Investigating the effects of angelica sinensis on ovarian remodeling and egg production performance in molting laying hens

Abstract

Cage-induced molting is a management strategy used to help older laying hens achieve a second peak in egg production. Angelica sinensis (AS), a traditional Chinese herbal medicine, is known for its blood-nourishing and blood-activating effects. To explore the impact of AS on the molting process of laying hens and its underlying mechanisms, an experiment was conducted using 270 hens aged 70 weeks. These hens were divided into five groups: CON, IM, RIM, l-AS, and H-AS, with 18 hens per group and six replicates each. Molting was induced through feed restriction and controlled light exposure. Using network pharmacology and molecular docking, it was predicted that active compounds in AS, including Angelica A, carotenoids, and β-sitosterol, may interact with ERBB2 and ERBB4 receptors. Western blot analysis showed that AS increases the expression of ERBB2 and ERBB4, activating the EGFR downstream signaling pathways PI3K/AKT/mTOR/P70S6K and RAF/RAS/MEK/ERK. This activation promotes the proliferation of ovarian epithelial and granulosa cells and increases follicle numbers. In conclusion, adding AS to the diet during the late molting phase effectively supports ovarian tissue regeneration and follicle development, leading to improved egg production after molting. These results contribute to the development of enhanced molting techniques for laying hens.

Graphical abstract

Introduction

Molting is a conserved physiological process in birds, commonly marked by a temporary decline and subsequent recovery of the reproductive system (Huo et al., 2020). Artificially inducing molting can extend the laying period of hens (Bozkurt et al., 2016) and promotes the repair and regeneration of ovarian tissue (Wang et al., 2023a). Studies show that during molting, the ovaries of laying hens undergo functional regression, resulting in lower metabolic demands and reduced follicle recruitment. This adaptation helps prevent excessive depletion of ovarian tissue (Gongruttananun et al., 2017). After molting, the ovaries gradually regain function, leading to improved follicular development and a significant increase in egg production (Onbaşılar et al., 2020; Sah et al., 2018). Additionally, optimized molting methods support ovarian cell regeneration and boost the ovaries’antioxidant defenses and damage resistance, thereby prolonging the hens’peak laying period (Saeed et al., 2023). Therefore, understanding molting physiology and managing laying hens effectively is essential not only for enhancing their productivity but also for the artificial breeding of endangered wild bird species.

AS is extensively utilized in traditional Chinese medicine, particularly for regulating the female reproductive system (Wei et al., 2016). Research has shown that AS is rich in bioactive compounds such as ferulic acid, coumarin, and various volatile oils, which promote ovarian regeneration through multiple pathways (Ping et al., 2023). The components of AS have been found to improve blood circulation and enhance nutrient delivery to ovarian tissues, potentially aiding the repair of damaged ovarian cells. Recently, network pharmacology has emerged as an innovative research method that deepens scientific insight into the mechanisms of traditional Chinese medicine (TCM) (Niu et al., 2018). This technique is especially useful for clarifying how TCM operates within complex biological systems, enabling a more systematic study of the in vivo effects of TCM ingredients (Zheng et al., 2019).

Studies have shown that the bioactive components of AS possess strong anti-inflammatory and antioxidant effects (Chen et al., 2023; Lang et al., 2018). Specifically, Levistolid A protects ovarian cells by reducing oxidative stress and inflammation in ovarian tissue (Sriraman et al., 2015), while also activating the PI3K/AKT and MAPK signaling pathways. β-sitosterol offers protective benefits by regulating estrogen receptor-related signaling as well as the PI3K/AKT and Wnt/β-catenin pathways (Banno et al., 2005). Sitogluside activates the ERK/MAPK pathway in ovarian cells (Wang et al., 2023b). Meanwhile, stigmasterol enhances ovarian responsiveness to hormonal signals by promoting ovarian cell proliferation and modulating the estrogen receptor pathway through activation of the PI3K/AKT and ERK1/2 signaling pathways (Guo and Ding, 2018). Together, these bioactive substances aid in repairing damaged ovarian tissue, delay ovarian aging, and improve regenerative abilities, thereby supporting overall ovarian health.

Human epidermal growth factor receptor 2 (ERBB2) and human epidermal growth factor receptor 4 (ERBB4) are key members of the receptor tyrosine kinase family (Tao et al., 2014; Wang et al., 2024). Their engagement with the epidermal growth factor (EGF) signaling pathway triggers downstream signaling cascades (Hsieh et al., 2009), especially the MAPK/ERK and PI3K/Akt pathways (Freimann et al., 2004), which control vital cellular functions such as proliferation, differentiation, and survival (Tománek et al., 2008). These signaling pathways play a crucial role in ovarian regeneration in laying hens. Recent studies have revealed that ERBB2 and ERBB4 significantly contribute to ovarian regeneration and the preservation of ovarian function (Wang et al., 2017). Overexpression of ERBB2 has been found to promote granulosa cell proliferation and inhibit apoptosis (Chen et al., 2021), while ERBB4 is important for follicular maturation and sustaining follicular function (Veikkolainen et al., 2020). Precisely regulating ERBB2 and ERBB4 activity could enhance follicular development and maturation, potentially prolonging the laying cycle and boosting reproductive performance in laying hens.

Molting is associated with enhanced ovarian function, which prolongs the laying period of hens and improves both egg production and quality. Network pharmacology, a new interdisciplinary method combining bioinformatics and systems biology, allows for the systematic identification of multi-target mechanisms of traditional Chinese medicine ingredients by integrating pharmacological data and analyzing molecular networks. This study uses network pharmacology to comprehensively explore the bioactive components of AS and their possible interactions with targets involved in ovarian regeneration (Wang et al., 2024). The goal is to reveal the molecular mechanisms involved and to develop new theoretical models supported by evidence-based approaches for managing molting in poultry production.

