Abstract
Objective
Fused in Sarcoma (FUS), an RNA-binding protein implicated in gene expression regulation and DNA damage repair, demonstrates abnormal overexpression in multiple malignancies. Its functional significance in Renal Cell Carcinoma (RCC) pathogenesis remains poorly characterized.
Methods
We employed bioinformatics analysis to assess FUS prognostic value, complemented by in vitro and in vivo functional studies to evaluate its phenotypic impact on RCC. Protein interactors were identified through Co-Immunoprecipitation (Co-IP), with mechanistic insights derived from flow cytometry and immunofluorescence assays.
Results
Clinical RCC specimens exhibited significantly elevated FUS expression compared to adjacent normal tissues (p < 0.01). Both cellular models and xenograft experiments demonstrated that FUS overexpression potentiated RCC proliferation, invasion, and metastatic capacity, whereas FUS knockdown suppressed tumorigenic progression. Mechanistically, FUS promoted RCC advancement by attenuating apoptosis and inducing Epithelial-Mesenchymal Transition (EMT). Further investigation revealed FUS interaction with KCMF1 and CENPT, forming a pro-oncogenic signaling axis. KCMF1 overexpression facilitated FUS nuclear translocation, enhancing its binding to CENPT mRNA and subsequent CENPT upregulation. As a core centromere protein, the upregulation of CENPT can induce abnormal chromosome segregation, leading to genomic instability. This feature is associated with a higher recurrence rate, shorter survival time, and distant metastasis in RCC patients. The JNK (c-Jun N-terminal Kinase) signaling also plays a key role in driving malignant progression.
Conclusion
The KCMF1/FUS/CENPT axis promotes RCC growth and metastasis via a non-proteasomal mechanism coupled with JNK pathway activation. These findings position FUS as a potential diagnostic biomarker and therapeutic target in RCC management.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12967-025-07254-z.
Keywords: RCC, KCMF1/FUS/CENPT axis, Apoptosis, EMT, JNK signaling pathway
Introduction
Renal Cell Carcinoma (RCC) is the most common malignant tumor of the kidney and one of the most prevalent urological malignancies. RCC comprises multiple distinct subtypes, among which the typical types can be divided into three main histological subtypes: Clear Cell Renal Cell Carcinoma (ccRCC), Papillary Renal Cell Carcinoma (PRCC), and Chromophobe Renal Cell Carcinoma (ChRCC) [1].Worldwide, ccRCC being the predominant subtype, accounting for approximately 75% of all RCC cases [2]. RCC is characterized by its aggressive nature and complex etiology, driven by numerous molecular and signaling pathways. Currently, the primary treatment strategies for RCC involve local tumor resection and systemic therapies for metastatic disease, which are often associated with poor prognostic outcomes [3]. Despite surgical removal of the primary tumor, approximately 30% of RCC patients experience disease recurrence and metastasis, underscoring the urgent need to investigate the molecular mechanisms underlying RCC to identify novel preventive and therapeutic targets.
FUS, an essential RNA-binding protein, plays crucial roles in various biological processes, including cell metabolism, RNA processing, and DNA repair [4]. FUS has been studied in neurodegenerative diseases such as ALS and FTD. However, its role in cancer biology, particularly in RCC, remains poorly understood [5–7]. To address this gap, our study identified two molecules, KCMF1 and CENPT. KCMF1, a recently characterized E3 ubiquitin ligase, interacts with unstable proteins, promoting cancer progression by regulating autophagy and ion channel functions in RCC [8]. CENPT is involved in chromosome segregation, and its overexpression has been linked to chromosomal instability, further contributing to cancer progression [9]. Whether FUS alters its subcellular localization through interactions with proteins such as KCMF1, thereby regulating the expression of target molecules like CENPT, and ultimately affecting cell apoptosis, EMT, and JNK pathway activity, this complete regulatory network remains unelucidated.
Apoptosis, first defined by Kerr et al. in 1972 [10], plays a critical role in cancer progression. Tumorigenesis is characterized by dysregulated cell proliferation and impaired apoptosis, highlighting apoptosis as a key therapeutic target in cancer [11]. Functionally, apoptosis eliminates damaged or abnormal cells, preventing malignant transformation. Conversely, inhibiting apoptosis allows aberrant cells to survive and drive tumor growth. Epithelial-Mesenchymal Transition (EMT) is another integral process in cancer progression, playing a pivotal role in tumor invasion, metastasis, and drug resistance [12]. Due to its association with high therapy resistance, EMT is a critical focus for cancer research and treatment development [13]. Although the roles of these processes have been clearly confirmed, the mechanism by which FUS coordinates these processes in RCC remains unclear. The specific functions of FUS in mediating drug resistance, apoptosis, and EMT have not yet been clarified. Particularly, in RCC, there is still a lack of systematic research on whether FUS regulates the above biological processes through crosstalk with other signaling molecules.
The JNK signaling pathway is a major stress-response pathway involved in cellular processes such as proliferation, apoptosis, and differentiation, primarily mediated through a kinase cascade with JNK as the central regulator [14]. Upon stress signal activation, JNK translocates to the nucleus and activates transcription factors, such as c-Jun, influencing gene expression. Recent studies have revealed aberrant activation of the JNK1/2 signaling pathway in RCC, which contributes to enhanced tumor proliferation and metastasis, establishing JNK as a potential therapeutic target [15]. Meanwhile, existing studies have confirmed that abnormal activation of the JNK pathway can promote the malignant progression of RCC [16], however, there is still a lack of experimental evidence regarding whether FUS is involved in the regulation of the JNK pathway through direct or indirect means, and whether this regulation depends on its interaction with the KCMF1/CENPT axis. Clarifying these scientific issues will not only help fill the knowledge gap in FUS research related to RCC but also provide a new perspective for understanding how RNA-binding proteins coordinate multiple signaling pathways to regulate tumor progression.
Against this backdrop, the present study aims to: (1) investigate and characterize the expression pattern of FUS in RCC and its clinical significance. (2) explore the functional role of FUS in regulating the proliferation, invasion, and metastasis of RCC cells. (3) explore the molecular mechanisms underlying FUS-mediated effects, including its interaction with KCMF1 and CENPT, as well as its potential involvement in the JNK signaling pathway. By addressing these issues, we seek to identify new therapeutic targets for RCC management.
Materials and methods
Tissue samples
In this study, RCC was confirmed by pathological examination as the criteria for sample selection. RCC tissues and matched adjacent normal kidney tissues were obtained from 15 patients treated at the Affiliated Hospital of Qingdao University. Basic information, including sex, age, pathological subtype, and TNM stage was also collected. Immediately after excision, tissue samples were rapidly preserved in liquid nitrogen. The study protocol was approved by the Ethics Committee of the Affiliated Hospital of Qingdao University (Qingdao, China), and written informed consent was obtained from all participants.
Cell culture
The human RCC lines, ACHN, A498, and OSRC-2, as well as the human renal epithelial cell line HK2, were sourced from the Gong Kan Laboratory at the Institute of Urology, Peking University. The RCC line Caki-1 and 786-O was purchased from Pricella Biotechnology Co., Ltd. (Wuhan, China). The human RCC cell lines were cultured in DMEM medium (Pricella, PM150210, China) supplemented with 10% fetal bovine serum (FBS) (Pricella, 164210-50, China) and 1% penicillin-streptomycin (Pricella, PB180120, China). All cell cultures were maintained at 37 °C in a humidified incubator with 5% CO2.
Transfection
The FUS and KCMF1 overexpression lentivirus were purchased from Nanjing Zebrafish Biotechnology Co. Recombinant overexpression lentiviruses were constructed using lentiviral plasmids carrying Green Fluorescent Protein (GFP). For FUS knockdown, we performed cell transfection using three different lentiviral shRNA oligonucleotide sequences synthesized by Qingdao Bokang Biotechnology Co, with the most efficient sequence selected for further analysis. Cell transfection targeted knockdown of CENPT using three different lentiviral shRNA oligonucleotide sequences synthesized by OBiO Technology Corp., Ltd. (Shanghai, China). We selected the most efficient sequences for subsequent analysis. Cells were seeded into 24-well plates at a density of 1 × 10⁴ cells per well and infected with the lentivirus. The MOI value is 10. After 48–72 h, fluorescence expression efficiency was observed under a fluorescence microscope, and we quantified the transfection efficiency through Western blot experiments. RCC cell lines with stable expression were subsequently screened for further experiments.
CCK8 assay
We seeded cells into 96-well plates at a density of 1 × 10³ cells per well in 100 µl of medium. At 24 h, 48 h, 72 h, 96 h, and 120 h post-inoculation, 10 µl of the CCK-8 reagent (MCE, HY-K0301, USA) was added to each well under dark conditions. After incubating for 2 h, we measured the absorbance of each well at 450 nm using a microplate reader and recorded the values.
