Abstract
Acute kidney injury (AKI) is a severe clinical condition with high morbidity and mortality, often triggered by nephrotoxic drugs like cisplatin. The cGAS/STING pathway, activated by DNA damage, plays a critical role in cisplatin-induced AKI. This study explores the potential of phloretin-loaded selenium nanoparticles (Phl/HS15-Se) as a therapeutic strategy to mitigate cisplatin-induced nephrotoxicity. Phloretin, a natural flavonoid with antioxidant properties, was encapsulated in polyethylene glycol (15)-hydroxy stearate (HS15) micelles and combined with selenium nanoparticles to enhance its renal protective effects. The in vitro and in vivo experiments demonstrated that Phl/HS15-Se significantly reduced oxidative stress, DNA damage, and inflammation by inhibiting the cGAS/STING pathway. In a cisplatin-induced AKI mouse model, Phl/HS15-Se alleviated renal pathological injury, improved renal function, and reduced the expression of inflammatory markers. This study provides a promising nanomedicine approach for the treatment of cisplatin-induced AKI by targeting the cGAS/STING pathway.
Keywords: Acute kidney injury, Phloretin, Selenium nanoparticles, cGAS/STING pathway
Graphical abstract

1. Introduction
Kidney excretes various metabolic wastes from the blood into the urine, which renders it more susceptible to injury compared to other organs. The accumulation of harmful substances within these metabolic wastes induces oxidative stress, inflammation, and adaptive responses in the kidney, thereby leading to impaired renal function (Chen et al., 2023). Acute kidney injury (AKI) is defined as a rapid decline in kidney function over a short period (less than 7 days) (Chawla et al., 2017). It is characterized by high morbidity and mortality rates (Yu et al., 2021a; Wang et al., 2021). In fact, multiple factors can also contribute to the onset of AKI, including peri-operative events, sepsis, nephrotoxic drugs, rhabdomyolysis, and malignancy (Geo et al., 2022). A significant proportion of AKI patients develop chronic kidney disease, renal failure, multi-organ dysfunction, and may even face death due to the lack of effective treatment for AKI in clinical practice, which imposes a substantial medical burden on both families and society. For example, cisplatin is one of the most effective and potent anticancer drugs for treating solid tumors, while nephrotoxicity is its primary dose-limiting factor (Kim et al., 2015). After entering cells, cisplatin can induce massive reactive oxygen species and nitrogen species production, oxidize intracellular biomolecules to promote DNA damage and apoptosis, and trigger the inflammatory cascade to induce nephrotoxicity (Chen et al., 2023). Therefore, the development of drugs capable of alleviating cisplatin-induced nephrotoxicity holds great promise in significantly improving the utilization of cisplatin, reducing the occurrence of AKI and its associated severe consequences, and ultimately easing the heavy medical burden on patients.
Stimulator of interferon genes (STING) pathway serves as a critical regulator in cisplatin-induced AKI (Qi et al., 2023a). In cisplatin-induced AKI mice, STING inhibitors have been shown to significantly ameliorate tubular injury and inflammation (Maekawa et al., 2019; Gong et al., 2021a). The cyclic GMP-AMP synthase (cGAS)/STING pathway is an essential component of the innate immune system, which plays a vital role in detecting and responding to the presence of foreign or abnormal DNA (Hu et al., 2022) cGAS/STING pathway also plays a key role in initiating anti-tumor immunity. For example, a self-cascade strategy for activating and amplifying the cGAS-STING pathway with specificity mediated by pyroptosis can not only significantly impeded the growth of the primary tumor, but also elicited an immune response to further augment the efficacy of immune checkpoint inhibitors in preventing distant tumor progression (Yu et al., 2025). When cGAS encounters double-stranded DNA that is ectopically present in the cytoplasm, such as viral DNA, bacterial DNA, or self-DNA leaked from the nucleus or mitochondria due to cell damage, cGAS undergoes a conformational change and becomes activated. Once activated, cGAS catalyzes the synthesis of cyclic GMP-AMP (cGAMP) from adenosine triphosphate and guanosine triphosphate (Taguchi et al., 2021). After cGAMP is synthesized, it binds to the STING. The activation of STING recruits and activates downstream kinases, leading to the excessive production of interferons and inflammatory cytokines. On the other hand, excessive and prolonged activation of the cGAS/STING pathway can exacerbate renal pathological injury in chronic kidney disease (Qi et al., 2023b). Therefore, targeting cGAS and STING could represent a significant therapeutic strategy for alleviating cisplatin-induced AKI.
Based on these, developing antioxidants capable of inhibiting the cGAS/STING pathway is an effective approach to alleviating AKI. Antioxidants can directly scavenge ROS, thus mitigate DNA damage induced by ROS (Kumar et al., 2022). Subsequently, this prevention of DNA damage can impede the activation of the cGAS/STING pathway. As a result, the inflammatory response is reduced, and AKI is alleviated. Many antioxidant drugs, particularly small-molecule compounds from traditional Chinese medicine, can alleviate kidney damage via this pathway. For example, it has been reported that flavonoids (e.g., naringenin, baicalein, myricetin), (Qi et al., 2023a; Jiang et al., 2025; Liu et al., 2022) astragalus polysaccharide, (Sun et al., 2024) shuangdan jiedu decoction, (Yao et al., 2025) and proanthocyanidins (Gao et al., 2023) can protect against AKI by inhibiting the DNA damage-cGAS-STING signaling pathway.