Materials and methods

Ethics Statement

The experiment received approval from the Animal Welfare and Ethics Committee at Northeast Agricultural University (NEDAUEC20240332). All animal experimentation adhered to the ARRIVE guidelines. Preparation of AS involved the grinding of its roots, which were procured from Guishengtang in Harbin, China, using an automatic grinder with a mesh size of 100. Component analysis of AS (Supplementary materials). Following the grinding process, the resulting material was uniformly incorporated into the feed for laying hens.

Experimental Design and Management

A total of 270 healthy Hyland brown laying hens, all 70 weeks old and with similar body weights, were randomly divided into five groups: a Control group (CON), a molting group (IM), a molting recovery group (RIM), a low-dose AS group (10 g/kg AS), and a high-dose AS group (20 g/kg AS). Each group included six replicates, with 15 hens per replicate. The hens were housed individually in cages measuring 400 mm × 380 mm × 360 mm. After one week of environmental acclimation to the laboratory, the fasting-induced molting method was applied as detailed in Table S1. Each hen was fed 100 g of feed twice daily at 9 a.m. and 5 p.m., with the feed composition provided in Table 1. Lighting was set for 16 h per day (6 a.m. to 10 p.m.). Three days before molting, the light duration was reduced by 2 h daily, and for 12 days after molting, lighting was limited to 8 h per day (9 a.m. to 5 p.m.) at temperatures between 26 and 28 °C. During the molting recovery phase, light exposure was gradually increased by 2 h each day over three days before feeding resumed, continuing to increase by 2 h daily until reaching 16 h per day. The hens reached their peak secondary laying phase on day 28. Throughout the experiment, room temperature was maintained between 23 and 25 °C, with humidity levels kept between 60 % and 70 %.

Table 1.

Composition and calculated nutrient content (as-fed).

Items	No choline chloride basal diet
Igredients, %
Corn grain	33.65
Soybean meal, 43 % Crude protein	6.5
Soybean meal, 46 % Crude protein	13.65
Corn gluten powder	16.50
Corn gluten meal	1.50
Wheat middling	24.00
Limestone	1.53
Monocalcium phosphate	1.20
DL-Methionine	0,15
L-Lysine HCL	0.30
Premix	1.02
Total	100.0
Calculated nutrient composition, %
Metabolizable energy, MJ/kg	11.28
Crude protein	18,50
Calcium	1.00
Total phosphorus	0.60
Available phosphorus	0.42
Lysine	0.87
Methionine + Cysteine	0.68

Premix providing per kg of diet: vitamin A (retinyl acetate), 2,700 IU; vitamin D3 (cholecalciferol), 3,400 IU; vitamin E (dl-α-tocopherol acetate), 10 mg; vitamin K₃ (menadione), 0.5 mg; vitamin B₁ (thiamine), 2.0 mg; vitamin B₂ (ribofavin), 5 mg; niacin, 30 mg; d-pantothenic acid, 10 mg; vitamin B₆ (pyridoxine-HCl), 3 mg; vitamin B₁₂ (cyanocobalamine). 7 ug; folic acid, 0.5 mg; biotin, 0.1 mg; Fe (FeSO₄.H₂O), 80 mg; Cu (CuSO₄,5H₂O), 8 mg; Zn (ZnO), 80 mg; Mn (MnSO₄), 80 mg; I (KI), 0.7 mg; Se (Na₂O₃Se), 0.3 mg.

Collection and processing of tissue samples

At the end of the experiment, six hens were randomly chosen from each group. Blood was quickly drawn from the wing vein and transported to the laboratory, where it was left to clot at 37°C for 2 h. Afterward, the serum was separated by centrifuging at 4°C at 4000 × g for 15 min. The serum samples were then stored at -20°C for later analysis. Euthanasia was carried out 3 h after egg-laying, and the ovaries and follicles were collected under controlled low-temperature conditions.

Determination of production indicators for laying hens

Determination of laying hen body weight and egg production rate

Each group of hens underwent daily inspections, and their weights were measured on days 0, 7, 14, 21, and 28. Furthermore, the time period during which egg-laying stopped after feeding, along with the time when egg-laying resumed post-feeding, was carefully recorded. Eggs were gathered twice daily, and the average laying rate for each group was determined.

Determination of Egg quality in laying hens

after the experimental phase, 10 eggs from each group were randomly chosen for quality evaluation. The weights of the yolk and eggshell were measured using an electronic analytical balance. The height of the egg white and the Haugh Unit were evaluated with an egg quality analyzer. Eggshell strength was measured using an eggshell strength analyzer. Once the eggshells were removed, the blunt end, sharp end, and equatorial region of the eggs were measured with a caliper, and average values for each group were calculated. Furthermore, horizontal and vertical diameters were recorded to determine the surface area and shape index.

Network pharmacology analysis of AS

Compounds linked to AS were gathered and screened using online databases, and their potential targets were predicted. Next, data concerning ovarian regeneration were systematically collected and analyzed. The common targets were subjected to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses. Key targets were identified through protein-protein interaction (PPI) network analysis. Molecular docking was conducted to assess the interactions between the key targets involved in ovarian regeneration and the bioactive compounds of AS. All procedures were carried out according to established protocols. (Zhenlei, et al., 2023).

Serum Antioxidants and Reproductive Hormones

Serum levels of total antioxidant capacity (T-AOC, A015-2-1), total superoxide dismutase (T-SOD, A001-1-2), malondialdehyde (MDA, A003-1-2), catalase (CAT, A007-1-1), glutathione (GSH, A006-2-1), and glutathione peroxidase (GSH-Px, A007-1) were measured using biochemical reagent kits according to the manufacturer's protocols. Furthermore, serum concentrations of luteinizing hormone (LH, JM-00809C1), follicle-stimulating hormone (FSH, JM-09212C1), progesterone (P₄, JM-00887C1), estradiol (E₂, JM-00859C1), and anti-Müllerian hormone (AMH, JM-00819C1) were assessed using commercial sandwich ELISA kits from JingMei Biotech (Jiangsu, China).