Colony formation assay
A total of 1,000 cells per well were seeded into 6-well plates and incubated in an incubator for one week. We first fixed the cells with 4% paraformaldehyde for 30 min, then stained them with 0.1% crystal violet for 20 min. After staining, the cells were rinsed with PBS, air-dried, photographed, and quantified using ImageJ software.
Wound healing assay
We cultured cells in six-well plates, the seeding density was 1000 cells per well, and used a 200 µL pipette tip to create a scratch in the cell monolayer. Representative images of cell migration were captured at 0, 24 h post-scratch. For image acquisition, we used a 10× objective lens. The imaging conditions were as follows: three fixed fields of view were selected per well to ensure that the same regions were imaged at each time point, thereby reducing errors. This magnification balanced the field-of-view range and detail resolution, allowing complete capture of the scratched area. Each field of view was required to include the center of the scratch and its edges on both sides, ensuring that the wound width could be quantified. The area covered by migrating cells was quantified using ImageJ software.
Transwell assay
We seeded cells into the upper chamber with 100 µl of serum-free medium. The cell density was adjusted to 1 × 104 cells/ mL. For invasion experiments, matrigel (ABW Bio, 0827045, China) was applied to the upper chamber, whereas it was omitted for migration experiments. Matrigel was thawed overnight at 4°C under sterile conditions. Before the experiment, it was transferred to an ice box, diluted with serum-free medium at a ratio of 1: 8, and 60 µl of the diluted Matrigel was vertically added to the upper chamber of the Transwell insert and spread evenly. 500 µl of complete medium containing 10% FBS was added to the lower chamber. After 24 h of incubation, the cells in the upper chamber were fixed and stained with crystal violet for 20 min. The stained cells were then visualized, photographed, and counted in five randomly selected fields of view. This experiment was independently repeated 3 times.
RNA extraction and quantitative real-time PCR (qRT-PCR)
We extracted Total RNA using 500ul RNA-easy Isolation Reagent (Vazyme, R701, China) according to the manufacturer’s instructions, and measured the A260/A280 ratio using a NanoDrop spectrophotometer, with an acceptable range of 1.8-2.0. The extracted RNA was reverse transcribed into complementary DNA (cDNA) using a reverse transcription kit (Accurate Biology, AG11728, China). We used the SYBR® Green Pro Taq HS premixed qRT-PCR kit (Accurate Biology, AG11701, China) to determine the expression levels of gene-specific cDNAs. qRT-PCR was performed using specific primers. Relative gene expression levels were calculated using the 2−ΔΔCt method, with the GAPDH gene used as an internal control. The pre-denaturation step was performed at 95 °C for 30 s. Subsequently, 40 cycles of amplification were carried out under the following conditions: 95 °C for 5 s (denaturation) and 60 °C for 30 s (annealing/extension). The primer sequences were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The specific sequences are as follows: FUS, F: CAGAGCCAGAACAGCTATGGA and R: CCATAGCCAGGGTAGGAGGA. CENPT, F: GGTGAGAGGATTGTCAACCAG and R: AGTCTTGGCTTCTTCATCATATTCT. GAPDH, F: GGAAGCTTGTCATCAATGGAAATC and R: TGATGACCCTTTTGGCTCCC.
Western blotting
We extracted Proteins from cells using RIPA lysis buffer (Solarbio, R0020), and their concentrations were measured using the bicinchoninic acid (BCA) assay (Solarbio, PC0020). Proteins were first normalized to equal quantities, then resolved via electrophoresis on a 10% SDS-PAGE gel. Following separation, proteins were electroblotted onto a 0.45 μm PVDF membrane at a constant current of 190 mA for 90 min. We blocked the membranes with 5% nonfat dry milk and incubated overnight (approximately 16 h) on a shaker at 4 °C, then washed the membrane 3 times with TBST for 10 min each. Subsequently, the membranes were incubated with peroxidase-conjugated secondary antibodies for 2 h at room temperature. The primary antibodies were FUS (Abcam, 1:1000, ab243880), CENPT (Abcam, 1:1500, ab86595), BAX (Affinity, 1:1000, AF0120), Bcl-2 (Affinity, 1:1000, AF6139), E-cadherin (Affinity, 1:1000, AF0131), Vimentin (Affinity, 1:1000, BF8006), JNK (Abcam, 1:1000, ab179461), ERK (Abcam, 1:1000, ab184699), p38 (Abcam, 1:2000, ab170099), GAPDH (Abcam, 1:5000, ab9485). The corresponding secondary antibodies (Elabscience, 1:10000, E-AB-1003/E-AB-1122) were incubated at room temperature for 1 h. Finally, immunoreactive bands were visualized using an enhanced chemiluminescence detection system.
Co-immunoprecipitation (Co-IP) assay
We performed the co-immunoprecipitation assay using stably transfected A498 and ACHN cells, which were lysed with 500 µL RIPA lysis buffer at 4 °C for 30 min. Overexpress Flag-tagged KCMF1 protein (Bait protein) and perform immunoprecipitation with 20 µg of Flag antibody (Abcam, ab205606) to verify whether KCMF1 interacts with FUS. Conversely, overexpress Myc-tagged FUS protein (Bait protein) and perform immunoprecipitation with 20 µg of Myc antibody (CST, 2276 S) to validate the interaction between FUS and KCMF1 in the reverse direction. Antibodies were directly immobilized on the agarose matrix using the Thermo Scientific™ Pierce™ Co-Immunoprecipitation Kit (Thermo Scientific™, 26149, USA). The bait protein was incubated with the prey protein mixture at 4 °C overnight. After incubation, the immunoprecipitated protein complexes were eluted and heated at 100 °C for 5 min in 5× SDS loading buffer. The bound proteins were separated by 10% SDS-PAGE and analyzed by Western blotting to detect the precipitated proteins.
RNA immunoprecipitation assays
We performed RIP analysis using a RIP assay kit (Bersinbio, Bes5101). Approximately 2 × 107 ACHN cells were collected and lysed with RIP lysis buffer. Add 5ug of FUS antibody to the experimental group and 5ug of IgG antibody to the control group. Incubate the samples with slow rotation at 4 °C for 16 h (overnight). For the purified RNA, construct strand-specific libraries. After quality control of the libraries, perform high-throughput sequencing using the Illumina NovaSeq 6000 platform. Analyze the sequencing data with software such as high-quality mapped reads and MACS2.
RNA pull down
We used the RNA Pull-Down Kit (Genecreate, JKR23004, China) to detect the interaction between CENPT-RNA and target proteins, following the manufacturer’s protocol. Briefly, we prepared cell lysates of 2 × 10⁷cells using IP cell lysis buffer supplemented with protease inhibitors. We incubated biotin-labeled CENPT-RNA probes and control probes with washed streptavidin magnetic beads at room temperature for 2 h with agitation. Subsequently, we incubated the streptavidin magnetic beads with immobilized probes with the prepared cell lysates at 4 °C overnight with rotation. After washing the magnetic beads, we eluted the pulled-down proteins. We identified the target proteins by Western blotting analysis.
Nuclear and cytoplasmic extraction
The Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime, P0028) was used. Prepare cytoplasmic protein extraction reagent A by adding PMSF to a final concentration of 1 mM. Treat cells with EDTA solution to detach them from the culture dish. After centrifugation, carefully remove the supernatant and retain the cell pellet. Add 10 µL of cytoplasmic protein extraction reagent B to the cell pellet. Incubate on ice for 10 min, then centrifuge at 12,000–16,000 g for 5 min at 4 °C. The supernatant contains the extracted cytoplasmic proteins. Remove all residual supernatant from the pellet. Add 50 µL of nuclear protein extraction reagent supplemented with PMSF. Vortex vigorously at maximum speed for 15–30 s to completely resuspend and disperse the cell pellet. Centrifuge at 12,000–16,000 g for 10 min at 4 °C. The supernatant contains the extracted nuclear proteins. Finally, Proceed with Western blot analysis.
Flow cytometry
The apoptosis rate of RCC cells was assessed using the Annexin V-FITC/PE-A Apoptosis Detection Kit (Elabscience, Wuhan, China). Caki-1 or OSRC-2 cells (1 × 10⁴ cells/mL) were seeded into 6-well plates and cultured overnight. Following digestion with EDTA-free trypsin, as per the manufacturer’s instructions, the cells were collected by centrifugation, washed twice with PBS, and centrifuged again to remove the supernatant. The cells were then resuspended in 500 µL of diluted 1× Annexin V Binding Buffer, followed by the addition of 5 µL Annexin V-FITC and 5 µL PE-A. The mixture was incubated in the dark for 15 min. After staining, the cells were immediately analyzed using a flow cytometer (ThermoFisher, A24864). In the flow cytometry analysis, cells in the lower left quadrant represented live cells, those in the upper left quadrant represented necrotic cells, cells in the lower right quadrant represented early apoptotic cells, and those in the upper right quadrant represented late apoptotic cells. We calculated the apoptosis rate as the sum of the percentages of cells in the lower right and upper right quadrants and statistically analyzed the results.