Phloretin, a flavonoid belonging to the dihydrochalcone class, is abundantly present in apples, strawberries, and certain vegetables (Yahyaa et al., 2017). It exhibits a variety of biological properties, including antifungal, anticancer, antioxidant, antibacterial, anti-osteoclastogenic, estrogenic, antiviral, and anti-inflammatory activities (Behzad et al., 2017; Mariadoss et al., 2019). The beneficial effects of phloretin are primarily attributed to its potent antioxidant properties (Nakhate et al., 2022). In a study on cisplatin-induced nephrotoxicity in mice, phloretin was found to normalize the biochemical markers associated with the disease. These markers include indicators of antioxidant status, such as superoxide dismutase (SOD) activities and glutathione (GSH) levels, as well as those of oxidative stress, like malondialdehyde (MDA) levels (Un et al., 2021; Habtemariam, 2023). Concurrently, phloretin led to the normalization of pathological features, including the structural damage of renal tubules and glomeruli.
However, the instability and poor water solubility of phloretin in its natural form reduce its bioavailability, thereby limiting its clinical application (Wei et al., 2017; Deshpande et al., 2023). By using convenient nanotechnology, the water solubility of insoluble phloretin should be greatly improved. On the other hand, nanotechnology can also be used to prepare antioxidant products with the participation of nanomaterials including silver, (Rai et al., 2009) gold, (Daniel and Astruc, 2004) cerium oxide, (Schubert et al., 2006) and platinum (Kim et al., 2008). To enhance the renal protective effect of phloretin and elucidate its molecular mechanism, in this study, we initially utilized polyethylene glycol (15)-hydroxy stearate (HS15) as a carrier to load phloretin, aiming to improve its water-solubility and stability (Gao et al., 2022). Subsequently, we combined selenium (Se) nanoparticles with the phloretin-loaded HS15 (Phl/HS15) to synergistically enhance the antioxidant and anti-inflammatory effects (Huang et al., 2023). We then verified the biological activity of this combination (Phl/HS15-Se) in a cisplatin-induced AKI mouse model, with the intention of developing a nanomedicine for alleviating AKI.
2. Experimental
2.1. Materials
Phloretin (Phl, P127748-5 g, >98 %) and sodium selenite were obtained from Shanghai Aladdin Biochemical Technology Co., Ltd. Polyethylene glycol (15)-hydroxy stearate (HS15) was purchased from Dalian Meilun Biology Technology Co., Ltd. l-ascorbic acid (L-AA, ≥99.7 %) and other reagents were obtained from Sinopharm Chemical Reagent Co., Ltd.
2.2. Characterization
The morphology of the sample was observed by transmission electron microscope (Hitachi H-7650, Japan). The particle size distribution was obtained on a NanoBrook Omni (Brookhaven Instruments, Holtsville, New York) at 25 °C. UV–Vis spectra were obtained on an ultraviolet spectrophotometer (TU-1950, Beijing Puxi General Instrument Co., Ltd).
2.3. Preparation of Phl/HS15
First, 50 mg of phloretin and 900 mg of polyethylene glycol(15)-hydroxyl stearate (HS15) were weighed into a round-bottom flask. They were then dissolved in a specific amount of methanol, which was completely evaporated using a rotary evaporator at 40 °C under vacuum. The resulting film on the inner wall of the flask was re-dissolved in 20 mL of PBS, yielding the solution of Phl/HS15.
2.4. Preparation of Phl/HS15-Se
Added 500 μL of sodium selenite at different concentrations (with Na2SeO3 to Phl/HS15 ratios of 1:100, 1:50, 1:25, and 1:10) to 4 mL of Phl/HS15, and stirred thoroughly. Next, incorporated 500 μL of L-AA (80 mg/mL) and stirred for 1 h to obtain Phl/HS15-Se.
2.5. In vitro antioxidant activity
The in vitro antioxidant activity of Phl/HS15-Se was assessed using 2 methods: the Ferric Reducing Antioxidant Potential (FRAP) assay and the 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) radical scavenging assay.
FRAP Assay: The FRAP working solution was created by combining 5 mL of a 1 mM 2,4,6-tripyridyltriazine solution (dissolved in 40 mM HCl) with 5 mL of a 2 mM FeCl3 solution (prepared in pH 3.6 sodium acetate). Subsequently, 5 μL of diluted Phl/HS15-Se (at a 1:100 dilution) was added along with 180 μL of the FRAP working solution to a 96-well plate. Absorbance changes at 593 nm were measured immediately over time. The antioxidant activity was presented as the concentration of the reaction product (Fe2+, mM).
ABTS Assay: The ABTS+ working solution was formulated by combining a 7.4 mM ABTS solution with a 2.6 mM K2S2O8 solution in equal volumes. This mixture was kept in the dark at room temperature overnight to facilitate complete oxidation. Following this, the solution was diluted with PBS until the absorbance at 734 nm reached 1.5 ± 0.5. To determine the ABTS+ scavenging rate, 5 μL of diluted Phl/HS15-Se (1:100 dilution) and 180 μL of the ABTS+ working solution were added to a 96-well plate, and the absorbance at 734 nm was measured immediately over time. The ABTS+ scavenging rate was calculated using the following formula:
Where At represented the absorbance of the sample to be tested over time, and A0 represented the initial absorbance of the ABTS+ working solution.
2.6. Cell viability
HK-2 cells were cultured in 96-well plates at a density of 4 × 103 cells per well for 24 h. Following this, the cells were treated with 20 μM cisplatin, after which Phl/HS15 and Phl/HS15-Se were added at various concentrations for an additional 24 h incubation. Next, 0.05 mg/mL of MTT solution was added to each well, and the cells were incubated at 37 °C for 4 h. After incubation, the supernatant was gently removed, and 150 μL of DMSO was added to each well. The plates were then shaken at 100 rpm for 20 min. Finally, the absorbance of each well was measured at a wavelength of 490 nm to evaluate cell viability.