Detection of ovarian follicles in laying hens

Six hens from each group were randomly chosen. Their ovarian follicles were removed and placed in sterile Petri dishes. The follicles were categorized and counted according to size in descending order: preovulatory follicles (POF; larger than 10 mm), small yellow follicles (SYF; 8 to 10 mm), large white follicles (LWF; 6 to 8 mm), and small white follicles (SWF; 2 to 4 mm). The diameters of the F1 to F3 follicles were measured with digital calipers.

Ovarian tissue HE staining

The ovarian tissue is fully excised and transferred into PBS, then fixed in 4 % paraformaldehyde. After 24 h of fixation, the tissue undergoes dehydration, embedding, and sectioning with an automatic dehydrator. Once the tissue sections are deparaffinized, they are stained with hematoxylin, differentiated using hydrochloric alcohol, and thoroughly rinsed with tap water. The sections are then returned to a blue color by immersing them in water at 50°C or in a diluted alkaline solution until the blue tint appears. Following this, the samples are rinsed again with tap water, placed in 85 % alcohol, and stained with eosin. The sections are subsequently dehydrated through an ethanol series, cleared with xylene, and finally mounted using neutral gum. Images are captured with a Leica microscope, and the observations and analyses are performed using Image-J software.

Immunofluorescence analysis

To assess the impact of molting on ovarian and follicular regeneration and development, we analyzed the expression of ERBB2 and ERBB4 in the ovaries, SWF, and F1 follicles of hens through immunofluorescence. After standard deparaffinization of tissue sections, the samples were treated with EDTA antigen retrieval solution and heated in a microwave at high power until boiling. They were then cooled to room temperature for 5 min, reheated for another 5 min at high heat, and allowed to cool naturally to room temperature. Next, a blocking solution containing goat serum was applied, and the sections were incubated at 37°C for 30 minutes before removing any excess liquid. The primary antibody solution was then added, and the sections were incubated at room temperature for 2 h, followed by three 5-min washes with PBS. Afterwards, DyLight 488/594 fluorescently labeled goat anti-rabbit IgG (diluted 1:1000) was applied, and the sections were incubated at 37°C for 1 hour, followed by three additional 5-min PBS washes. Finally, the sections were stained with DAPI for 5 min at room temperature, washed three times with PBS, mounted with anti-fade medium, and imaged using a fluorescence microscope. The images were subsequently analyzed using Image-J software.

Ovarian regeneration pathway verification

Western blot analysis

Precisely weigh 0.1 g of ovarian tissue from each group and grind it at 4°C for 1 min. Then, centrifuge the samples at 4°C and 12,000 rpm for 10 min to collect the supernatant. To aid protein extraction, add RIPA buffer containing protease and phosphatase inhibitors to the supernatant. Measure the protein concentration using a BCA assay kit (Solarbio, PC0020, Beijing, China). Next, separate the proteins by SDS-PAGE gradient electrophoresis and transfer them onto PVDF membranes via electrophoresis. Block the membranes with 5 % non-fat milk for 2 h, then incubate overnight with the primary antibody at the dilution indicated in Table S2. Afterward, incubate the membranes with a goat anti-rabbit secondary antibody diluted 1:10,000. Detect signals using an ECL chemiluminescent substrate in a chemiluminescence detection system (Tanon, Shanghai, China), and analyze band intensities with ImageJ software to determine the relative expression levels of the target protein.

qRT-PCR assay

The RNA was extracted from ovarian tissue using the Meiji RNA extraction kit (DP431, Magen Biotech, Shanghai, China). The concentration and purity of total RNA were assessed using a UV spectrophotometer, and then reverse-transcribed into cDNA (R1081, GDSbio, Guangzhou, China). Detection was performed using the quantitative real-time PCR system (Bioer Technology, Hangzhou, China) reaction program. Relative gene expression levels were calculated using the 2^−ΔΔCt method, with ACTB as the internal reference gene. Primers were designed using Primer Premier 5 software, ensuring a product score >98. The primer sequences’ positions are detailed in Table 2. All reactions were performed in triplicate, and results were expressed as mean ± standard error of the mean (SEM).

Table 2.

Primers used for detection of ovarian regeneration genes.

Gene	Orientation	Primer (5′→3′)	Accession no.	Pb
PI3K	Forward	CTCCTCTTAATCCTGCTCATCAACTGG	NM_001004410.2	257
	Reverse	ACAACCGTAAGGCAACATCCGAAG
AKT	Forward	ACTCACGGCATCCATTCTTAACAGC	NM_001396387.1	376
	Reverse	GCACGACCATAGTCATTATCCTCCAG
MTOR	Forward	CTAACGCTCCACGCCTCATTCG	XM_052691756.1	327
	Reverse	AGTTCAGAAGCACCTCCAGTAAAGTTG
P70S6K	Forward	AATCTTGATGAGGAGTGGGCATAATCG	NM_001030721.2	281
	Reverse	AGTTAATGTGTCTGAAGAACGGGTGAG
RAS	Forward	GGTGGAGTTGGCTTTGTGGGATAC	NM_204704.2	234
	Reverse	TCTCGTCTTGTGTGCTCGTCATTC
RAF	Forward	ACCGACCATTGTCCAGCAGTTTG	NM_205307.2	280
	Reverse	AATCAAGGAGGCAGCATCAGTGTTC
MEK	Forward	TGGAGAACTTGGGCGAGATGGG	NM_001297555.2	393
	Reverse	GCAGGATGTTGGAGGGCTTGAC

Statistical analysis

All data from this experiment were analyzed using SPSS software (version 10.0, SPSS, Chicago, IL). Protein bands and slices were analyzed with ImageJ software. Quantitative results are presented as mean ± SEM. Statistical comparisons were conducted using one-way ANOVA. Different letter superscripts between groups denote significant differences (P < 0.05).

Results

Egg-laying performance

Fig. 1 A illustrates changes in body weight among laying hens. The CON group showed no significant weight changes over time. In contrast, the RIM, l-AS, and H-AS groups experienced a significant weight loss by day 7, reaching about 25-30 % reduction by day 14, meeting the molting criteria. Body weight then increased notably by day 21, and by day 28, weights in all groups were similar to those in the CON group. Fig. 1 B displays egg production rates. The CON group had a slight decline in egg production over 28 days. The RIM, l-AS, and H-AS groups stopped laying eggs by day 7 but gradually resumed production by day 14, with l-AS and H-AS groups recovering to over 50 % of their initial rates. By day 21, these groups surpassed the CON group in egg production, and by day 28, their rates stabilized above 90 %, with the H-AS group showing significantly higher production than the others. Egg quality after molting is shown in Fig. 1 C and Table 3. The CON group had a higher rate of eggshell discoloration at 43.24 %. After molting, eggshell discoloration decreased significantly in all groups, with the H-AS group having only 1.52 %. Additionally, the l-AS and H-AS groups significantly outperformed the CON group in several egg quality measures, demonstrating that these treatments greatly improved egg quality, especially in terms of egg weight, eggshell thickness, albumen height, breakage rate, and eggshell contamination.

Fig. 1.

The effect of adding AS to feed on the production performance of laying hens. (A) Changes in body weight, (B) Changes in egg production rate, (C) Changes in egg quality. Note: Different letters represent significant differences (P < 0.05).

Table 3.

Egg quality assessment results.

Items	CON	RIM	L-AS	H-AS
Egg weight (g)	57.4 ± 1.13d	59.1 ± 1.54 c	62.2 ± 1.42 b	63.2 ± 1.24 a
Eggshell weight (g)	4.6 ± 0.22 b	4.97 ± 0.24 b	5.55 ± 0.23 a	5.74 ± 0.26 a
HU	71.32 ± 3.11 d	78.32 ± 3.21 c	81.66 ± 3.83 b	85.16 ± 3.43 a
Albumen height (mm)	5.64 ± 0.21 d	6.14 ± 0.24 c	7.13 ± 0.18 b	7.41 ± 0.18 a
Yolk weight (g)	9.12 ± 0.24 c	10.39 ± 0.32 b	11.14 ± 0.37 a	11.98 ± 0.27 a
Albumen weight (g)	5.04 ± 0.32 c	5.84 ± 0.23 b	6.05 ± 0.24 b	6.57 ± 0.33 a
Eggshell strength (N)	27.47 ± 0.88 c	30.57 ± 0.88 b	32.67 ± 0.79 a	34.06 ± 1.45 a
Eggshell thickness (mm)	0.34 ± 0.02 c	0.38 ± 0.01 b	0.41 ± 0.01 ab	0.43 ± 0.02 a
Broken egg rate (%)	14.46 ± 0.75 d	1.14 ± 0.04 c	0.88 ± 0.03 b	0.59 ± 0.02 a
Eggshell stain rate (%)	43.26 ± 0.85 d	3.25 ± 0.18 c	2.39 ± 0.14 b	1.51 ± 0.03 a
Egg Shape Index	0.78 ± 0.03 b	0.75 ± 0.02 ab	0.74 ± 0.02 ab	0.72 ± 0.03 a

Note: Different letters represent significant differences (P < 0.05).

Serum reproductive hormone levels and antioxidant capacity

The results for serum antioxidant levels are presented in Fig. 2. Compared to the CON group, the IM group showed a significant decrease in CAT, T-AOC, SOD, and GSH-Px levels (P < 0.05), along with a notable increase in MDA levels (P < 0.05). Conversely, the RIM, l-AS, and H-AS groups had significantly higher CAT levels than the CON group (P < 0.05), with the H-AS group displaying levels significantly greater than both the l-AS and RIM groups. For SOD and T-AOC, the H-AS group exhibited significantly higher levels than the l-AS and RIM groups, while the l-AS group also had significantly higher levels than the RIM group. Regarding GSH-Px, the H-AS group’s levels were significantly higher than those of the RIM group, but not significantly different from the l-AS group. The H-AS group had significantly lower MDA levels compared to both the l-AS and RIM groups, and the l-AS group’s MDA levels were also significantly lower than those of the RIM group. Overall, the H-AS group showed the highest antioxidant activity, indicating a marked improvement in antioxidant capacity. The l-AS group ranked second in antioxidant indicators, significantly outperforming the RIM group. Additionally, MDA levels in both the H-AS and l-AS groups were significantly reduced compared to the RIM and CON groups, suggesting enhanced antioxidant stress resistance in laying hens after molting, with both H-AS and l-AS treatments effectively alleviating oxidative stress. As depicted in Fig. 3, the IM group had significantly lower levels of AMH, E₂, FSH, LH, and P₄ compared to the CON group (P < 0.05). In contrast, the RIM, l-AS, and H-AS groups showed significantly increased AMH levels relative to the CON group (P < 0.05), with particularly notable rises in the H-AS and l-AS groups. For E₂, both l-AS and H-AS groups had significantly higher levels than the RIM group. Furthermore, the H-AS group exhibited significantly elevated FSH and LH levels compared to both the l-AS and RIM groups. Regarding P₄, the H-AS and l-AS groups had significantly higher levels than the RIM group. Overall, these findings indicate that both H-AS and l-AS groups significantly increased the levels of all measured hormone indicators, suggesting that adding Angelica to the feed after molting can enhance the reproductive hormone levels in laying hens.

Fig. 2.

Effects of adding AS on serum oxidative stress in laying hens during the late molting period. (A) CAT content, (B) SOD content, (C) GSH-PX content, (D) T-AOC content, (E) MDA content. Note: Different letters represent significant differences (P < 0.05).

Fig. 3.

Effects of adding AS to the feed on serum reproductive hormones. (A) AMH levels, (B) E₂ levels, (C) FSH levels, (D) LH levels, (E) P₄ levels. Note: Different letters represent significant differences (P < 0.05).

The effect of adding AS to feed on ovarian development

Fig. 4 A illustrates that the IM group showed follicular atrophy along with yolk absorption. Compared to the CON group, the RIM, l-AS, and H-AS groups demonstrated a statistically significant increase in both the number and size of follicles, as depicted in Fig. 4 B and summarized in Table 4. Notably, these groups exhibited a significant rise in the count of graded follicles relative to the CON group, with the H-AS group showing the greatest increase, especially in primary follicles (SWF, LWF, SYF). According to Table 5, the weight and diameter of graded primary follicles (F1–F3) were significantly higher in all experimental groups compared to the CON group. Fig. 4 C reveals that the CON group had multiple follicles at different developmental stages, marked by follicular atresia and degeneration, along with a sparse tissue structure. The IM group experienced a significant decrease in follicle numbers, with most follicles undergoing atresia and degeneration. In contrast, ovarian tissue in the RIM, l-AS, and H-AS groups became denser, showing an increase in primary follicles, larger graded follicles, and improvements in both follicle weight and diameter. The H-AS and l-AS groups showed significant enhancements compared to the RIM group. These results indicate that hens in the CON group had poor ovarian development, characterized by a notable decline in ovarian function during molting, leading to follicular atresia and deformation. After molting, ovarian function appeared to recover, as shown by increased ovarian tissue cellularity, a significant rise in primary follicle numbers, better development of graded follicles, and overall improved ovarian function—especially in the AS-supplemented groups, which achieved the best results.

Fig. 4.

Effect of adding AS to the feed on the ovarian and follicular development of laying hens. (A) In vivo observation of follicles. (B) In vitro observation of pre-grading and grading follicles. (C) Ovarian HE staining results (15 ×). Scale:100 μm. The blue arrows indicate follicle atresia, and the red arrows indicate follicle deformation. Note: Different letters represent significant differences (P < 0.05).

Table 4.

Results of follicle count.

Group	Small white follicle	Large white follicle	Small yellow follicle	Follicular Hierarchy
CON	8.33±0.58 b	6.33±0.58 c	4.33±0.58 b	3.67±0.58 b
IM	5.00±1.00 c	4.33±0.58 d	2.67±1.15 c	0
RIM	9.67±1.15 ab	7.67±0.58 b	5.33±0.58 ab	4.33±0.58 ab
L-AS	10±1.00 ab	10.67±0.58 a	5.67±0.58 ab	5 ± 0.00 a
H-AS	11±1.00 a	11.67±1.08 a	6 ± 0.52 a	5 ± 0.45 a

Note: Different letters represent significant differences (P < 0.05).

Table 5.

Diameter and weight of Follicular Hierarchy (F1-F3).

Follicular Hierarchy	Group	Weight (g)	Diameter (cm)
F1	CON	13.13±1.02 c	3.10±0.16 c
	RIM	16.31±1.83 b	3.50±0.22 b
	L-AS	18.15±0.91 ab	3.89±0.13 a
	H-AS	19.19±1.05 a	4.07±0.20 a
F2	CON	10.07±0.18 d	2.20±0.13 c
	RIM	12.75±0.21 c	2.49±0.12 b
	L-AS	14.27±0.16 b	2.83±0.07 a
	H-AS	14.74±0.20 a	3.02±0.12 a
F3	CON	7.90±0.13 d	2.02±0.08 d
	RIM	9.16±0.15 c	2.65±0.06 c
	L-AS	10.91±0.24 b	2.87±0.11b
	H-AS	11.40±0.17 a	3.05±0.078 a

Note: Different letters represent significant differences (P < 0.05).

Network pharmacology analysis and visualization of molecular docking

To clarify how AS extracts promote angiogenesis in preovulatory follicles (F1-F3), a network pharmacology approach was employed. First, the main active components of AS were determined to be angelolactone A, carotenoid e, β-sitosterol, and stigmasterol, with their validity supported by existing literature. Next, 190 potential targets were predicted using the SwissTargetPrediction database (Fig. 5 A). Additionally, a search in GeneCards and OMIM databases identified 1,406 proteins related to angiogenesis, from which 101 overlapping targets were found with the predicted ones (Fig. 5 B). Enrichment analysis of these targets showed that KEGG pathway analysis significantly linked them to EGFR signaling pathways (Fig. 5 C-D). To pinpoint key hub targets, a network analysis of the 101 overlapping targets was conducted using Cytoscape and Centiscape, applying screening criteria of DC ≥ 21, CC ≥ 0.0119, and BC ≥ 30.11, resulting in the construction of a hub target network (Fig. 5 E). By integrating this hub target network with KEGG enrichment results and angiogenesis correlation data, ERBB2 and ERBB4 were identified as crucial hub targets for further validation.

Fig. 5.

Network pharmacology exploration of AS targets in angiogenesis. (A) AS active ingredient targets. (B) 101 intersection genes of Angelica sinensis targets and angiogenesis. (C) KEGG pathway enrichment analysis of 101 crossed gene targets. (D) GO enrichment analysis of 101 crossed gene targets. (E) The topology of the PPI network shows the core objective of this study.

Molecular docking was employed to simulate the binding interactions of Levistolid A, Sitogluside, β-sitosterol and Stigmasterol with the ERBB2 and ERBB4 proteins. The optimal binding configurations were identified within the binding pockets. Structural analysis showed, the lowest binding energies for the ERBB2 protein with Levistolid A, Sitogluside, beta-sitosterol, and Stigmasterol were found to be 8.56kcal/mol, -7.40 kcal/mol, 9.94kcal/mol and -8.83 kcal/mol, respectively (Fig. 6 A-D). For the ERBB4 protein, the corresponding lowest binding energies with Levistolid A, Sitogluside, beta-sitosterol, and Stigmasterol were -5.65kcal/mol, 5.97 kcal/mol, -6.02kcal/mol and-6.77 kcal/mol, respectively (Fig.s 6 E-H). β-Sitosterol formed hydrogen bonds with the amino acid residues ILE-767 of the ERBB2 protein and LYS-128 and ASN-127 of the ERBB4 protein. Levistolid A formed hydrogen bonds with the residues ARG-713, LEU-711, and ALA-710 of the ERBB2 protein, as well as ARG-70 and HIS-45 of the ERBB4 protein. Sitogluside interacts with the residues ARG-814, ARG-811, PHE-918, and THR-917 of the ERBB2 protein, and VAL-122 and ARG-89 of the ERBB4 protein through hydrogen bonding. Stigmasterol can form hydrogen bonds with MET-801 of the ERBB2 protein and SER-159 and LYS-128 of the ERBB4 protein. These hydrogen bonds may facilitate the formation of stable and tightly bound complexes between the ligands and the respective proteins.

Fig. 6.

Molecular docking mode diagram. (A-D) ERBB2 is coupled to the docking pocket with active molecules Levistolid A, Sitogluside, beta-sitosterol, and Stigmasterol. (E-H) ERBB4 is coupled to the docking pocket with the active molecules Levistolid A, Sitogluside, beta-sitosterol and Stigmasterol. Blue is the protein structure, the blue-green color is the bound molecule, the yellow color is the bound amino acid, and the yellow dashed line indicates the hydrogen bond interaction force that promotes the binding of the molecule to the active site.

AS promotes ovarian regeneration by activating PI3K/AKT/mTOR/P70S6K and RAF/RAS/MEK/ERK pathways

As illustrated in Fig.s 7 A-C, compared to the CON group, the levels of ERBB2 and ERBB4 in ovarian stromal cells were significantly decreased in the IM group (P < 0.05). In contrast, these levels were significantly elevated in the RIM, l-AS, and H-AS groups, with the l-AS and H-AS groups showing notably higher expression than the RIM group (P < 0.05), particularly the H-AS group, which exhibited the highest expression. To assess the impact of adding AS to the diet during the molting period of laying hens on ovarian regeneration, we examined the expression of proteins involved in the ovarian stromal cell regeneration pathway via western blot analysis. ERBB2 and ERBB4 are members of the ERBB receptor tyrosine kinase family that activate downstream signaling through dimerization, thereby triggering the PI3K/AKT/mTOR/P70S6K and RAF/RAS/MEK/ERK pathways. As shown in Figs. 7 D-H, phosphorylation levels of PI3K, AKT, mTOR, and P70S6K were significantly reduced in the IM group compared to the CON group (P < 0.05), whereas these levels were significantly increased in the RIM, l-AS, and H-AS groups (P < 0.05). Moreover, protein expression in the H-AS group was higher than in the RIM group (P < 0.05), with the l-AS group also exceeding the RIM group (P < 0.05). The RAF/MEK/ERK pathway primarily regulates cell proliferation and the cell cycle. As depicted in Figs. 7 F-I, the IM group showed significantly reduced expression of RAF, RAS, and phosphorylation of MEK and ERK compared to the CON group (P < 0.05). Conversely, these levels were significantly elevated in the RIM, l-AS, and H-AS groups (P < 0.05), with the H-AS group displaying higher protein expression than the RIM group (P < 0.05), and the l-AS group also surpassing the RIM group (P < 0.05). These findings suggest that molting promotes ovarian regeneration by activating the PI3K/AKT/mTOR/P70S6K and RAF/RAS/MEK/ERK pathways, with the strongest effect observed in the H-AS group supplemented with AS.

Fig. 7.

Effects on ovarian regeneration pathways. (A-B) Immunofluorescence staining of ERBB2 and ERBB4 in ovaries. Scale bar: 100 μm. (C-D) Immunofluorescence quantification of ERBB2 and ERBB4 expression in ovaries. Scale bar: 100 μm. (E) Phosphorylation of PI3K, AKT, MTOR, and P70S6K proteins. (F) Relative protein levels of phosphorylated PI3K, AKT, MTOR and P70S6K. (G) Phosphorylation of MEK and ERK proteins and expression of RAS and RAF proteins. (H) Relative protein levels of RAS and RAF, phosphorylated MEK and ERK. (I) Heat map of PI3K/AKT and RAS/RAF pathway genes. Note: Different letters represent significant differences (P < 0.05).

AS promotes microvascular regeneration in the theca layer

As illustrated in Figs. 8 A-C, the expression levels of ERBB2 and ERBB4 in the granulosa cells of SWF were significantly decreased in the IM group compared to the CON group (P < 0.05). In contrast, the RIM, l-AS, and H-AS groups showed significant increases (P < 0.05). Among these, the H-AS group exhibited higher expression than both the l-AS and RIM groups (P < 0.05), while the l-AS group also had higher levels than the RIM group (P < 0.05). Similarly, Figs. 8 D-F demonstrated that ERBB2 and ERBB4 expression in granulosa cells of F1 follicles was significantly lower in the IM group compared to the CON group (P < 0.05). Conversely, the RIM, l-AS, and H-AS groups displayed significantly elevated expression levels (P < 0.05), with the H-AS group again showing higher expression than the l-AS and RIM groups (P < 0.05), and the l-AS group surpassing the RIM group (P < 0.05). In summary, these results suggest that after molting, ERBB2 and ERBB4 expression in the granulosa cell membranes of both SWF and F1 follicles increases, with the AS group showing the most significant enhancement. This implies that molting may promote the regeneration of small white and F1 follicles in laying hens, with the AS treatment being the most effective.

Fig. 8.

Expression of ERBB2 and ERBB4 in small white follicles and graded follicles (F1). (A-B) Immunofluorescence staining of ERBB2 and ERBB4 in the inner membrane layer of SWF follicles. Scale bar: 100 μm. (C-D) Immunofluorescence staining of ERBB2 and ERBB4 in the inner membrane layer of graded follicles (F1). Scale bar: 100 μm. (E) Quantitative immunofluorescence expression of ERBB2 and ERBB4 in SWF. (F) Quantitative immunofluorescence expression of ERBB2 and ERBB4 in the inner membrane layer of graded follicles (F1). Note: Different letters represent significant differences (P < 0.05).

Discussion

Controlling body weight changes during the molting period in laying hens is crucial for minimizing mortality linked to stress responses. In this study, hens in the RIM, l-AS, and H-AS groups showed significant weight loss by day 7, consistent with the normal physiological pattern of 25-30 % weight reduction during molting. Starting from day 21, the hens experienced a rapid recovery in body weight, and by day 28, all treatment groups had body weights similar to the CON group. The findings suggest that adding AS to the feed does not significantly impact the overall recovery of body weight after molting. However, it seems to accelerate physiological recovery, likely due to bioactive compounds in AS, such as ferulic acid and volatile oils, which may boost metabolic activity and support tissue repair processes (Sabeel et al., 2023).

The RIM, l-AS, and H-AS groups stopped laying eggs at the start of the molting process (day 7), which aligns with the typical temporary suppression of reproductive activity during this stage. Angelica sinensis (AS) is recognized for its ability to improve blood circulation, boost immune function, and regulate endocrine activity, thereby aiding the recovery of reproductive organs (Zhao et al., 2024a). Consequently, egg production rates quickly rebounded from day 14 onward, with the l-AS and H-AS groups showing especially significant improvements. Egg production rates surpassed 90 %, with the H-AS group outperforming both other treatment groups and the CON group. Improvements in egg quality after molting were particularly evident. The increased amino acid availability from AS supports eggshell mineralization and protein synthesis (Zhao et al., 2023). Additionally, the antioxidant properties of AS may enhance eggshell pigmentation and protein quality while reducing breakage and contamination (Zhu et al., 2024). The CON group had a higher rate of eggshell color spots, recorded at 43.24 %. In contrast, groups supplemented with Angelica, especially the H-AS group, showed a significant reduction in eggshell color spots, down to just 1.52 %. Moreover, both the l-AS and H-AS groups significantly outperformed the CON group in key measures such as egg weight, eggshell thickness, albumen height, breakage rate, and eggshell contamination rate.

The molting phase combined with feed limitation can trigger the body's stress response, which appears as unusual behavior, feather loss, and weight reduction. Oxidative stress occurs when the production of free radicals surpasses the body's natural antioxidant defenses. Excess free radicals can damage cells and tissues. During molting, laying hens become more susceptible to oxidative stress, shown by decreased antioxidant enzyme activity and increased MDA levels. After molting, antioxidant enzyme activities recover and lipid peroxidation decreases, reflecting enhanced antioxidant capacity in older hens that helps reduce oxidative stress-related physiological damage. Ferulic acid from AS exhibits free radical scavenging effects that inhibit lipid peroxidation and oxidative injury (Xiaodong et al., 2024), effectively reducing MDA and increasing GSH-Px. AS polysaccharides improve immune function and antioxidant status by regulating enzyme activity, boosting T-AOC and SOD levels (Xiaodong et al., 2024). Additionally, volatile compounds in AS may increase CAT levels by optimizing mitochondrial function and reducing radical production (Zhuang et al., 2018). As a result, all AS treatment groups exhibited significantly improved antioxidant markers and decreased MDA levels after molting, confirming its antioxidant effectiveness. During feed restriction, estrogen levels in laying hens dropped significantly due to inadequate nutrition and increased oxidative stress. This hormonal reduction is the main mechanism behind reproductive suppression during molting (Dixon et al., 2014). Once feeding resumed, FSH levels rose, reactivating follicle development. LH levels also returned to normal, supporting follicle maturation and ovulation. Additionally, E₂ levels gradually recovered, promoting the regeneration of ovaries and follicles (Yang et al., 2023). P₄ levels were restored, aiding luteal function. AMH, primarily secreted by small antral ovarian follicles, functions to inhibit initial follicle growth and regulate follicle selection (Sechman, 2013). The increase in egg production after molting is linked to enhanced ovarian activity, marked by faster folliculogenesis and ovulation. During this period, elevated AMH levels help maintain follicle pool balance by preventing excessive simultaneous follicle maturation (Moolhuijsen and Visser, 2020), which is essential for sustaining optimal oocyte production. AS contains phytoestrogens that imitate natural hormones to promote follicle development and reproductive hormone secretion (Dietz et al., 2016). P₄ supports the luteal function of the corpus luteum in the ovary, while AMH serves as an important indicator of ovarian function. Overall, molting plays a crucial role in replenishing the follicular reserve. As a result, administering AS after molting led to increased levels of both AMH and P₄. E₂, an essential hormone produced by ovarian granulosa cells (Johnson, 2015), plays a key role in this process. AS extract may promote follicular development by improving granulosa cell function. Additionally, AS extract influences the hypothalamic-pituitary-ovarian axis to boost the secretion of FSH and LH, while also reducing stress responses and restoring hormonal balance, thereby enhancing laying performance and egg quality (Zhao et al., 2024b). The H-AS group showed the greatest hormonal improvements, suggesting that AS extract supports reproductive hormone levels through multiple mechanisms during the recovery phase after molting.

During molting, the ovarian tissues of laying hens are especially susceptible to severe damage caused by environmental stress, starvation treatments, and hormonal changes. These influences may result in follicular atrophy, follicular atresia, and a reduction in the number of functional ovarian cells (Dongmei et al., 2023; Li et al., 2023). After molting, the ovary of laying hens undergoes remodeling and tissue regeneration, which restores ovarian function and further promotes follicular development. Related studies have confirmed these findings (Ma, et al., 2025; Zhu, et al., 2025). These injuries greatly impact the egg-laying performance and reproductive health of laying hens (Tao et al., 2022). Recent studies have shown that ovarian damage caused by molting can be substantially reduced by adding natural active ingredients with reproductive regulatory effects to the diet (Mohamed et al., 2021). AS, a key element of traditional Chinese medicine, has exhibited various biological activities, especially in regulating female reproductive system functions. Research suggests that AS provides significant protection to ovarian function through antioxidant effects, anti-inflammatory actions, and hormonal regulation. Additionally, it has been found to encourage the regeneration of both follicular and ovarian stromal cells.

In this study, we performed an extensive review of the literature and screened databases, which led to the identification of Angelicolide A, carotenoids, β-sitosterol, and stigmasterol as the main bioactive compounds found in AS. Molecular docking analysis revealed that these compounds have binding affinity for the ERBB2 and ERBB4 receptors, thereby influencing the epidermal growth factor receptor (EGFR) signaling pathway. ERBB2 is known to play a key role in cell division, proliferation, and maintaining the structural integrity of the ovary (Tzu Chao et al., 2021). Research indicates that ERBB2 may indirectly support ovarian regeneration by encouraging the proliferation of ovarian cells (Tao et al., 2020). ERBB4 is essential for ovarian health, mainly by regulating granulosa cell proliferation and supporting oocytes during ovarian development and regeneration. Studies have shown that ERBB4 and ERBB2 work together synergistically in ovarian development and regeneration processes (Zhao et al., 2022). Additionally, ERBB2 and ERBB4 receptors can activate the PI3K/AKT/mTOR/P70S6K and RAF/RAS/MEK/ERK signaling pathways, which are vital for controlling ovarian cell proliferation, preventing apoptosis, and promoting tissue repair (Roberto et al., 2012). The PI3K/AKT/mTOR/P70S6K pathway promotes protein synthesis and cell proliferation by regulating mTOR and its downstream targets (Rute et al., 2021). At the same time, the RAF/RAS/MEK/ERK pathway enhances cellular regeneration by affecting proteins involved in the cell cycle (Sapir et al., 2021).

The active ingredients in AS can also improve ovarian blood supply and microenvironment, providing favorable conditions for follicle development, thereby achieving overall restoration of ovarian function. Research shows that dietary supplementation with AS extract of laying hens can significantly improve ovarian function indicators (Chunhong, et al., 2017), such as ovarian weight, follicle count, and the activity of ovarian stromal cells, further enhancing egg production performance.

The active compounds in AS can also enhance ovarian blood flow and the microenvironment, creating favorable conditions for follicle growth and thereby promoting overall ovarian function recovery. Studies indicate that dietary supplementation with AS extract in laying hens significantly improves ovarian function markers (Chunhong et al., 2017), including ovarian weight, follicle count, and the activity of ovarian stromal cells, which further boosts egg production performance.

Follicles progress through various developmental stages within the ovaries, eventually forming mature oocytes (Kui et al., 2023). These follicles are categorized into different stages based on their development, such as primordial and primary follicles. SWF, representing the earliest developmental stage, are the smallest in size, mainly consist of follicular cells, and contain almost no yolk (Li et al., 2017). The F1 follicle is the one closest to ovulation, typically the largest in diameter and richest in content (Stephens and Johnson, 2016). The combined action of these two signaling pathways also supports the healthy development of small white and graded follicles in the ovaries. The active ingredients in AS increase the expression of ERBB2 and ERBB4 in SWF, promote the proliferation of granulosa and theca cells, and significantly raise the number of SWF, ensuring an ample follicular reserve for the growth of graded follicles (Huang et al., 2024). Additionally, the elevated expression of ERBB2 and ERBB4 in graded follicles, especially in F1 follicles, aids their development and maturation, which in turn enhances the egg quality of laying hens (Wu et al., 2024). This cascade of effects ultimately leads to the restoration of egg-laying ability and improvement in egg quality in laying hens.

Conclusion

In summary, adding 2 % AS to the diets of laying hens during their recovery period after molting has been proven to significantly improve their post-molt recovery. Active compounds like Angelicolide A, carotenoids, and β-sitosterol specifically bind to ERBB2/ERBB4 receptors, triggering downstream signaling pathways such as PI3K/AKT/mTOR/P70S6K and RAF/RAS/MEK/ERK linked to EGFR. This biochemical process promotes ovarian regeneration, encourages granulosa cell growth in follicles, increases reproductive hormone levels, improves ovarian function, and ultimately boosts the productivity of laying hens.

Abbreviation

Angelica sinensis	AS
anti-Müllerian hormone	AMH
catalase	CAT
estradiol	E2
follicle-stimulating hormone	FSH
Gene Ontology	GO
glutathione	GSH
human epidermal growth factor receptor 2	ERBB2
human epidermal growth factor receptor 4	ERBB4
Kyoto Encyclopedia of Genes and Genomes	KEGG
large white follicles	LWF
luteinizing hormone	LH
malondialdehyde	MDA
preovulatory follicles	POF
progesterone	P4
protein-protein interaction	PPI
small white follicles	SWF
small yellow follicles	SYF
standard error of the mean	SEM
total antioxidant capacity	T-AOC
total superoxide dismutase	T-SOD

CRediT authorship contribution statement

Mengqing Sun: Visualization, Investigation, Data curation. Hailing Wang: Visualization, Investigation. Xinyu Zhu: Data curation. Chen Xu: Data curation. Binglin Wang: Conceptualization. Yahong Min: Visualization. Ming Ge: Methodology. Xiaowen Jiang: Visualization. Wenhui Yu: Visualization, Methodology, Investigation.

Disclosures

The authors have no conflicts of interest to declare.