Immunofluorescence staining
Slides containing Caki-1 or OSRC-2 cells were fixed with 4% paraformaldehyde, blocked (Abcam, ab126587), and incubated overnight at 4 °C with the primary antibody. The following day, the cells were incubated with the appropriate fluorescence-labeled secondary antibody for 1 h at room temperature. The primary antibodies were E-cadherin (Affinity, 1:100, AF0131) and Vimentin (Affinity, 1:100, BF8006). The corresponding secondary antibodies were (Elabscience, 1:100, E-AB-1056/E-AB-1060). The nuclei were stained with DAPI for 5 min, and protein expression was analyzed with a LEICA SP8 laser scanning confocal microscope. Fluorescence intensity was quantified with ImageJ software.
MG132 treatment
MG132 is an inhibitor of the proteasome protein degradation pathway. The proteasome inhibitor MG132 (TargetMol, T12628, USA) was added to cells stably expressing KCMF1. Cells were collected for protein extraction and Western blot analysis.
Tumor xenograft models
Four-week-old male BALB/c nude mice were obtained from Jinan Pangyue Laboratory Animal Breeding Co Ltd (Jinan, China). The mice were randomly assigned to the control group and the experimental group. Each group consisted of 5 mice. We established the xenograft tumor model by subcutaneously injecting 5 × 106 tumor cells into the right side of nude mice. Tumor length and width were measured every three days. When the tumors reached the preset endpoint or at the end of the monitoring period, the mice were euthanized, and tumor size was measured and photographed. We calculated tumor volume using the following formula TV (mm³) = length × width² × 0.5. During the experiment, two independent researchers were respectively responsible for animal feeding and tumor measurement. Blinding was unblinded during the data analysis phase to reduce subjective bias.
Statistical analysis
We conducted Statistical analysis and graphing using SPSS Statistics and GraphPad Prism software. The statistical analysis workflow was as follows: we used Shapiro-Wilk test to assess the normality of the data. For data that followed a normal distribution, we performed Levene’s test to evaluate the homogeneity of variances. If the variances were homogeneous, a two-tailed Student’s t-test was used for comparisons between two groups, and one-way analysis of variance (ANOVA) was used for comparisons among multiple groups. If the variances were heterogeneous, Welch’s t-test was used for two-group comparisons, and the Kruskal-Wallis test was used for multiple-group comparisons. For data that did not follow a normal distribution, the Kruskal-Wallis test was used for comparisons between two groups or among multiple groups. Two-way ANOVA was used for two-factor experimental designs. Survival analysis was performed using the Kaplan-Meier method, and differences in survival curves were compared using the log-rank test. All tests were two-tailed. All p-values < 0.05 were considered to be statistically significant. The significance levels were defined as follows: ns (p > 0.05), * (p < 0.05), ** (p < 0.01), *** (p < 0.001).
Results
Aberrant expression of FUS in RCC
We utilized the R programming language to perform a comparative analysis of FUS expression in kidney cancer and normal tissue samples obtained from the TCGA database. The analysis revealed that FUS is aberrantly expressed across various cancer types and is upregulated in cancers such as renal cell carcinoma, liver cancer, breast cancer, and bladder cancer (Fig. 1A). Further stratified analysis (Figs. 1B-D) demonstrated that FUS expression in kidney cancer tissues was significantly elevated compared to normal tissues. Additionally, a volcano plot clearly indicated the upregulation of the FUS gene in kidney cancer samples (Fig. 1E). We conducted a Receiver Operating Characteristic (ROC) analysis, which demonstrated that FUS expression effectively differentiates between RCC patients and normal adjacent tissue (NAT) controls (Fig. 1F).
Fig. 1.
Aberrant expression of FUS in RCC. (A) FUS is highly expressed in various cancers, including RCC. (B-D) The expression of FUS in RCC tissues is significantly higher than that in normal tissues. (E) A volcano plot shows that FUS expression is upregulated in RCC. (F) ROC curve analysis indicates that FUS can accurately distinguish RCC patients from normal adjacent tissue patients. (G-H) The protein expression of FUS in RCC tissues is significantly higher than that in adjacent normal tissues. (I-J) FUS expression levels in RCC cell lines are higher than those in HK-2 cells. Data are presented as the mean ± SD (n = 3). Statistical significance was calculated by two tailed student’s t tests for A-E and H, and one-way ANOVA for panel J. *p < 0.05, ** p < 0.01
To further validate FUS expression at the protein level, we collected patients’ basic information from 15 patients (Figure S1A-B). Then, we performed Western blot analysis on 9 clinical RCC specimens. The results confirmed that the levels of FUS protein were significantly elevated in RCC tissues compared to adjacent normal kidney tissues (Fig. 1G, H). To investigate whether the expression level of FUS contributes to resistance to current renal cell carcinoma therapies, we performed Western blot analysis on 6 clinical renal cell carcinoma specimens, and the results showed that the FUS protein level in tumor tissues from sunitinib-resistant patients was significantly higher than that from drug-sensitive patients (Figures S1C). Additionally, we evaluated FUS protein expression across six RCC cell lines (Figs. 1I, J). We selected OSRC-2 and Caki-1 cells to establish stable FUS overexpression cell lines and used A498 and ACHN cells to generate stable FUS knockdown cell lines. The efficiency of FUS overexpression and knockdown was validated using Western blot analysis (Figures S1D-E).
FUS affects proliferation, migration, and invasion of RCC
To assess the effects of FUS overexpression on the proliferation, migration, and invasion capacities of renal cell carcinoma (RCC) cells, we conducted a series of in vitro functional assays. The CCK8 assay demonstrated that FUS overexpression significantly enhanced the proliferation of OSRC-2 and Caki-1 cells compared to the control group (p < 0.001) (Fig. 2A). Consistently, the clonogenic assay confirmed that FUS overexpression markedly improved the colony-forming ability of these cells (Figs. 2B, C). Furthermore, transwell assays revealed that FUS overexpression significantly promoted the migratory and invasive abilities of OSRC-2 and Caki-1 cells (Figs. 2D-F). These findings collectively indicate that FUS overexpression substantially enhances the proliferation, migration, and invasion of OSRC-2 and Caki-1 cells, suggesting that FUS may function as a pro-oncogenic factor in renal cancer progression.
Fig. 2.
FUS affects proliferation, migration and invasion of RCC. (A) The CCK8 assay showed that FUS overexpression significantly enhanced the proliferation of OSRC-2 and Caki-1 cells compared to the control group. (B-C) The colony formation assay confirmed that FUS overexpression significantly increased the colony-forming ability of RCC cells. (D-F) Transwell assays demonstrated that FUS overexpression promoted the migration and invasion abilities of RCC cells. Scale bar, 400 μm. (G)The CCK8 assay showed that FUS knockdown significantly reduced the proliferation of A498 and ACHN cells compared to the control group. (H-I) The colony formation assay confirmed that FUS knockdown significantly decreased the colony-forming ability of RCC cells. (J-L) Transwell assays demonstrated that FUS knockdown inhibited the migration and invasion abilities of RCC cells. Scale bar, 400 μm. Data are presented as the mean ± SD (n = 3). Statistical significance was calculated by two tailed student’s t tests for C, E, F, I, K, and L, and two-way ANOVA for panel A and G.** p < 0.01, *** p < 0.001
Subsequently, we established stable FUS knockdown cell lines using A498 and ACHN cells. The effects of FUS knockdown on RCC cell proliferation, migration, and invasion were then evaluated through additional in vitro functional assays. The functional results showed that FUS knockdown significantly suppressed the proliferation, migration, and invasion capacities of A498 and ACHN cells (Figs. 2G-L). By combining the findings from both FUS knockdown and overexpression experiments, we provide a comprehensive demonstration of the impact of FUS expression levels on the biological behavior of RCC cells.
FUS promotes RCC progression by inhibiting apoptosis and inducing epithelial-mesenchymal transition
We further investigated the mechanisms by which FUS overexpression promotes renal cancer progression, we analyzed its effects on apoptosis and epithelial-mesenchymal transition (EMT). Flow cytometry analysis revealed that FUS overexpression significantly reduced the apoptosis rate in OSRC-2 (p < 0.01) and Caki-1 (p < 0.01) cells (Fig. 3A). In contrast, Western blot analysis demonstrated that FUS knockdown increased the expression of the pro-apoptotic protein Bax while decreasing the expression of the anti-apoptotic protein Bcl-2 compared to the control vector group (Fig. 3B, C). These findings suggest that FUS overexpression inhibits apoptosis, whereas FUS knockdown promotes it.
Fig. 3.
FUS promotes RCC progression by inhibiting apoptosis and inducing epithelial-mesenchymal transition. (A) Flow cytometry analysis of the effect of FUS overexpression on apoptosis showed that FUS overexpression significantly reduced the apoptosis rate of OSRC-2 and Caki-1 cells. (B-C) Western blot analysis revealed that FUS knockdown increased the expression of the pro-apoptotic protein Bax and decreased the expression of the anti-apoptotic protein Bcl-2 compared to the control group. (D-E) Western blot analysis detected changes in EMT-related proteins in Caki-1 and OSRC-2 cells. N-cad refers to N-cadherin, and E-cad refers to E-cadherin. (F-G) Immunofluorescence assays showed that FUS overexpression significantly downregulated E-cadherin expression while significantly upregulating Vimentin expression. FUS overexpression promotes EMT. Data are presented as the mean ± SD (n = 3). Statistical significance was calculated by two tailed student’s t tests for C, E, and G.* p < 0.05, ** p < 0.01, *** p < 0.001
Then, we examined the association between FUS and EMT. Western blot analysis revealed that FUS overexpression led to a significant downregulation of the epithelial marker E-cadherin and an upregulation of the mesenchymal marker Vimentin in RCC cells (Fig. 3D, E). We further confirmed these results through immunofluorescence microscopy, where dual fluorescence labeling of E-cadherin and Vimentin showed that FUS overexpression induced a marked reduction in E-cadherin levels while significantly increasing Vimentin expression in RCC cells (Fig. 3F, G). In summary, these findings demonstrate that FUS promotes the proliferation, migration, and invasion of RCC cells in vitro by suppressing apoptosis and inducing epithelial-mesenchymal transition.
FUS interacted with KCMF1 in RCC cells
It has been well-established that FUS promotes RCC progression by inhibiting apoptosis and facilitating EMT. To investigate the underlying mechanisms by which FUS enhances tumor development, we conducted Co-IP assays to identify potential FUS-interacting proteins. The results revealed that KCMF1 and FUS interact with each other (Fig. 4A). This interaction was further validated via Western blot analysis in A498 and ACHN cell lines (Figs. 4B, C). Additionally, elevated KCMF1 expression was found to enhance FUS expression levels, suggesting that the interaction between KCMF1 and FUS may play a significant role in driving RCC progression. To explore whether the proteasome pathway is involved in KCMF1-mediated regulation of FUS expression, we treated cells with the proteasome inhibitor MG132. Interestingly, MG132 treatment did not influence FUS expression levels (Fig. 4D), indicating that KCMF1 does not regulate FUS via the proteasome pathway. Then, we performed Western blot analysis on 9 clinical RCC specimens. The results confirmed significantly elevated KCMF1 protein levels in RCC tissues compared to adjacent normal kidney tissues (Figures S2A-B). In vivo experiments also showed that overexpression of KCMF1 enhanced the proliferation of RCC cells and promoted tumor progression (Figures S2C-E).
Fig. 4.
FUS interacted with FUS in RCC cells. (A) Co-IP experiments were performed to verify the interaction between KCMF1 and FUS. (B-C) Western blot results showed that increased KCMF1 expression led to elevated FUS expression levels. (D) To investigate whether the proteasome pathway is involved in the regulation of FUS expression by KCMF1, cells were treated with the proteasome inhibitor MG132. (E) The CCK-8 assay was used to explore the effect of the interaction between KCMF1 and FUS on RCC cell proliferation. (F-G) Colony formation assays were conducted to examine the combined effect of KCMF1 and shFUS on the colony-forming ability of RCC cells. (H-I) Wound healing assays were performed to evaluate the impact of the interaction between KCMF1 and FUS on RCC cell migration, and the wound closure percentage was calculated. Scale bar, 400 μm. (J-K) Transwell assays were used to confirm the effect of the interaction between KCMF1 and FUS on RCC cell migration and invasion. Scale bar, 400 μm. Data are presented as the mean ± SD (n = 3). Statistical significance was calculated by two tailed student’s t tests for B, C, and H, one-way ANOVA for panel G and K, and two-way ANOVA for panel D, E and I. * p < 0.05, ** p < 0.01, *** p < 0.001
To further validate this hypothesis, we generated stable KCMF1-overexpressing and FUS-knockdown ACHN and A498 cell lines using lentiviral transduction. Functional assays, including CCK-8 and colony formation assays, demonstrated that the interaction between KCMF1 and FUS is critical for promoting RCC proliferation (Fig. 4E-G). Furthermore, Transwell and wound-healing assays showed that KCMF1 overexpression significantly restored the migratory and invasive capacities of RCC cells, even upon FUS knockdown (Fig. 4H-K). Collectively, these findings highlight the functional importance of the KCMF1-FUS interaction in RCC progression and provide novel insights into the molecular mechanisms underlying RCC development.
KCMF1 promotes nuclear accumulation of FUS, thereby upregulating CENPT expression and driving tumorigenesis
Our findings demonstrate that KCMF1 overexpression significantly upregulates both mRNA and protein levels of CENPT, suggesting a potential regulatory relationship between these molecules (Fig. 5A, B). Western Blot results confirmed that, compared with adjacent normal renal tissues, the protein level of CENPT in RCC tissues was significantly increased (Figures S2F-G). Comprehensive functional assays (Fig. 5C-F) revealed that the KCMF1-CENPT interaction plays a pivotal role in promoting RCC proliferation. Notably, KCMF1 overexpression effectively rescued the impaired migration and invasion capacities of RCC cells caused by CENPT knockdown via shRNA. We hypothesize that KCMF1 upregulates CENPT expression through FUS mediation. Western blot analysis provided robust evidence that KCMF1 overexpression promotes FUS nuclear translocation, resulting in the increased nuclear accumulation of FUS (Fig. 5G).
Fig. 5.
KCMF1 promotes FUS nuclear translocation, then FUS enhances CENPT expression, thereby driving tumorigenesis. (A) The protein level of CENPT was examined by western blot after overexpression of KCMF1. (B) The mRNA level of CENPT was determined by qRT-PCR after overexpression of KCMF. (C-D) The proliferation of RCC cells was detected by CCK8 and colony formation assay after co-transfection of shCENPT with KCMF1overexpression. (E-F) Transwell assays confirmed that the interaction between KCMF1 and CENPT plays a critical role in promoting the proliferation, migration, and invasion of RCC cells. Scale bar, 400 μm. (G) Western blot analysis revealed that KCMF1 overexpression promoted the nuclear translocation of FUS. (H) RIP assay verifying the binding between FUS and CENPT-RNA. (I) After RNA pull-down, Western blotting was used to verify the specific association between FUS protein and CENPT-RNA. (J-K) The effect of FUS overexpression on CENPT expression was investigated, and the results showed that FUS overexpression significantly enhanced both the mRNA and protein levels of CENPT. (L) Colony formation assays demonstrated that FUS overexpression could reverse the tumor-suppressive effect induced by CENPT knockdown, suggesting a potential interaction between FUS and CENPT. (M-N) The impact of the FUS-CENPT interaction on RCC cell proliferation, migration, and invasion was studied. Scale bar, 400 μm. Data are presented as the mean ± SD (n = 3). Statistical significance was calculated by two tailed student’s t tests for A, B, G, H, J, and K, one-way ANOVA for D, F, L, and N, and two-way ANOVA for panel C.* p < 0.05, ** p < 0.01, *** p < 0.001
To elucidate this molecular mechanism, we performed RNA immunoprecipitation (RIP) assays, and subsequent RIP-Seq analysis revealed a direct interaction between CENPT mRNA and the FUS protein. Then, we performed RIP-qPCR and observed marked enrichment of CENPT-RNA using anti-FUS antibodies (Fig. 5H). The binding between CENPT-RNA and FUS was verified by independent RNA pulldown and immunoblot assays (Fig. 5I). Further analyses (Fig. 5J-K) demonstrated that FUS overexpression significantly enhanced both mRNA and protein expression levels of CENPT. As an RNA-binding protein primarily functioning within the nucleus, FUS augments CENPT expression by binding to CENPT mRNA, thereby driving tumorigenesis. The functional significance of the FUS-CENPT interaction was further confirmed by its ability to substantially enhance RCC cell proliferation, migration, and invasion. Importantly, FUS overexpression effectively reversed the tumor-suppressive effects induced by CENPT knockdown (Fig. 5L-N). Similarly, in the nude mouse xenograft model, we observed that FUS overexpression reversed the tumor-suppressive effect induced by CENPT knockdown (Fig. 6A-C).
Fig. 6.
FUS regulates RCC progression through the JNK pathway. (A-C) In vivo, FUS overexpression resulted in a faster tumor growth rate compared with the control group, and it also reversed the in vivo tumor-suppressive effect induced by CENPT knockdown. (D-I) Western blot analysis showed that FUS overexpression increased the levels of phosphorylated JNK protein, suggesting that FUS may exert its effects through the JNK pathway. (J) The CCK8 assay demonstrated that inhibiting the JNK pathway could attenuate the effects of FUS overexpression on RCC cells. (K-L) Transwell assays indicated that the use of the p-JNK inhibitor SP-600,125 suppressed p-JNK activity and effectively counteracted the pro-tumor effects mediated by FUS overexpression. Scale bar, 400 μm. Data are presented as the mean ± SD (in vitro assays, n = 3; in vivo assays, n = 5). Statistical significance was calculated by two tailed student’s t tests for G, H, and I, one-way ANOVA for B, and L, and two-way ANOVA for panel C and J. *p < 0.05, ** p < 0.01, *** p < 0.001, n.s., no significant differences
We also investigated whether the expression levels of FUS, KCMF1, and CENPT correlate with the clinical outcomes of RCC patients. Analysis of TCGA data revealed that high expression of KCMF1/FUS/CENPT was significantly associated with poor prognosis in RCC patients. Specifically, patients in the high-expression group exhibited shorter Overall Survival (OS) and Progress-Free Interval (PFI), higher metastasis rates, and a greater proportion of M1 stage disease (Figures S2H-K). Collectively, our study identifies the KCMF1/FUS/CENPT signaling axis as a critical regulator of RCC progression, providing novel insights into the molecular mechanisms underlying RCC pathogenesis.
FUS regulates RCC progression through the JNK pathway
We next investigated the regulatory mechanisms of FUS in RCC cells, we analyzed its role in activating the MAPK signaling pathway based on KEGG pathway analysis. Western blot analysis revealed that in FUS-overexpressing OSRC-2 and Caki-1 cells, the levels of phosphorylated JNK (p-JNK) were significantly increased, whereas total JNK protein levels remained unchanged. In contrast, no significant changes were observed in the protein levels of p38, p-p38, ERK1/2, or p-ERK1/2 (Fig. 6D-I). These findings suggest that FUS selectively regulates the MAPK/JNK signaling pathway to influence RCC progression.
To confirm the involvement of FUS in MAPK/JNK pathway regulation, we used the p-JNK inhibitor SP-600,125 to suppress p-JNK activity. Functional assays, including the CCK-8 assay, wound healing assay, and Transwell invasion assay, were conducted to evaluate whether inhibition of the JNK pathway could reverse the effects of FUS overexpression. The results demonstrated that treatment with SP-600,125 effectively counteracted the pro-tumorigenic effects mediated by FUS overexpression. These findings strongly support the hypothesis that FUS promotes the proliferation, migration, and invasion of RCC cells in vitro by activating the JNK pathway (Fig. 6J-L and 7A-B). Overall, this study underscores the critical role of the MAPK/JNK signaling pathway in FUS-mediated RCC progression and highlights its potential as a therapeutic target.
Fig. 7.
FUS promotes RCC tumorigenesis in vivo. (A, B) Wound healing assays showed that inhibiting the JNK pathway reduced the effects of FUS, and the wound closure percentage was calculated. Scale bar, 400 μm. (C-E) The effect of FUS on tumorigenesis in vivo was evaluated using a subcutaneous tumorigenesis assay in nude mice. The results showed that RCC tumors with FUS overexpression had significantly larger volumes and weights compared to the control group. (F-G) FUS enhances the proliferation of RCC cells and promotes tumor progression in vivo. However, the addition of the p-JNK inhibitor SP-600,125 effectively counteracted the tumor-promoting effects mediated by FUS overexpression in vivo. (H-I) The tumor volume and weight of RCC in the FUS overexpression group were both higher than those in the control group, and FUS overexpression could counteract the tumor-suppressive effect of the SP600125 inhibitor. Data are presented as the mean ± SD (in vitro assays, n = 3; in vivo assays, n = 5). Statistical significance was calculated by two tailed student’s t tests for D, one-way ANOVA for H, and two-way ANOVA for panel B, E and I. ** p < 0.01, *** p < 0.001
FUS promotes RCC tumorigenesis In vivo
The tumorigenic potential of RCC cells and the impact of FUS on tumor cell proliferation and tumorigenesis in vivo were evaluated using a subcutaneous tumorigenesis assay in nude mice. As shown in Fig. 7C-E, the tumor volume and weight of RCC tumors overexpressing FUS were significantly higher than those in the control group, demonstrating that FUS enhances RCC cell proliferation and promotes tumor progression in vivo. Furthermore, the addition of the p-JNK inhibitor SP-600,125 effectively mitigated the tumor-promoting effects driven by FUS overexpression in vivo (Fig. 7F-I). These findings provide robust evidence that FUS contributes to RCC tumorigenesis through activation of the JNK pathway.
Discussion
Significant progress has been made in the treatment of Renal Cell Carcinoma (RCC) in recent years, particularly in targeted therapy and immunotherapy. Despite these advancements, the survival rate of patients with RCC remains poor. The limited efficacy of conventional chemotherapy and radiotherapy in RCC is primarily attributed to drug resistance and the intrinsic resistance of renal cancer cells. Current molecular targeted therapies, which mainly focus on the VEGF and mTOR signaling pathways, show initial effectiveness. However, many patients with advanced RCC eventually develop resistance to these treatments, including targeted drugs and immunotherapies, resulting in poor long-term prognoses [17, 18]. While the pathogenesis of RCC remains incompletely understood, it is believed to be closely associated with genetic and chromosomal abnormalities [19]. Moreover, distant metastasis remains the leading cause of cancer-specific mortality in patients with RCC [20, 21]. These challenges underscore the urgent need for the development of novel therapeutic targets to improve treatment efficacy and patient outcomes.
FUS functions as an RNA-binding protein involved in numerous cellular processes, including gene transcription, RNA splicing, transport, and DNA repair [4]. Previous studies have demonstrated that FUS is associated with various cancers, and its role in specific cancer types may depend on the RNAs it interacts with within cancer cells [22]. For instance, the oncogenic mechanisms of FUS are mostly associated with its binding to lncRNAs (such as LINC00460) and circRNAs (such as circPTPN22), as exemplified by the LINC00460-FUS-MYC loop in breast cancer and the circPTPN22-FUS axis in gastric cancer [23, 24].In addition, researchers have also reported similar mechanisms underlying the progression of prostate cancer [25, 26]. Despite these findings, the role of FUS in RCC has been relatively understudied. Our study is the first to demonstrate that FUS can interact with KCMF1, translocate into the nucleus, bind to CENPT mRNA to stabilize its expression, thereby forming a novel regulatory chain of “KCMF1-Nuclear Accumulation of FUS-Upregulation of CENPT”. This mechanism, distinct from the classical interaction mode between FUS and other RNAs, represents a unique molecular regulatory pattern in RCC. It is known that the regulation of FUS expression is mostly associated with the ubiquitin-proteasome system. However, our study found that KCMF1 regulates FUS independently of the proteasome pathway, instead, it enhances FUS functional activity by promoting its nuclear translocation. This finding differs from previous research focusing on FUS degradation pathways.
As an RNA-binding protein, FUS dysregulation can drive tumor progression by affecting RNA metabolism. Our study demonstrated that KCMF1 overexpression directly promotes FUS overexpression and facilitates its nuclear translocation. Similar mechanisms have been reported in related studies [27]. The accumulation of FUS in the nucleus enhances its binding to CENPT mRNA, a finding corroborated by our RIP-sequencing results, which demonstrated that FUS can directly interact with CENPT mRNA. FUS increases CENPT mRNA stability, thereby elevating CENPT protein levels. As a core component of the centromere, CENPT overexpression induces chromosome segregation errors, leading to genomic instability—a hallmark of cancer [28]. Furthermore, in our previously unpublished research, we confirmed that CENPT promotes the progression of renal cell carcinoma by reducing Reactive Oxygen Species (ROS) levels and lipid peroxidation. Additionally, it would be valuable to analyze whether the functional interaction between FUS and CENPT is altered under different stress conditions, such as oxidative stress or nutrient deprivation. KCMF1 promotes the progression of RCC by regulating autophagy and ion channels, targeting KCMF1 may simultaneously interfere with multiple pro-cancer pathways, thereby enhancing therapeutic efficacy. As an E3 ubiquitin ligase, the enzymatic activity of KCMF1 could be targeted by specific inhibitors, inhibiting its activity may reduce the nuclear function of FUS and further block downstream pathways. As an RNA-binding protein, the nuclear localization of FUS depends on its interaction with KCMF1, which provides a theoretical basis for developing small-molecule inhibitors targeting the FUS-KCMF1 binding interface. Blocking the interaction between the two can inhibit the nuclear translocation of FUS, thereby attenuating its regulation of CENPT and the activation of the JNK pathway. Targeting CENPT can directly suppress the genomic instability mediated by it, and since the expression of CENPT in normal cells is strictly regulated, the abnormally high expression of CENPT in tumor cells may serve as a selective target. Based on the hierarchical regulatory relationship among molecules in the axis (KCMF1→FUS→CENPT), a combined targeting strategy may overcome the limitations of single-target intervention.
Metastasis is the leading cause of cancer-related deaths [29], with Epithelial-Mesenchymal Transition (EMT) and tumor angiogenesis playing critical roles in this process [30]. EMT endows cancer cells with enhanced migratory and invasive capabilities, thereby facilitating metastasis, while reduced apoptosis supports tumor cell survival and dissemination. Apoptosis occurs through two main pathways: the intrinsic (endogenous) pathway and the extrinsic (exogenous) pathway [31]. The Bcl-2 family of proteins is a key regulator of mitochondria-associated apoptosis, comprising pro-apoptotic proteins (e.g., Bax) and anti-apoptotic proteins (e.g., Bcl-2) [32]. EMT associated with cancer metastasis is classified as type 3 EMT [33], This process is often accompanied by the inhibition of apoptosis, as well as immunosuppression and resistance to anticancer drugs. These mechanisms involve multiple signaling pathways and complex molecular interactions [12, 13]. It is well established that the JNK pathway is involved in resistance to VEGF inhibitors [34, 35]. Resistance to mTOR inhibitors is often associated with EMT, and cancer cells in an EMT state typically exhibit stronger resistance to both VEGF and mTOR inhibitors [36]. In this study, we demonstrated that FUS activates JNK and induces EMT, both of which are key mechanisms underlying resistance to VEGF/mTOR inhibitors, suggesting that high FUS expression may lead to drug resistance. Therefore, we performed Western blot analysis on 6 clinical renal cell carcinoma specimens. The results showed that the FUS protein level in tumor tissues from sunitinib-resistant patients was significantly higher than that from drug-sensitive patients. Due to the limitations of the experimental cycle, we were unable to further test the drug resistance. However, based on the consistency between the FUS-JNK-EMT mechanism and the known drug resistance pathways, we put forward the hypothesis that FUS may mediate drug resistance, which will be the focus of future research.
The JNK signaling pathway, a member of the MAPK signaling family, plays a critical role in various cellular processes, including inflammation, apoptosis, cell differentiation, and proliferation [37]. Dysregulation or overactivation of JNK frequently contributes to tumorigenesis, progression, and invasion [38–42]. Building on this foundation, we conducted an in-depth investigation into the role of FUS in RCC and found that FUS significantly promotes RCC growth and metastasis through activation of the JNK signaling pathway. Our study revealed that overexpression of FUS markedly enhances the activity of p-JNK, a key protein in the JNK signaling pathway, demonstrating that JNK pathway regulation is a central mechanism by which FUS exerts its pro-tumorigenic effects. Therapeutic intervention targeting JNK activity has focused on inhibitors like SP600125, CEP-1347, and AS601245. Among these, SP600125—a compound of anthrapyrazolone—is the most extensively studied ATP-competitive JNK inhibitor [43]. It has shown therapeutic promise in addressing diseases associated with dysregulated JNK signaling pathways [44, 45]. Previous studies have found that SP600125 is well-tolerated in mice at appropriate doses and generally does not cause obvious systemic toxicity [46, 47]. In our study, inhibition of p-JNK activity using SP600125 effectively counteracted the pro-tumor effects induced by FUS overexpression, further confirming the pivotal regulatory role of FUS in JNK signaling. These findings strongly support FUS as a potential therapeutic target and prognostic marker in RCC and offer valuable insights for developing novel treatment strategies aimed at disrupting JNK pathway-mediated tumor progression.
However, this study still has certain limitations. These include the lack of in-depth analysis on the direct correlation between FUS expression levels and prognostic indicators, which to some extent restricts the comprehensive evaluation of its clinical application value. Meanwhile, this study mainly relies on classical RCC cell lines for mechanistic exploration and compared with patient-derived xenograft (PDX) models, it is difficult to fully reflect the heterogeneity of tumors and the complexity of the in vivo microenvironment. In addition, the sample size of each group in the nude mouse xenograft experiment is relatively limited. To address the above issues, subsequent studies will be improved systematically. This includes enrolling RCC patients with complete follow-up data, expanding the sample size of nude mouse xenograft experiments, and constructing RCC patient derived PDX models to verify the function of the KCMF1/FUS/CENPT axis in a tumor microenvironment that is closer to clinical reality.
Conclusion
This study elucidates the molecular mechanisms which the KCMF1/FUS/CENPT axis and JNK signaling pathway contribute to the pathogenesis of RCC, highlighting that FUS and its axis-related molecules hold promise as diagnostic biomarkers and combinatorial therapeutic targets for RCC. In summary, the FUS/KCMF1/CENPT axis not only influences patient prognosis but also may emerge as a novel target for overcoming drug resistance.
Supplementary Information
Below is the link to the electronic supplementary material.
Supplementary Material 1: Figure S1 FUS expression was increased in clinical samples and transfected renal cancer cells. (A-B) Basic clinical information of patients (sex, age, pathological subtype, and TNM stage) were analyzed. (C) The protein level of FUS in six renal cell carcinoma specimens from sunitinib-resistant and drug-sensitive patients was performed by western blot. (D) The protein level of FUS in renal cancer cells after transfection with FUS overexpression virus was determined by western blot. (E) The protein level of FUS in renal cancer cells after transfection with FUS knockdown virus was determined by western blot. Data are presented as the mean ± SD (n = 3). Statistical significance was calculated by two tailed student’s t tests for C, D, and E. * p < 0.05, ** p < 0.01, *** p < 0.001
Supplementary Material 2: Figure S2 Expression levels and prognostic significance of KCMF1, FUS, and CENPT in RCC. (A-B) The protein level of KCMF1 in RCC tissues compared with adjacent normal renal tissues was performed by western blot. (C-E) The in vivo effect of KCMF1 overexpression on tumor growth. (F-G) CENPT protein level in RCC tissues compared with adjacent normal tissues was assessed by western blot. (H) Kaplan-Meier analysis of the correlation between KCMF1 levels and progress free interval (PFI) in RCC samples. (I) High FUS expression correlates with shorter PFI and increased risk of progression. (J) High CENPT expression is strongly associated with reduced overall survival (OS) and increased risk of death, while low CENPT expression predicts better prognosis. (K) In patients with stage M1 tumors, high CENPT expression is associated with shorter survival and higher risk of death. Data are presented as the mean ± SD (in vitro assays, n = 3; in vivo assays, n = 5). Statistical significance was calculated by two tailed student’s t tests for B, D, and G, two-way ANOVA for E, Kaplan-Meier curves and log-rank tests for panel H, I, J, and K. * p < 0.05, ** p < 0.01, *** p < 0.001
Acknowledgements
None.
Abbreviations
- FUS
Fused in Sarcoma
- RCC
Renal Cell Carcinoma
- KCMF1
Potassium Channel Modulatory Factor 1
- CENPT
Centromere Protein T
- JNK
c-Jun N-Terminal Kinase
- ALS
Amyotrophic Lateral Sclerosis
- ANOVA
Analysis of Variance
- BCA
Bicinchoninic Acid
- Bax
Bcl-2-Associated X Protein
- Bcl-2
B-Cell Lymphoma 2
- ccRCC
Clear Cell Renal Cell Carcinoma
- PRCC
Papillary Renal Cell Carcinoma
- ChRCC
Chromophobe Renal Cell Carcinoma
- Co-IP
Co-Immunoprecipitation
- CRISPR-Cas9
Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR Associated Protein 9
- DAPI
4’,6-Diamidino-2-Phenylindole
- DMEM
Dulbecco’s Modified Eagle Medium
- ECL
Enhanced Chemiluminescence
- EMT
Epithelial-Mesenchymal Transition
- ERK1/2
Extracellular Signal-Regulated Kinase 1/2
- FBS
Fetal Bovine Serum
- GAPDH
Glyceraldehyde 3-Phosphate Dehydrogenase
- GPX4
Glutathione Peroxidase 4
- GSH
Glutathione
- HK2
Human Renal Epithelial Cell Line
- KEGG
Kyoto Encyclopedia of Genes and Genomes
- LINC00460
Long Intergenic Non-Protein Coding RNA 00460
- lncRNA
Long Non-Coding RNA
- MAPK
Mitogen-Activated Protein Kinase
- MG132
Carbobenzoxy-Leu-Leu-Leucinal
- miR-4687-5p
MicroRNA-4687-5p
- mTOR
Mammalian Target of Rapamycin
- MYC
MYC Proto-Oncogene, BHLH Transcription Factor
- NAT
Normal Adjacent Tissue
- NRF2/HO-1
Nuclear Factor Erythroid 2-Related Factor 2/Heme Oxygenase-1
- OSRC-2
Human Renal Cell Carcinoma Cell Line
- p-JNK
Phosphorylated c-Jun N-Terminal Kinase
- p-p38
Phosphorylated p38
- p38
p38 Mitogen-Activated Protein Kinase
- PD-L1
Programmed Death-Ligand 1
- PE-A
Phycoerythrin-Annexin V
- PI
Propidium Iodide
- PVDF
Polyvinylidene Fluoride
- qRT-PCR
Quantitative Real-Time Polymerase Chain Reaction
- RIP
RNA Immunoprecipitation
- ROC
Receiver Operating Characteristic
- ROS
Reactive Oxygen Species
- SDS-PAGE
Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis
- shRNA
Short Hairpin RNA
- SP-600125
Anthrapyrazolone Inhibitor
- TCGA
The Cancer Genome Atlas
- TNF-α
Tumor Necrosis Factor-Alpha
- VEGF
Vascular Endothelial Growth Factor
Author contributions
Z.Z. and Z.J. designed the study. Z.J., Y.Q., and R.Z. performed the experiments. K.Z., X.Y., and X.L. assisted in data and reference collection. H.Y., Z.L., and Z.J. analyzed the data and created the charts. Z.J., Y.L, and K.W. wrote the manuscript. Supervision was conducted by G.Z. and X.Y., and funding support was provided by K.W. and Z.Z. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by the National Natural Science Foundation of China (NO: 82200759, NO: 31971191 and NO: 82100557); the Qingdao Science and Technology Benefiting People Demonstration Project (NO: 24-1-8-smjk-4-nsh); and the Beijing Dadi Medical Charity Foundation (NO: DDYL-KY-20240327 and DDYL-KY-20240328).
Data availability
The transcriptome sequencing data of renal cell carcinoma analyzed in this study are available in the TCGA database.
Declarations
Institutional review board statement
This study protocol underwent review and approval by the ethics committee of the Affiliated Hospital of Qingdao University (Approval Number: QYFY WZLL 29838). This animal study was reviewed and approved by the Laboratory Animal Ethics Committee of the Affiliated Hospital of Qingdao University (Approval Number: AHQU-MAL20241113JZQ).
Informed consent
Written informed consent was obtained from all participants involved in this study.
Conflict of interest
The authors have no conflicts of interest to declare.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Zaiqing Jiang, Rui Zhang and Yixin Qi contributed equally to this work.
Contributor Information
Tianzhen He, Email: sailing198562@ntu.edu.cn.
Ke Wang, Email: wangke@qdu.edu.cn.
Zongliang Zhang, Email: zzl-qdfy@qdu.edu.cn.
References
- 1.Hsieh JJ, Purdue MP, Signoretti S, Swanton C, Albiges L, Schmidinger M, Heng DY, Larkin J, Ficarra V. Renal cell carcinoma. Nat Rev Dis Primers. 2017;3:17009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Ricketts CJ, De Cubas AA, Fan H, Smith CC, Lang M, Reznik E, Bowlby R, Gibb EA, Akbani R, Beroukhim R, et al. The cancer genome atlas comprehensive molecular characterization of renal cell carcinoma. Cell Rep. 2018;23:3698. [DOI] [PubMed] [Google Scholar]
- 3.Ingels A, Campi R, Capitanio U, Amparore D, Bertolo R, Carbonara U, Erdem S, Kara Ö, Klatte T, Kriegmair MC, et al. Complementary roles of surgery and systemic treatment in clear cell renal cell carcinoma. Nat Rev Urol. 2022;19:391–418. [DOI] [PubMed] [Google Scholar]
- 4.Levone BR, Lenzken SC, Antonaci M, Maiser A, Rapp A, Conte F, Reber S, Mechtersheimer J, Ronchi AE, Mühlemann O, et al. FUS-dependent liquid-liquid phase separation is important for DNA repair initiation. J Cell Biol. 2021;220. [DOI] [PMC free article] [PubMed]
- 5.Neumann M, Rademakers R, Roeber S, Baker M, Kretzschmar HA, Mackenzie IR. A new subtype of frontotemporal Lobar degeneration with FUS pathology. Brain. 2009;132:2922–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Ling SC, Polymenidou M, Cleveland DW. Converging mechanisms in ALS and FTD: disrupted RNA and protein homeostasis. Neuron. 2013;79:416–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Brunet MA, Jacques JF, Nassari S, Tyzack GE, McGoldrick P, Zinman L, Jean S, Robertson J, Patani R, Roucou X. The FUS gene is dual-coding with both proteins contributing to FUS-mediated toxicity. EMBO Rep. 2021;22:e50640. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Singh A, Choudhury SD, Singh P, Singh VV, Singh SN, Sharma A. KCMF1 regulates autophagy and ion channels’ function in renal cell carcinoma: a future therapeutic target. J Cancer Res Clin Oncol. 2023;149:5617–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hoevenaar WHM, Janssen A, Quirindongo AI, Ma H, Klaasen SJ, Teixeira A, van Gerwen B, Lansu N, Morsink FHM, Offerhaus GJA, et al. Degree and site of chromosomal instability define its oncogenic potential. Nat Commun. 2020;11:1501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Nössing C, Ryan KM. 50 years on and still very much alive: ‘Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics’. Br J Cancer. 2023;128:426–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Evan GI, Vousden KH. Proliferation, cell cycle and apoptosis in cancer. Nature. 2001;411:342–8. [DOI] [PubMed] [Google Scholar]
- 12.Chen HT, Liu H, Mao MJ, Tan Y, Mo XQ, Meng XJ, Cao MT, Zhong CY, Liu Y, Shan H, Jiang GM. Crosstalk between autophagy and epithelial-mesenchymal transition and its application in cancer therapy. Mol Cancer. 2019;18:101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ramesh V, Brabletz T, Ceppi P. Targeting EMT in cancer with repurposed metabolic inhibitors. Trends Cancer. 2020;6:942–50. [DOI] [PubMed] [Google Scholar]
- 14.Weston CR, Davis RJ. The JNK signal transduction pathway. Curr Opin Cell Biol. 2007;19:142–9. [DOI] [PubMed] [Google Scholar]
- 15.Cheng Y, Zhong X, Nie X, Gu H, Wu X, Li R, Wu Y, Lv K, Leung GP, Fu C, et al. Glycyrrhetinic acid suppresses breast cancer metastasis by inhibiting M2-like macrophage polarization via activating JNK1/2 signaling. Phytomedicine. 2023;114:154757. [DOI] [PubMed] [Google Scholar]
- 16.Wu CW, Wu YG, Cheng C, Hong ZD, Shi ZM, Lin SQ, Li J, He XY, Zhu AY. Interleukin-33 predicts poor prognosis and promotes renal cell carcinoma cell growth through its receptor ST2 and the JNK signaling pathway. Cell Physiol Biochem. 2018;47:191–200. [DOI] [PubMed] [Google Scholar]
- 17.Chen YW, Rini BI, Beckermann KE. Emerging targets in clear cell renal cell carcinoma. Cancers (Basel). 2022;14. [DOI] [PMC free article] [PubMed]
- 18.Li Y, Lih TM, Dhanasekaran SM, Mannan R, Chen L, Cieslik M, Wu Y, Lu RJ, Clark DJ, Kołodziejczak I, et al. Histopathologic and proteogenomic heterogeneity reveals features of clear cell renal cell carcinoma aggressiveness. Cancer Cell. 2023;41:139–e163117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Zhang X, Zhang G, Xu L, Bai X, Zhang J, Chen L, Lu X, Yu S, Jin Z, Sun H. Prediction of world health organization /International society of urological pathology (WHO/ISUP) pathological grading of clear cell renal cell carcinoma by Dual-Layer spectral CT. Acad Radiol. 2023;30:2321–8. [DOI] [PubMed] [Google Scholar]
- 20.Dizman N, Philip EJ, Pal SK. Genomic profiling in renal cell carcinoma. Nat Rev Nephrol. 2020;16:435–51. [DOI] [PubMed] [Google Scholar]
- 21.Obradovic A, Chowdhury N, Haake SM, Ager C, Wang V, Vlahos L, Guo XV, Aggen DH, Rathmell WK, Jonasch E, et al. Single-cell protein activity analysis identifies recurrence-associated renal tumor macrophages. Cell. 2021;184:2988–e30052916. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Swaminathan G, Rogel-Ayala DG, Armich A, Barreto G. Implications in cancer of nuclear micro RNAs, long non-coding RNAs, and circular RNAs bound by PRC2 and FUS. Cancers (Basel). 2024;16. [DOI] [PMC free article] [PubMed]
- 23.Yang L, Wang M, Wang Y, Zhu Y, Wang J, Wu M, Guo Q, Han X, Pandey V, Wu Z, et al. LINC00460-FUS-MYC feedback loop drives breast cancer metastasis and doxorubicin resistance. Oncogene. 2024;43:1249–62. [DOI] [PubMed] [Google Scholar]
- 24.Ma S, Xu Y, Qin X, Tao M, Gu X, Shen L, Chen Y, Zheng M, Qin S, Wu G, Ju S. RUNX1, FUS, and ELAVL1-induced circPTPN22 promote gastric cancer cell proliferation, migration, and invasion through miR-6788-5p/PAK1 axis-mediated autophagy. Cell Mol Biol Lett. 2024;29:95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wang R, Zhong J, Pan X, Su Z, Xu Y, Zhang M, Chen X, Chen N, Yu T, Zhou Q. A novel intronic circular RNA circFGFR1(int2) up-regulates FGFR1 by recruiting transcriptional activators P65/FUS and suppressing miR-4687-5p to promote prostate cancer progression. J Transl Med. 2023;21:840. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Wang N, Yu Y, Wang R, Chen Y, Tang J. mRNA-modified FUS/NRF2 signalling inhibits ferroptosis and promotes prostate cancer growth. Comput Math Methods Med. 2022;2022:8509626. [DOI] [PMC free article] [PubMed] [Retracted]
- 27.Wang MD, Yi L, Li Y, Xu R, Hu J, Hou DY, Liu C, Wang H. Homologous peptide foldamer promotes FUS aggregation and triggers cancer cell death. J Am Chem Soc. 2024;146:28669–76. [DOI] [PubMed] [Google Scholar]
- 28.Lengauer C, Kinzler KW, Vogelstein B. Genetic instabilities in human cancers. Nature. 1998;396:643–9. [DOI] [PubMed] [Google Scholar]
- 29.Steeg PS. Targeting metastasis. Nat Rev Cancer. 2016;16:201–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Jin X, Demere Z, Nair K, Ali A, Ferraro GB, Natoli T, Deik A, Petronio L, Tang AA, Zhu C, et al. A metastasis map of human cancer cell lines. Nature. 2020;588:331–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Bertheloot D, Latz E, Franklin BS. Necroptosis, pyroptosis and apoptosis: an intricate game of cell death. Cell Mol Immunol. 2021;18:1106–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Tsujimoto Y. Role of Bcl-2 family proteins in apoptosis: apoptosomes or mitochondria? Genes Cells. 1998;3:697–707. [DOI] [PubMed] [Google Scholar]
- 33.Xu W, Liu H, Liu ZG, Wang HS, Zhang F, Wang H, Zhang J, Chen JJ, Huang HJ, Tan Y, et al. Histone deacetylase inhibitors upregulate snail via Smad2/3 phosphorylation and stabilization of snail to promote metastasis of hepatoma cells. Cancer Lett. 2018;420:1–13. [DOI] [PubMed] [Google Scholar]
- 34.Wang M, Zhang C, Zheng Q, Ma Z, Qi M, Di G, Ling S, Xu H, Qi B, Yao C, et al. RhoJ facilitates angiogenesis in glioblastoma via JNK/VEGFR2 mediated activation of PAK and ERK signaling pathways. Int J Biol Sci. 2022;18:942–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Zhang Z, Neiva KG, Lingen MW, Ellis LM, Nör JE. VEGF-dependent tumor angiogenesis requires inverse and reciprocal regulation of VEGFR1 and VEGFR2. Cell Death Differ. 2010;17:499–512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Jewer M, Lee L, Leibovitch M, Zhang G, Liu J, Findlay SD, Vincent KM, Tandoc K, Dieters-Castator D, Quail DF, et al. Translational control of breast cancer plasticity. Nat Commun. 2020;11:2498. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Wu Q, Wu W, Fu B, Shi L, Wang X, Kuca K. JNK signaling in cancer cell survival. Med Res Rev. 2019;39:2082–104. [DOI] [PubMed] [Google Scholar]
- 38.Hammouda MB, Ford AE, Liu Y, Zhang JY. The JNK signaling pathway in inflammatory skin disorders and cancer. Cells. 2020;9. [DOI] [PMC free article] [PubMed]
- 39.Liu S, Chu B, Cai C, Wu X, Yao W, Wu Z, Yang Z, Li F, Liu Y, Dong P, Gong W. DGCR5 promotes gallbladder cancer by sponging MiR-3619-5p via MEK/ERK1/2 and JNK/p38 MAPK pathways. J Cancer. 2020;11:5466–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Miao H, Geng Y, Li Y, Tang S, Feng F, Li W, Li Y, Liu L, Zhang R, Qiu S, et al. Novel protein kinase inhibitor TT-00420 inhibits gallbladder cancer by inhibiting JNK/JUN-mediated signaling pathway. Cell Oncol (Dordr). 2022;45:689–708. [DOI] [PubMed] [Google Scholar]
- 41.Liu C, Qian X, Yu C, Xia X, Li J, Li Y, Xie Y, Gao G, Song Y, Zhang M, et al. Inhibition of ATM promotes PD-L1 expression by activating JNK/c-Jun/TNF-α signaling axis in triple-negative breast cancer. Cancer Lett. 2024;586:216642. [DOI] [PubMed] [Google Scholar]
- 42.Jin H, Liu C, Liu X, Wang H, Zhang Y, Liu Y, Li J, Yu Z, Liu HX. Huaier suppresses cisplatin resistance in non-small cell lung cancer by inhibiting the JNK/JUN/IL-8 signaling pathway. J Ethnopharmacol. 2024;319:117270. [DOI] [PubMed] [Google Scholar]
- 43.Davies C, Tournier C. Exploring the function of the JNK (c-Jun N-terminal kinase) signalling pathway in physiological and pathological processes to design novel therapeutic strategies. Biochem Soc Trans. 2012;40:85–9. [DOI] [PubMed] [Google Scholar]
- 44.Grynberg K, Ma FY, Nikolic-Paterson DJ. The JNK signaling pathway in renal fibrosis. Front Physiol. 2017;8:829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Lou L, Hu D, Chen S, Wang S, Xu Y, Huang Y, Shi Y, Zhang H. Protective role of JNK inhibitor SP600125 in sepsis-induced acute lung injury. Int J Clin Exp Pathol. 2019;12:528–38. [PMC free article] [PubMed] [Google Scholar]
- 46.Henderson-Redmond AN, Nealon CM, Davis BJ, Yuill MB, Sepulveda DE, Blanton HL, Piscura MK, Zee ML, Haskins CP, Marcus DJ, et al. c-Jun N terminal kinase signaling pathways mediate cannabinoid tolerance in an agonist-specific manner. Neuropharmacology. 2020;164:107847. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Urrutia A, Granado N, Gutierrez-Lopez MD, Moratalla R, O’Shea E, Colado MI. The JNK inhibitor, SP600125, potentiates the glial response and cell death induced by methamphetamine in the mouse striatum. Int J Neuropsychopharmacol. 2014;17:235–46. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary Material 1: Figure S1 FUS expression was increased in clinical samples and transfected renal cancer cells. (A-B) Basic clinical information of patients (sex, age, pathological subtype, and TNM stage) were analyzed. (C) The protein level of FUS in six renal cell carcinoma specimens from sunitinib-resistant and drug-sensitive patients was performed by western blot. (D) The protein level of FUS in renal cancer cells after transfection with FUS overexpression virus was determined by western blot. (E) The protein level of FUS in renal cancer cells after transfection with FUS knockdown virus was determined by western blot. Data are presented as the mean ± SD (n = 3). Statistical significance was calculated by two tailed student’s t tests for C, D, and E. * p < 0.05, ** p < 0.01, *** p < 0.001
Supplementary Material 2: Figure S2 Expression levels and prognostic significance of KCMF1, FUS, and CENPT in RCC. (A-B) The protein level of KCMF1 in RCC tissues compared with adjacent normal renal tissues was performed by western blot. (C-E) The in vivo effect of KCMF1 overexpression on tumor growth. (F-G) CENPT protein level in RCC tissues compared with adjacent normal tissues was assessed by western blot. (H) Kaplan-Meier analysis of the correlation between KCMF1 levels and progress free interval (PFI) in RCC samples. (I) High FUS expression correlates with shorter PFI and increased risk of progression. (J) High CENPT expression is strongly associated with reduced overall survival (OS) and increased risk of death, while low CENPT expression predicts better prognosis. (K) In patients with stage M1 tumors, high CENPT expression is associated with shorter survival and higher risk of death. Data are presented as the mean ± SD (in vitro assays, n = 3; in vivo assays, n = 5). Statistical significance was calculated by two tailed student’s t tests for B, D, and G, two-way ANOVA for E, Kaplan-Meier curves and log-rank tests for panel H, I, J, and K. * p < 0.05, ** p < 0.01, *** p < 0.001
Data Availability Statement
The transcriptome sequencing data of renal cell carcinoma analyzed in this study are available in the TCGA database.