2.7. Cell morphology and apoptosis
HK-2 cells (1 × 105 cells per well) were plated in 24-well plates and allowed to culture for 24 h. Following this, 20 μM cisplatin was administered to each well. The cells were then incubated for an additional 24 h in a medium containing 10 μg/mL Phl/HS15 and Phl/HS15-Se. Morphological changes in the cells were observed and documented using an optical microscope.
After the incubation, a 4 % paraformaldehyde solution was added to each well for cell fixation, left for 15 min. Subsequently, the nuclei were stained with 500 μL of DAPI solution (10 μg/mL). After staining, the cells were rinsed, and an appropriate volume of PBS was added to each well. The apoptotic changes in the nuclei were then examined using a fluorescence microscope.
2.8. ROS generation detection
HK-2 cells were plated in 24-well plates at a density of 1 × 105 cells per well and incubated for 24 h. Each well was treated with 20 μM cisplatin, and the cells were further cultured for 24 h in a medium containing 10 μg/mL Phl/HS15 and Phl/HS15-Se. Following this treatment, the cells were stained with 10 μM DCFH-DA for 30 min to assess the generation of reactive oxygen species (ROS). After staining, the cells were rinsed three times with PBS to eliminate any unbound dye. Then, 500 μL of PBS was added to each well, and the cells were immediately examined under a fluorescence microscope to evaluate ROS levels.
2.9. Rhodamine 123 staining
HK-2 cells were plated in 24-well plates at a density of 1 × 105 cells per well and incubated for 24 h. Each well received a treatment of 20 μM cisplatin, and the cells were subsequently cultured for another 24 h in a medium containing 10 μg/mL Phl/HS15 and Phl/HS15-Se. Afterward, the cells were stained with rhodamine 123 (10 μM) for 30 min to measure ROS generation. Following the staining, the cells were washed three times with PBS to ensure the removal of any unbound dye. Finally, 500 μL of PBS was added to each well, and the cells were immediately examined under a fluorescence microscope to assess ROS levels.
2.10. Cellular immunofluorescence
HK-2 cells were seeded in 48-well plates at a density of 2 × 104 cells per well and allowed to culture for 24 h. Each well was then treated with 20 μM cisplatin and cultured for another 24 h in a medium containing 10 μg/mL Phl/HS15 and Phl/HS15-Se. After treatment, the cells were fixed with 200 μL of 4 % paraformaldehyde for 15 min at room temperature, followed by blocking with 5 % skim milk powder for 1 h to prevent nonspecific binding. The primary antibody, diluted in PBS, was incubated with the cells overnight at 4 °C for optimal binding. The cells were then washed three times with PBST to remove unbound antibody.
Next, the fluorescently labeled secondary antibody was diluted in PBS and incubated with the cells for 1 h at room temperature in the dark. After another three washes with PBST, DAPI was used for nuclear staining for 5 min, avoiding light exposure to prevent fluorescence loss. Finally, an appropriate volume of PBS was added to each well, and the stained cells were imaged under a fluorescence microscope.
2.11. Western blot analysis
HK-2 cells were seeded in 6-well plates at a density of 2 × 105 cells per well. After 24 h of incubation to reach confluence, each well was treated with 20 μM cisplatin and cultured with 10 μg/mL Phl/HS15 and Phl/HS15-Se for an additional 24 h. Then, the cells were lysed on ice with RIPA buffer for 15 min, then centrifuged at 12,000 rpm for 10 min at 4 °C to collect the supernatant for protein sample preparation. The samples were subjected to SDS-PAGE and transferred to a PVDF membrane, which was then blocked with 5 % non-fat milk powder for 1 h and incubated with the primary antibody overnight at 4 °C.
Following three washes with TBST, an HRP-labeled secondary antibody was added and incubated at room temperature for 1 h. After additional washes with TBST, protein signals were developed using the BeyoECL Plus chemiluminescence system (Beyotime). The protein content of the bands was quantitatively analyzed, with GAPDH as the internal reference for normalization.
2.12. In vivo AKI model in mice
Male Kunming mice (4–5 weeks old, approximately 30 g) are acquired from Qingdao Daren Fucheng Animal Technology Co., Ltd. (Shandong, China). Animal experiments are conducted in accordance with the “Guidelines for the Care and Use of Experimental Animals” and approved by the Ethics Committee of Qingdao University of Science and Technology (QKDLL-2025–166).
The experiment consisted 5 groups: control group, cisplatin model group, cisplatin+Se nanoparticles treatment group, cisplatin+Phl/HS15 treatment group, and cisplatin+Phl/HS15-Se treatment group. To induce AKI in mice, a cisplatin solution at a concentration of 1 mg/mL was prepared. The initial weights of the mice in each group were recorded before they received an intraperitoneal injection of 20 mg/kg cisplatin.
The mice were gavage with different samples once daily, starting 2 h before and continuing for 3 days after cisplatin administration. On the fourth day, the mice were euthanized, and their body and visceral organ weights were recorded. Blood samples were collected in enzyme-free centrifuge tubes to assess serum levels of blood urea nitrogen (BUN) and serum creatinine (CRE). Organ tissues from kidneys were stained with hematoxylin and eosin (H&E) and immunohistochemical staining. Renal tissue samples were collected, and levels of cGAS, STING, γH2AX, and TNF-α were measured using RT-PCR. (See Table 1)
Table 1.
Primers information.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| m-TNF-α | ACAAGGCTGCCCCGACTAC | TGGGCTCATACCAGGGTTTG |
| m-GAPDH | GCCACCCAGAAGACTGTGGAT | GGAAGGCCATGCCAGTGA |
| m-STING | GGCTGGCCTGGTCATACTACA | CCCCACAGTCCAATGGAAAG |
| m-γH2AX | CATGTTCGTCATGGGTGTGAA | CCAGCAGCTTGTTGAGCTCCT |
| m-cGAS | AAGAGTTTCAAGAGCTGGATGCA | GGCACTCAAGAAAGAATGCTAACA |
2.13. Statistical analysis
Significant differences between the data were calculated by one-way ANOVA and two-way ANOVA. Each experiment was repeated three times to ensure accuracy. P < 0.05 was considered statistically significant.
3. Results and discussion
In recent years, the utilization of nanosized drug carriers to improve the delivery of reno-protective agents to the kidneys for the treatment of AKI has become increasingly prevalent (Chade and Bidwell, 2022). Polyethylene glycol (15)-hydroxy stearate (HS15), which features an amphiphilic structure, is capable of forming micelles in an aqueous environment (Ye et al., 2021). These micelles can encapsulate insoluble drugs within their hydrophobic cores, thus enhancing the solubility of the drugs in aqueous media (Tang et al., 2021). As depicted in Fig. 1A, when HS15 is mixed with phloretin, Phl/HS15 micelles are formed. This process not only increases the water solubility of phloretin but also enhances its stability. Selenium (Se), an essential microelement for humans, plays a crucial role in maintaining biological functions (Bai et al., 2025). It has been demonstrated that Se can enhance immune surveillance and regulate cell proliferation (Zhu et al., 2022). Moreover, Se is an indispensable component of glutathione peroxidase (Lee et al., 2018; Pieczyńska and Grajeta, 2015; Roman et al., 2013). This enzyme is capable of scavenging intracellular free radicals, which showcases the antioxidant properties of Se (Zhu et al., 2022; Torres et al., 2012). By in situ growing Se nanoparticles on the surface of Phl/HS15 micelles, Phl/HS15-Se nanoparticles can be obtained. This approach further enhances the efficacy of phloretin by augmenting its antioxidant capacity.
Fig. 1.
(A) Preparation of Phl/HS15 and Phl/HS15-Se. (B) Optical image of Se NPs, Phl/HS15, and Phl/HS15-Se suspensions with different Se loading amount. (C) UV–Visible spectrum and (D) Granulometric distribution of Phl/HS15-Se, the inset picture is the TEM image of Phl/HS15-Se. (E) Hemolysis of Se NPs, Phl/HS15, and Phl/HS15-Se nanoparticles, ****p < 0.0001 compared to the positive control A+ group. (F-G) Antioxidant activity of Phl/HS15-Se confirmed by both the (F) ABTS assay and the (G) FRAP assay.
Fig. 1B presents optical images of Phl/HS15-Se nanoparticles solutions with varying loading amounts of Se nanoparticles. As the loading amount of Se nanoparticles rises, the solution takes on an orange-red color, and the color intensity gradually deepens. The UV–Visible spectrum of Phl/HS15-Se nanoparticles in Fig. 1C exhibits characteristic peaks of Se nanoparticles, which confirms the successful loading of Se nanoparticles onto the Phl/HS15 system. Taking Phl/HS15-Se 1:50 (hereinafter referred to as Phl/HS15-Se) as an example, it shows a monodispersed nanoparticles morphology (TEM image in the inset picture of Fig. 1D). The most frequently-occurring particle diameter is approximately 9.9 nm (Fig. 1D). For the purpose of exploring the in vivo biological application of Phl/HS15-Se, its hemolytic activity was evaluated in Fig. 1E. Under the specified experimental conditions, neither Se nanoparticles nor Phl/HS15 alone caused hemolysis. Similarly, Phl/HS15-Se demonstrated good blood compatibility, as it also did not induce hemolysis.
Oxidative stress is recognized as a crucial pathogenic factor implicated in the initiation, development, and progression of many kidney diseases (Gorin, 2016; Feng et al., 2022; Ogura et al., 2021). To assess the renal-protective effect of Phl/HS15-Se, its in vitro antioxidant activity was initially investigated in Fig. 1F & G. Both the ABTS and FRAP assays demonstrated that Phl/HS15 displayed antioxidant activity, which can be attributed to the antioxidant property of phloretin. With an increase in the Se nanoparticles loading, the antioxidant activity of Phl/HS15-Se also enhanced, indicated that the antioxidant activity of Phl/HS15-Se is related to the concentration of Se nanoparticles. Similarly, the free radical scavenging activity of Se nanoparticles-loaded whey protein concentrate and phloretin complex prepared by Kheynoor, Najme et al. (Kheynoor et al., 2025) and the green Se nanoparticles synthesized by Nassar et al. (2023) using the endophytic fungal strain Penicillium verhagenii increased with the increase of Se nanoparticles concentration. Also He et al. (2023) reported that encapsulated selenium-enriched peptide by dextran/whey protein isolate could increase the DPPH and ABTS radical scavenging activities. The antioxidant activity of Se nanoparticles could be attributed to the inhibition and neutralization of free radicals formation via electron transfer (Kheynoor et al., 2025). Given that the antioxidant activities of Phl/HS15-Se 1:25 and Phl/HS15-Se 1:10 were not significantly higher than that of Phl/HS15-Se 1:50, to prevent potential excessive drug toxicity in future applications, Phl/HS15-Se 1:50 (hereinafter referred to as Phl/HS15-Se) was selected as the subject for all subsequent experiments.
The protective effect of Phl/HS15-Se nanoparticles on cisplatin-treated cells is presented in Fig. 2A. The well-known chemotherapeutic agent cisplatin is unfortunately associated with significant nephrotoxicity, which can lead to cell damage and death (Volovat et al., 2023; Lee et al., 2021). In our experimental setup, we exposed HK-2 cells, a commonly used in vitro model for studying renal cell functions, to cisplatin. After the treatment with cisplatin, a remarkable decrease in the survival rate of HK-2 cells was observed (cell viability decreased to 53 %). This reduction in cell survival can be attributed to the oxidative stress and inflammation induced by cisplatin within the cells. Phl/HS15, micelles with inherent anti-inflammatory and antioxidant activities, can counteract part of the harmful effects of cisplatin, improve the survival rate of the cells to a certain degree. When Phl/HS15-Se nanoparticles were utilized, a more pronounced improvement in the cell survival rate was evident. Se supplementation has been reported to alleviate the antioxidant balance and enhanced kidneys cells' resistance to oxidative damage in grass carp (Malyugina et al., 2021). The combination of Phl/HS15 with Se nanoparticles likely enhances the overall biological activity of the treatment. Se nanoparticles can further boost the antioxidant capacity of Phl/HS15, leading to a stronger protective effect against cisplatin-induced cell damage. The dose-response relationship of Phl/HS15-Se nanoparticles showed that, at lower concentrations (2.5–10 μg/mL), the protective effect of Phl/HS15-Se nanoparticles on the cell survival rate increased in a concentration-dependent manner. Specifically, when the concentration of Phl/HS15-Se nanoparticles reached 10 μg/mL, the improvement effect on the cell survival rate was the most significant. At this concentration, the cell survival rate could be restored to 85 %. Observation of cell morphology and apoptosis in Fig. 2B showed that after cisplatin treatment, some of the cell nuclei lysed and formed apoptotic bodies. However, when Phl/HS15-Se nanoparticles were introduced, it notably improved the cell morphology. The rate of nuclear changes was reduced, indicating that Phl/HS15-Se nanoparticles can protect cells from cisplatin-induced nuclear damage and apoptosis. This finding preliminarily demonstrates the promising biological activity of Phl/HS15-Se nanoparticles, suggesting their potential as a therapeutic agent for protecting cells from cisplatin-induced damage.
Fig. 2.
(A) Cell viability of HK-2 cells after co-culture with cisplatin, Phl/HS15 + cisplatin, and Phl/HS15-Se + cisplatin for 24 h. (B) Cell morphology and DAPI staining of HK-2 cells after co-culture with cisplatin, Phl/HS15 + cisplatin, and Phl/HS15-Se + cisplatin for 24 h.
Further fluorescence staining of HK-2 cells treated with cisplatin using DCFH-DA and Rhodamine 123 demonstrated that cisplatin induced the overproduction of ROS in cells (Fig. 3). As a result, there was a substantial increase in the fluorescence intensity of cells after DCFH-DA staining, since DCFH-DA is a probe that reacts with ROS to generate a fluorescent product (Fig. 3A & B) (Yu et al., 2021b). Moreover, cisplatin treatment led to a significant reduction in the fluorescence intensity of HK-2 cells stained with Rhodamine 123 (Fig. 3A & C). Rhodamine 123 accumulates in mitochondria in a membrane-potential-dependent manner, so this decrease indicates a decline in mitochondrial membrane potential (Hagen et al., 1997; Cheng et al., 2017). Cisplatin likely impairs the integrity of the mitochondrial membrane, thereby causing mitochondrial dysfunction and disrupting the normal physiological functions of cells (Yu et al., 2021b; Rashid et al., 2023). Phl/HS15-Se nanoparticles possess antioxidant properties. They can scavenge the excessive ROS in cells, alleviating the intracellular oxidative stress. This is evidenced by the weakened fluorescence intensity of DCFH-DA staining. Additionally, these nanoparticles can gradually restore the mitochondrial membrane potential, which is crucial for maintaining normal mitochondrial function and overall cell homeostasis.
Fig. 3.
(A) DCFH-DA and Rhodamine 123 staining of HK-2 cells after co-culture with cisplatin, Phl/HS15 + cisplatin, and Phl/HS15-Se + cisplatin. (B-C) Fluorescence intensity calculated from (A), *p < 0.05, ***p < 0.001, and ****p < 0.0001 compared to the control group, ##p < 0.01 and ####p < 0.0001 compared to the cisplatin group, $$p < 0.01 compared to the Phl/HS15 group.
Immunofluorescence staining of HK-2 cells treated with cisplatin using γH2AX as a marker demonstrated that cisplatin can induce DNA damage, which is manifested by an increased expression of γH2AX (Fig. 4A & D). γH2AX is a well-established biomarker for DNA double-strand breaks (Valente et al., 2022; Sakurai et al., 2022). Phl/HS15-Se nanoparticles may exert a protective effect on DNA. It can reduce the incidence of DNA double-strand breaks, leading to a decrease in the expression of γH2AX and a weakened positive staining signal. This indicates that Phl/HS15-Se nanoparticles can mitigate the DNA-damaging effects of cisplatin. The released abnormal DNA fragments caused by cisplatin will continuously activate cGAS. As a result, the expression and activity of cGAS increase, accompanied by enhanced staining signals (Fig. 4B & D). Given the continuous activation of cGAS, the downstream STING is also persistently activated. This activation leads to strong STING staining signals and subsequently triggers an inflammatory response (Fig. 4C & D). Phl/HS15-Se nanoparticles reduce the generation of abnormal DNA within cells. By doing so, it can inhibit the activation of cGAS, resulting in a weakened cGAS staining signal. Moreover, the inhibition of cGAS activation by Phl/HS15-Se nanoparticles further inhibits the activation of STING, ultimately reducing the inflammatory response. The analysis of γH2AX, cGAS and STING through western blot showed similar results (Fig. 4E & F). Phl/HS15-Se nanoparticles can mitigate cellular oxidative stress, diminish mitochondrial damage and DNA double-strand breaks, reduce the leakage of nuclear DNA into the cytoplasm, and inhibit the activation of the cGAS/STING pathway, thereby reducing inflammation and alleviating kidney damage.
Fig. 4.
(A-C) Immunofluorescence analysis of the expression of (A) γH2AX, (B) cGAS, and (C) STING. (D) Fluorescence intensity calculated from (A-C), *p < 0.05 and ****p < 0.0001 compared to the control group, ####p < 0.0001 compared to the cisplatin group, $$$$p < 0.0001 compared to the Phl/HS15 group. (E) Western blot analysis of the expression of γH2AX, cGAS, and STING. (F) Relative expression calculated from (E), **p < 0.01 and ****p < 0.0001 compared to the control group, ##p < 0.01, ###p < 0.001, and ####p < 0.0001 compared to the cisplatin group.
To validate the in vivo activity of Phl/HS15-Se nanoparticles, an animal model of cisplatin-induced AKI was established in mice. Subsequently, samples including Phl/HS15-Se nanoparticles were administered to the mice via gavage. After a three-day administration period, the mice were humanely euthanized. Experimental results indicated that Phl/HS15-Se nanoparticles were able to ameliorate, to a certain degree, the weight loss caused by cisplatin toxicity (Fig. 5A). Moreover, the extent of improvement was more pronounced compared to the effects of Phl/HS15 and Se nanoparticles used individually. An analysis of the kidney and spleen indices of the mice in Fig. 5B & C revealed that Phl/HS15-Se nanoparticles could also rectify the abnormalities in organ indices induced by cisplatin. These indices serve as important biomarkers for evaluating the health status of the corresponding organs. Importantly, Phl/HS15-Se nanoparticles had no significant impact on the indices of other vital organs such as the heart, liver, and lungs (Fig. 5D), which provides evidence, to some extent, for the safety profile of Phl/HS15-Se nanoparticles in the context of this in vivo model.
Fig. 5.
(A) Number of mice body weight changes, ****p < 0.0001 compared to the control group, #p < 0.05 compared to the cisplatin group, $p < 0.05 compared to the Se NPs group. (B-D) Organ index of (B) kidney, (C) spleen, (D) liver, lungs, and heart. *p < 0.05, ***p < 0.001, and ****p < 0.0001 compared to the control group, ###p < 0.001 compared to the cisplatin group. (E-F) The levels of (E) CRE and (F) BUN in serum, ****p < 0.0001 compared to the control group, ##p < 0.01, ###p < 0.001, and ####p < 0.0001 compared to the cisplatin group, $p < 0.05, $$p < 0.01, $$$p < 0.001, and $$$$p < 0.0001 compared to the Se NPs group, &&p < 0.01 compared to the Phl/HS15 group.
Fig. 5E & F illustrated the effects of Phl/HS15-Se nanoparticles on serum creatinine (CRE) and blood urea nitrogen (BUN). In AKI, the glomerular filtration rate of the kidneys is compromised, resulting in reduced excretion of CRE and BUN (Kagawa et al., 2019; Chu et al., 2016; Li et al., 2016). This manifest as an abnormal increase in their serum concentrations, with the magnitude of elevation correlating with the severity of renal damage. Following the administration of Phl/HS15-Se nanoparticles, these nanoparticles may enhance renal function by alleviating oxidative stress and reducing renal inflammation, thereby promoting the excretion of CRE and BUN, and leading to a gradual decline in their serum levels.
Cisplatin induced renal injury mainly occurs in renal tubular epithelial cells (Gong et al., 2021b). The appearance characterization and H&E staining of kidney tissue demonstrated the reparative effects of Phl/HS15-Se nanoparticles on cisplatin-induced renal damage (Fig. 6). Specifically, the kidneys that exhibited swelling and a pale color due to cisplatin exposure showed significant improvement following treatment with Phl/HS15-Se nanoparticles. Additionally, the swelling and vacuolar degeneration of renal tubular epithelial cells were alleviated, indicating a protective effect on renal tissue structure. The results of immunohistochemical staining for γH2AX, cGAS, and STING in Fig. 6, as well as PCR analysis of kidney tissue in Fig. 7A-C, demonstrated that Phl/HS15-Se nanoparticles can alleviate AKI by reducing DNA damage and inhibiting the cGAS/STING pathway. This, in turn, suppresses inflammatory responses, as evidenced by decreased expression levels of inflammatory markers such as TNF-α (Fig. 7D). These findings are consistent with the results observed in in vitro cell experiments.
Fig. 6.
H&E and immunohistochemical staining of kidney tissue.
Fig. 7.
(A-D) The levels of (A) γH2AX, (B) cGAS, (C) STING, and (D) TNF-α in kidney tissue, *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001 compared to the control group, #p < 0.05, ##p < 0.01, ###p < 0.001, and ####p < 0.0001 compared to the cisplatin group, $p < 0.05, $$p < 0.01, $$$p < 0.001, and $$$$p < 0.0001 compared to the Se NPs group.
4. Conclusions
The study concludes that Phl/HS15-Se nanoparticles exhibit significant potential for alleviating cisplatin-induced AKI. The combination of phloretin with Se nanoparticles enhances the antioxidant and anti-inflammatory effects, effectively mitigating renal damage by inhibiting the cGAS/STING pathway. The in vivo results further validate the protective efficacy of Phl/HS15-Se in a cisplatin-induced AKI mouse model, demonstrating its ability to improve renal function and reduce pathological injury. This nanomedicine approach offers a novel and effective strategy for the treatment of cisplatin-induced nephrotoxicity, with potential applications in clinical practice to reduce the incidence and severity of AKI.
CRediT authorship contribution statement
Teng Xiao: Visualization, Validation, Investigation, Formal analysis, Data curation. Fanghong Wang: Investigation, Formal analysis, Data curation. Ye Li: Data curation. Gaoyang Lin: Writing – review & editing, Supervision, Funding acquisition. Xiaochen Wu: Writing – review & editing, Writing – original draft, Funding acquisition, Formal analysis.
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgements
This work was supported by Shandong Provincial Natural Science Foundation (ZR2023ME045), Shandong Province Key Traditional Chinese Medicine Science and Technology Project (Z20240222), Qingdao Science and Technology Benefiting the People Demonstration Project (25-1-5-smjk-1-nsh), and Youth Innovation Team Program of Shandong Higher Education Institution (2022KJ156).
Contributor Information
Gaoyang Lin, Email: lingaoyang1988@126.com.
Xiaochen Wu, Email: wxcguest@126.com.
Data availability
Data will be made available on request.
References
- Bai S., Zhang M., Tang S., Li M., Wu R., Wan S., Chen L., Wei X., Feng S. Effects and impact of selenium on human health, a review. Molecules. 2025;30(1):50. [Google Scholar]
- Behzad S., Sureda A., Barreca D., Nabavi S.F., Rastrelli L., Nabavi S.M. Health effects of phloretin: from chemistry to medicine. Phytochem. Rev. 2017;16(3):527–533. [Google Scholar]
- Chade A.R., Bidwell G.L. Novel drug delivery technologies and targets for renal disease. Hypertension. 2022;79(9):1937–1948. doi: 10.1161/HYPERTENSIONAHA.122.17944. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chawla L.S., Bellomo R., Bihorac A., Goldstein S.L., Siew E.D., Bagshaw S.M., Bittleman D., Cruz D., Endre Z., Fitzgerald R.L., Forni L., Kane-Gill S.L., Hoste E., Koyner J., Liu K.D., Macedo E., Mehta R., Murray P., Nadim M., Ostermann M., Palevsky P.M., Pannu N., Rosner M., Wald R., Zarbock A., Ronco C., Kellum J.A., W. on behalf of the Acute Disease Quality Initiative, Acute kidney disease and renal recovery: consensus report of the Acute Disease Quality Initiative (ADQI) 16 Workgroup. Nat. Rev. Nephrol. 2017;13(4):241–257. doi: 10.1038/nrneph.2017.2. [DOI] [PubMed] [Google Scholar]
- Chen Q., Nan Y., Yang Y., Xiao Z., Liu M., Huang J., Xiang Y., Long X., Zhao T., Wang X., Huang Q., Ai K. Nanodrugs alleviate acute kidney injury: Manipulate RONS at kidney. Bioactive Mater. 2023;22:141–167. [Google Scholar]
- Cheng P., Gui C., Huang J., Xia Y., Fang Y., Da G., Zhang X. Molecular mechanisms of ampelopsin from Ampelopsis megalophylla induces apoptosis in HeLa cells. Oncol. Lett. 2017;14(3):2691–2698. doi: 10.3892/ol.2017.6520. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chu X., Bleasby K., Chan G., Nunes I., Evers R. Transporters affecting biochemical test results: Creatinine-drug interactions. Clin. Pharmacol. Ther. (St. Louis, MO, U. S.) 2016;100(5):437–440. [Google Scholar]
- Daniel M.-C., Astruc D. Gold nanoparticles: assembly, supramolecular chemistry, quantum-size-related properties, and applications toward biology, catalysis, and nanotechnology. ChemInform. 2004;35(16):293–346. [Google Scholar]
- Deshpande R.D., Shah D.S., Gurram S., Jha D.K., Batabyal P., Amin P.D., Sathaye S. Formulation, characterization, pharmacokinetics and antioxidant activity of phloretin oral granules. Int. J. Pharm. 2023;645 [Google Scholar]
- Feng Q., Yu X., Qiao Y., Pan S., Wang R., Zheng B., Wang H., Ren K.-D., Liu H., Yang Y. Ferroptosis and acute kidney injury (AKI): Molecular mechanisms and therapeutic potentials. Front. Pharmacol. 2022;13 [Google Scholar]
- Gao F., Chen Z.Y., Zhou L., Xiao X.F., Wang L., Liu X.C., Wang C.G., Guo Q.H. Preparation, characterization and in vitro study of bellidifolin nano-micelles. RSC Adv. 2022;12(34):21982–21989. doi: 10.1039/d2ra02779h. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gao X.T., Yin Y.L., Liu S., Dong K.H., Wang J., Guo C.L. Fucoidan-proanthocyanidins nanoparticles protect against cisplatin-induced acute kidney injury by activating mitophagy and inhibiting mtDNA-cGAS/STING signaling pathway. Int. J. Biol. Macromol. 2023;245 [Google Scholar]
- Geo H.N., Murugan D.D., Chik Z., Norazit A., Foo Y.Y., Leo B.F., Teo Y.Y., Kadir S.Z.S.B.S.A., Chan Y., Chai H.J., Medel M., Abdullah N.A., Johns E.J., Vicent M.J., Chung L.Y., Kiew L.V. Renal Nano-drug delivery for acute kidney Injury: current status and future perspectives. J. Control. Release. 2022;343:237–254. doi: 10.1016/j.jconrel.2022.01.033. [DOI] [PubMed] [Google Scholar]
- Gong Q., Wang M., Jiang Y., Zha C., Yu D., Lei F., Luo Y., Feng Y., Yang S., Li J., Du L. The abrupt pathological deterioration of cisplatin-induced acute kidney injury: emerging of a critical time point. Pharmacol. Res. Perspect. 2021;9(6) [Google Scholar]
- Gong W., Lu L., Zhou Y., Liu J., Ma H., Fu L., Huang S., Zhang Y., Zhang A., Jia Z. The novel STING antagonist H151 ameliorates cisplatin-induced acute kidney injury and mitochondrial dysfunction. Am. J. Physiol. Renal Physiol. 2021;320(4):F608–f616. doi: 10.1152/ajprenal.00554.2020. [DOI] [PubMed] [Google Scholar]
- Gorin Y. The kidney: an organ in the front line of oxidative stress-associated pathologies. Antioxid. Redox Signal. 2016;25(12):639–641. doi: 10.1089/ars.2016.6804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Habtemariam S. The molecular pharmacology of phloretin: anti-inflammatory mechanisms of action. Biomedicines. 2023;11(1):143. doi: 10.3390/biomedicines11010143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hagen T.M., Yowe D.L., Bartholomew J.C., Wehr C.M., Do K.L., Park J.-Y., Ames B.N. Mitochondrial decay in hepatocytes from old rats: Membrane potential declines, heterogeneity and oxidants increase. Proc. Natl. Acad. Sci. 1997;94(7):3064–3069. doi: 10.1073/pnas.94.7.3064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- He J., Wang Z., Wei L., Ye Y., Din Z.-u., Zhou J., Cong X., Cheng S., Cai J. Electrospray-assisted fabrication of dextran–whey protein isolation microcapsules for the encapsulation of selenium-enriched peptide. Foods. 2023;12(5):1008. doi: 10.3390/foods12051008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu Y., Chen B., Yang F., Su Y., Yang D., Yao Y., Wang S., Wu Y., Tao L., Xu T. Emerging role of the cGAS-STING signaling pathway in autoimmune diseases: Biologic function, mechanisms and clinical prospection. Autoimmun. Rev. 2022;21(9) [Google Scholar]
- Huang Y.H., Chen Q.L., Zeng H., Yang C., Wang G., Zhou L. A Review of Selenium (Se) nanoparticles: from synthesis to applications. Part. Part. Syst. Charact. 2023;40(11):2300098. [Google Scholar]
- Jiang T., Zhu F.K., Gao X.T., Wu X.C., Zhu W.Y., Guo C.L. Naringenin loaded fucoidan/polyvinylpyrrolidone nanoparticles protect against folic acid induced acute kidney injury in vitro and in vivo. Colloids Surfaces B-Biointerfaces. 2025;245 [Google Scholar]
- Kagawa T., Zárybnický T., Omi T., Shirai Y., Toyokuni S., Oda S., Yokoi T. A scrutiny of circulating microRNA biomarkers for drug-induced tubular and glomerular injury in rats. Toxicology. 2019;415:26–36. doi: 10.1016/j.tox.2019.01.011. [DOI] [PubMed] [Google Scholar]
- Kheynoor N., Golmakani M.-T., Mortazavian A.M., Khanniri E., Hosseini S.M.H. Fabrication and characterization of antioxidant fish oil Pickering emulsions stabilized by selenium nanoparticles-loaded whey protein concentrate and phloretin complex. Food Chem.: X. 2025;27 [Google Scholar]
- Kim H.-J., Park D.J., Kim J.H., Jeong E.Y., Jung M.H., Kim T.-H., Yang J.I., Lee G.-W., Chung H.J., Chang S.-H. Glutamine protects against cisplatin-induced nephrotoxicity by decreasing cisplatin accumulation. J. Pharmacol. Sci. 2015;127(1):117–126. doi: 10.1016/j.jphs.2014.11.009. [DOI] [PubMed] [Google Scholar]
- Kim J., Takahashi M., Shimizu T., Shirasawa T., Kajita M., Kanayama A., Miyamoto Y. Effects of a potent antioxidant, platinum nanoparticle, on the lifespan of Caenorhabditis elegans. Mech. Ageing Dev. 2008;129(6):322–331. doi: 10.1016/j.mad.2008.02.011. [DOI] [PubMed] [Google Scholar]
- Kumar S., Saxena J., Srivastava V.K., Kaushik S., Singh H., Abo-EL-Sooud K., Abdel-Daim M.M., Jyoti A., Saluja R. The interplay of oxidative stress and ros scavenging: antioxidants as a therapeutic potential in sepsis. Vaccines. 2022;10(10):1575. doi: 10.3390/vaccines10101575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee D., Yamabe N., Lee H., Lim Lee H., Kim D.-W., Wook Lee J., Sung Kang K. Necrostatins regulate apoptosis, necroptosis, and inflammation in cisplatin-induced nephrotoxicity in LLC-PK1 cells. Bioorg. Med. Chem. Lett. 2021;48 [Google Scholar]
- Lee E.-b., Kim G.-H., Yoon G. P-316 - Mitochondrial ROS regulates hepatoma cell invasiveness via NFE2L1. Free Radic. Biol. Med. 2018;120:S140. [Google Scholar]
- Li C.-z., Jin H.-h., Sun H.-x., Zhang Z.-z., