPS-treated group, which was markedly reduced by TSA, PXD, or MGCD treatment (Fig. 6A, yellow arrows). Cathepsin K (CTSK), a protease highly expressed in osteoclasts and a representative marker of bone resorption, was strongly upregulated in LPS-treated mice, particularly along bone marrow surfaces and resorption sites (Fig. 6B, black arrows). However, administration of TSA, PXD, or MGCD significantly reduced CTSK staining intensity, indicating suppression of osteoclast-mediated bone degradation (Fig. 6C).
Fig. 6.
TSA, PXD, or MGCD restore osteoimmune balance and reduce osteolytic activity. A Histological examination by H&E staining revealed differences in calvarial bone morphology between groups. Immunohistochemical staining demonstrated that treatment with TSA, PXD, or MGCD reduced osteoclast activity, as shown by decreased CTSK expression (B), suppressed M1 macrophage polarization indicated by reduced iNOS expression (D), enhanced M2 macrophage polarization indicated by increased ARG1 expression (F), and promoted osteogenesis as reflected by elevated RUNX2 expression (H). Quantification of CTSK- (C), iNOS- (E), ARG1- (G), and RUNX2- (I) positive cells. Data are presented as mean ± SD (n = 6 per group). *P < 0.05, **P < 0.01, and ***P < 0.001. Scale bar = 100 μm
To evaluate macrophage polarization in vivo, IHC staining for iNOS and ARG1 was conducted. iNOS expression, indicative of M1 macrophage activation, was prominently elevated in LPS-injected calvaria but was significantly attenuated following HDAC inhibitor treatment (Fig. 6D and E). Conversely, ARG1 expression, associated with the anti-inflammatory M2 phenotype, was markedly increased in the TSA-, PXD-, or MGCD-treated groups compared to the LPS-only group (Fig. 6F and G), suggesting a shift toward a pro-regenerative immune profile.
Lastly, RUNX2 expression, a critical osteogenic transcription factor suppressed under inflammatory stress, was significantly restored in HDAC inhibitor-treated groups (Fig. 6H and I). This restoration of RUNX2 expression highlights the pro-osteogenic activity of HDAC inhibitors in the context of inflammation-induced bone damage.
Collectively, these findings indicate that TSA, PXD, or MGCD promote osteoimmune rebalancing by suppressing osteoclast activity, shifting macrophage polarization toward M2, and osteogenic potential.
Discussion
This study demonstrates that the HDAC inhibitors TSA, PXD, and MGCD exert dual osteoimmunomodulatory effects under inflammatory conditions, positioning them as promising candidates for drug repurposing in inflammatory bone diseases. To our knowledge, this study provides the first evidence that these inhibitors can modulate macrophage polarization, suppress inflammatory bone resorption, and restore osteogenic function. Through in vitro and in vivo LPS-induced osteolysis models, HDAC inhibition consistently suppressed pro-inflammatory macrophages, promoted M2 polarization, reduced cytokine production, and restored osteogenic differentiation. These results suggest the dual role of HDAC inhibitors as immunomodulatory and pro-regenerative agents.
In our study, RUNX2 expression was higher at day 10 than at day 5 after osteogenic induction, indicating that RUNX2 functions not only during early osteoprogenitor commitment but also at later stages of differentiation [27]. Previous studies have demonstrated that RUNX2 expression can persist or re-induced in late osteogenesis, contributing to extracellular matrix maturation and mineralization [28, 29]. This biphasic role suggests that RUNX2 is required both for lineage commitment and for sustaining the transcription of matrix-associated genes such as Col1a1 and OCN during mineral deposition [30].
Mechanistically, all three HDAC inhibitors modulated the MAPK signaling cascade in a selective manner. They suppressed the phosphorylation of NF-κB, p38, and JNK which are key drivers of cytokine production and osteoclastogenesis [31–33], while simultaneously enhancing ERK activation, which is associated with M2 macrophage polarization and osteogenic differentiation [34–37]. This selective modulation of MAPK signaling reflects a coordinated intracellular response that favors tissue repair. These effects are likely mediated by HDAC inhibitor-induced chromatin remodeling that increases promoter accessibility for anti-inflammatory and osteogenic genes [38–41]. Previous studies have demonstrated that HDAC inhibition induces hyperacetylation of histones H3 and H4, particularly at lysine residues such as H3K9, H3K14, H4K5, and H4K8 [42–46]. These modifications relax chromatin structure and enable transcriptional activation [47], suggesting that the molecular outcomes observed in our study may involve H3/H4 acetylation-dependent chromatin remodeling.
Despite structural differences and varying selectivity, TSA, PXD, and MGCD converge on the inhibition of HDAC1–3. All three inhibitors produced broadly comparable osteoimmunomodulatory outcomes, supporting a common HDAC1–3-dependent mechanism. Notably, TSA elicited more pronounced effects at lower concentrations, whereas PXD and MGCD required higher doses to achieve similar efficacy. Although isoform-specific effects were not directly examined, these findings collectively suggest that HDAC1–3 inhibition may represent a shared epigenetic axis regulating osteoimmune homeostasis.
The in vivo results further support the therapeutic potential of HDAC inhibitors. In the LPS-induced calvarial osteolysis model, administration of TSA, PXD, or MGCD after substantial bone erosion had occurred (7 days post-LPS treatment) effectively mitigated bone destruction, indicating therapeutic rather than merely preventive efficacy. Histological and immunohistochemical analyses showed reduced osteoclast activity, restoration of osteogenic marker expression, and a shift toward M2 macrophage polarization. These findings demonstrate that HDAC inhibitors not only reverse inflammatory bone loss but also re-establish a pro-regenerative osteoimmune microenvironment, highlighting their clinically relevant therapeutic potential as multifunctional modulators.
In our study, HDAC inhibitors were locally administered in the calvarial osteolysis model, minimizing systemic exposure. However, most FDA-approved HDAC inhibitors for hematologic malignancies are delivered systemically and are associated with hematological and hepatic toxicities [48–50]. Recent clinical trials of local delivery strategies have demonstrated promising efficacy with reduced systemic toxicity [51, 52], underscoring the translational relevance of our findings and suggesting that localized delivery of HDAC inhibitors may represent a safer and more effective therapeutic avenue for inflammatory bone diseases.
Collectively, our findings support an epigenetic drug-repurposing strategy that leverages the dual immune-regenerative potential of clinically available HDAC inhibitors. Because their pharmacokinetics, toxicity, and dosing parameters are already defined in oncology, these agents provide a feasible and accelerated path toward osteoimmunomodulatory therapy. This strategy is especially attractive for inflammatory bone diseases, where effective therapy demands concurrent suppression of inflammation and stimulation of bone regeneration. Nevertheless, this study has limitations, including reliance on the MC3T3-E1 cell line for osteogenic assays and the lack of direct histone acetylation measurements. Future studies should validate the findings in primary osteoblasts or MSC-derived cultures, incorporate histone acetylation assays, and further delineate isoform-specific mechanisms to strengthen mechanistic evidence and confirm efficacy in human tissues to facilitate clinical translation.
Conclusions
TSA, PXD, and MGCD can be repurposed to restore osteoimmune balance by simultaneously promoting M2 macrophage polarization and osteogenic signaling under inflammatory conditions. By selectively suppressing pro-inflammatory NF-κB/p38/JNK pathways and activating the ERK-Runx2 axis, these inhibitors create a pro-regenerative microenvironment that reverses bone loss (Fig. 7). These inhibitors target a shared HDAC1–3 and create a pro-regenerative microenvironment that reverses bone destruction. Our findings provide a mechanistic rationale for using clinically available HDAC inhibitors as dual-action therapeutics for inflammatory bone diseases.
Fig. 7.
TSA, PXD, and MGCD restore osteoimmune homeostasis by modulating inflammation and promoting bone regeneration. A schematic illustration summarizing the dual therapeutic effects of HDAC inhibitors—TSA, PXD, and MGCD—on the inflammatory bone microenvironment. In the inflammatory state, pro-inflammatory M1 macrophages predominate, producing high levels of IL-1β, TNF-α, and IL-6. These cytokines amplify local inflammation, disrupt bone homeostasis, and promote bone resorption. Treatment with TSA, PXD, or MGCD induces a shift toward anti-inflammatory M2 macrophages, contributing to the resolution of inflammation and the establishment of a pro-regenerative microenvironment by suppressing NF-κB, p38, and JNK signaling pathways while selectively enhancing the ERK pathway. These coordinated effects offer a potential therapeutic strategy for inflammatory bone diseases
Acknowledgements
The authors declare that they have not used AI-generated work in this manuscript.
Abbreviations
- HDAC
Histone deacetylase
- TSA
Trichostatin A
- PXD
PXD-101
- MGCD
MGCD-0103
- LPS
Lipopolysaccharide
- RUNX2
Runt-related transcription factor 2
- ALP
Alkaline phosphatase
- BSP
Bone sialoprotein
- ERK
extracellular signal-related kinase
- JNK
c-Jun N-terminal kinase
- GAPDH
Glyceraldehyde 3-phosphate dehydrogenase
Author contributions
H.K. and S.P. conceived and designed the study. Methodology was developed by H.K., L.K., and S.P. H.K. performed the data analysis and curated the data. Investigation was carried out by H.K., L.K., and S.P. The original draft was written by H.K., and the manuscript was reviewed and edited by H.K. and S.P. Visualization was conducted by H.K. Supervision and funding acquisition were provided by H.K. and S.P. All authors have read and approved the final version of the manuscript.
Funding
This research was supported by the Basic Science Research Program through the National Research Foundation of Korea funded by the Ministry of Education [grant nos. 2022R1A2C1012354 and 2022R1A6A3A01086548].
Data availability
All data generated or analyzed during this study are included in this published article and its supplementary information files.
Declarations
Ethics approval and consent to participate
The project titled “The study on effects of epigenetic modifier on modulation of inflammatory response in lipopolysaccharides (LPS)-induced mouse calvaria bone resorption model” was approved by the IACUC of Seoul National University on October 16, 2023 (approval number SNU-230918-4). All animal procedures were conducted in accordance with the ARRIVE guidelines and the relevant institutional regulations.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Sapra L, Srivastava RK. Immunotherapy in the management of inflammatory bone loss in osteoporosis. Adv Protein Chem Struct Biol. 2025;144:461–91. [DOI] [PubMed] [Google Scholar]
- 2.Steffen U, Schett G, Bozec A. How autoantibodies regulate osteoclast induced bone loss in rheumatoid arthritis. Front Immunol. 2019;10:1483. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Zhang M, Liu Y, Afzali H, Graves DT. An update on periodontal inflammation and bone loss. Front Immunol. 2024;15:1385436. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Torres HM, Arnold KM, Oviedo M, Westendorf JJ, Weaver SR. Inflammatory processes affecting bone health and repair. Curr Osteoporos Rep. 2023;21(6):842–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.DiCarlo EF, Kahn LB. Inflammatory diseases of the bones and joints. Semin Diagn Pathol. 2011;28(1):53–64. [DOI] [PubMed] [Google Scholar]
- 6.Okamoto K, Nakashima T, Shinohara M, Negishi-Koga T, Komatsu N, Terashima A, et al. Osteoimmunology: the conceptual framework unifying the immune and skeletal systems. Physiol Rev. 2017;97(4):1295–349. [DOI] [PubMed] [Google Scholar]
- 7.Guder C, Gravius S, Burger C, Wirtz DC, Schildberg FA. Osteoimmunology: A current update of the interplay between bone and the immune system. Front Immunol. 2020;11:58. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zhang D, Dang Y, Deng R, Ma Y, Wang J, Ao J, et al. Research progress of macrophages in bone regeneration. J Tissue Eng Regen Med. 2023;2023:1512966. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Yunna C, Mengru H, Lei W, Weidong C. Macrophage M1/M2 polarization. Eur J Pharmacol. 2020;877:173090. [DOI] [PubMed] [Google Scholar]
- 10.Luo M, Zhao F, Cheng H, Su M, Wang Y. Macrophage polarization: an important role in inflammatory diseases. Front Immunol. 2024;15:1352946. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Li J, Li L, Wang Y, Huang G, Li X, Xie Z, et al. Insights into the role of DNA methylation in immune cell development and autoimmune disease. Front Cell Dev Biol. 2021;9:757318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Montecino M, Carrasco ME, Nardocci G. Epigenetic control of osteogenic lineage commitment. Front Cell Dev Biol. 2020;8:611197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Li X, Ye Y, Peng K, Zeng Z, Chen L, Zeng Y. Histones: the critical players in innate immunity. Front Immunol. 2022;13:1030610. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Li K, Han J, Wang Z. Histone modifications centric-regulation in osteogenic differentiation. Cell Death Discov. 2021;7(1):91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Park SY, Kim JS. A short guide to histone deacetylases including recent progress on class II enzymes. Exp Mol Med. 2020;52(2):204–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Licciardi PV, Karagiannis TC. Regulation of immune responses by histone deacetylase inhibitors. ISRN Hematol. 2012;2012:690901. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Algate K, Haynes D, Fitzsimmons T, Romeo O, Wagner F, Holson E, et al. Histone deacetylases 1 and 2 Inhibition suppresses cytokine production and osteoclast bone resorption in vitro. J Cell Biochem. 2020;121(1):244–58. [DOI] [PubMed] [Google Scholar]
- 18.Liu XM, Yang L, Yang QB. Advanced progress of histone deacetylases in rheumatic diseases. J Inflamm Res. 2024;17:947–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Vigushin DM, Ali S, Pace PE, Mirsaidi N, Ito K, Adcock I, et al. Trichostatin A is a histone deacetylase inhibitor with potent antitumor activity against breast cancer in vivo. Clin Cancer Res. 2001;7(4):971–6. [PubMed] [Google Scholar]
- 20.Lassen U, Molife LR, Sorensen M, Engelholm SA, Vidal L, Sinha R, et al. A phase I study of the safety and pharmacokinetics of the histone deacetylase inhibitor Belinostat administered in combination with carboplatin and/or Paclitaxel in patients with solid tumours. Br J Cancer. 2010;103(1):12–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sikandar S, Dizon D, Shen X, Li Z, Besterman J, Lipkin SM. The class I HDAC inhibitor MGCD0103 induces cell cycle arrest and apoptosis in colon cancer initiating cells by upregulating Dickkopf-1 and non-canonical Wnt signaling. Oncotarget. 2010;1(7):596–605. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Furumai R, Komatsu Y, Nishino N, Khochbin S, Yoshida M, Horinouchi S. Potent histone deacetylase inhibitors built from trichostatin A and Cyclic tetrapeptide antibiotics including Trapoxin. Proc Natl Acad Sci U S A. 2001;98(1):87–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Porter NJ, Christianson DW. Structure, mechanism, and Inhibition of the zinc-dependent histone deacetylases. Curr Opin Struct Biol. 2019;59:9–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Boumber Y, Younes A, Garcia-Manero G. Mocetinostat (MGCD0103): a review of an isotype-specific histone deacetylase inhibitor. Expert Opin Investig Drugs. 2011;20(6):823–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Cui SN, Chen ZY, Yang XB, Chen L, Yang YY, Pan SW, et al. Trichostatin A modulates the macrophage phenotype by enhancing autophagy to reduce inflammation during polymicrobial sepsis. Int Immunopharmacol. 2019;77:105973. [DOI] [PubMed] [Google Scholar]
- 26.Zhang P, Tao F, Li Q, Wu S, Fu B, Liu P. 5-Azacytidine and trichostatin A enhance the osteogenic differentiation of bone marrow mesenchymal stem cells isolated from steroid-induced avascular necrosis of the femoral head in rabbit. J Biosci. 2019;44(4). [PubMed]
- 27.Vimalraj S, Arumugam B, Miranda PJ, Selvamurugan N. Runx2: Structure, function, and phosphorylation in osteoblast differentiation. Int J Biol Macromol. 2015;78:202–8. [DOI] [PubMed] [Google Scholar]
- 28.Wu H, Whitfield TW, Gordon JA, Dobson JR, Tai PW, van Wijnen AJ, et al. Genomic occupancy of Runx2 with global expression profiling identifies a novel dimension to control of osteoblastogenesis. Genome Biol. 2014;15(3):R52. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Liu TM, Lee EH. Transcriptional regulatory cascades in Runx2-dependent bone development. Tissue Eng Part B Rev. 2013;19(3):254–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Amarasekara DS, Kim S, Rho J. Regulation of osteoblast differentiation by cytokine networks. Int J Mol Sci. 2021;22(6). [DOI] [PMC free article] [PubMed]
- 31.Hu X, Yin Z, Chen X, Jiang G, Yang D, Cao Z, et al. Tussilagone inhibits osteoclastogenesis and periprosthetic osteolysis by suppressing the NF-κB and P38 MAPK signaling pathways. Front Pharmacol. 2020;11:385. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Su P, Luo X, Zeng C, Zhou L. Madecassic acid suppresses osteoclast differentiation and bone resorption by inhibiting RANKL-induced NF‐κB, JNK and NFAT signaling pathways. Rheumatol Autoimmun. 2023;3(4):220–9. [Google Scholar]
- 33.Ke D, Ji L, Wang Y, Fu X, Chen J, Wang F, et al. JNK1 regulates RANKL-induced osteoclastogenesis via activation of a novel Bcl-2-Beclin1-autophagy pathway. Faseb J. 2019;33(10):11082–95. [DOI] [PubMed] [Google Scholar]
- 34.Jun JH, Yoon WJ, Seo SB, Woo KM, Kim GS, Ryoo HM, et al. BMP2-activated Erk/MAP kinase stabilizes Runx2 by increasing p300 levels and histone acetyltransferase activity. J Biol Chem. 2010;285(47):36410–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Bai B, He J, Li YS, Wang XM, Ai HJ, Cui FZ. Activation of the ERK1/2 signaling pathway during the osteogenic differentiation of mesenchymal stem cells cultured on substrates modified with various chemical groups. Biomed Res Int. 2013;2013:361906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.He L, Jhong JH, Chen Q, Huang KY, Strittmatter K, Kreuzer J, et al. Global characterization of macrophage polarization mechanisms and identification of M2-type polarization inhibitors. Cell Rep. 2021;37(5):109955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Yang L, Guo P, Wang P, Wang W, Liu J. IL-6/ERK signaling pathway participates in type I IFN-programmed, unconventional M2-like macrophage polarization. Sci Rep. 2023;13(1):1827. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Chen X, Barozzi I, Termanini A, Prosperini E, Recchiuti A, Dalli J, et al. Requirement for the histone deacetylase Hdac3 for the inflammatory gene expression program in macrophages. Proc Natl Acad Sci U S A. 2012;109(42):E2865–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Feng D, Sangster-Guity N, Stone R, Korczeniewska J, Mancl ME, Fitzgerald-Bocarsly P, et al. Differential requirement of histone acetylase and deacetylase activities for IRF5-mediated Proinflammatory cytokine expression. J Immunol. 2010;185(10):6003–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Shen J, Yin C, Jiang X, Wang X, Yang S, Song G. Aberrant histone modification and inflammatory cytokine production of peripheral CD4 + T cells in patients with oral lichen planus. J Oral Pathol Med. 2019;48(2):136–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Chen Y, Liang R, Li Y, Jiang L, Ma D, Luo Q, et al. Chromatin accessibility: biological functions, molecular mechanisms and therapeutic application. Signal Transduct Target Ther. 2024;9(1):340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Lawlor L, Yang XB. Harnessing the HDAC-histone deacetylase enzymes, inhibitors and how these can be utilised in tissue engineering. Int J Oral Sci. 2019;11(2):20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Fu Y, Zhang P, Ge J, Cheng J, Dong W, Yuan H, et al. Histone deacetylase 8 suppresses osteogenic differentiation of bone marrow stromal cells by inhibiting histone H3K9 acetylation and RUNX2 activity. Int J Biochem Cell Biol. 2014;54:68–77. [DOI] [PubMed] [Google Scholar]
- 44.Dashti P, Lewallen EA, Gordon JAR, Montecino MA, Davie JR, Stein GS, et al. Epigenetic regulators controlling osteogenic lineage commitment and bone formation. Bone. 2024;181:117043. [DOI] [PubMed] [Google Scholar]
- 45.Hu L, Yu Y, Huang H, Fan H, Hu L, Yin C, et al. Epigenetic regulation of Interleukin 6 by histone acetylation in macrophages and its role in Paraquat-Induced pulmonary fibrosis. Front Immunol. 2016;7:696. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Chen M, Li Y, Zhang M, Ge S, Feng T, Chen R, et al. Histone deacetylase Inhibition enhances extracellular vesicles from muscle to promote osteogenesis via miR-873-3p. Signal Transduct Target Ther. 2024;9(1):256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Ning L, Rui X, Bo W, Qing G. The critical roles of histone deacetylase 3 in the pathogenesis of solid organ injury. Cell Death Dis. 2021;12(8):734. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.El Omari N, Bakrim S, Elhrech H, Aanniz T, Balahbib A, Lee LH, et al. Clinical efficacy and mechanistic insights of FDA-approved HDAC inhibitors in the treatment of lymphoma. Eur J Pharm Sci. 2025;208:107057. [DOI] [PubMed] [Google Scholar]
- 49.Advani A, Huang Q, Thai K, Advani SL, White KE, Kelly DJ, et al. Long-term administration of the histone deacetylase inhibitor Vorinostat attenuates renal injury in experimental diabetes through an endothelial nitric oxide synthase-dependent mechanism. Am J Pathol. 2011;178(5):2205–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Parveen R, Harihar D, Chatterji BP. Recent histone deacetylase inhibitors in cancer therapy. Cancer. 2023;129(21):3372–80. [DOI] [PubMed] [Google Scholar]
- 51.Gryder BE, Sodji QH, Oyelere AK. Targeted cancer therapy: giving histone deacetylase inhibitors all they need to succeed. Future Med Chem. 2012;4(4):505–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Burke B, Eden C, Perez C, Belshoff A, Hart S, Plaza-Rojas L, et al. Inhibition of histone deacetylase (HDAC) enhances checkpoint Blockade efficacy by rendering bladder cancer cells visible for T Cell-Mediated destruction. Front Oncol. 2020;10:699. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during this study are included in this published article and its supplementary information files.







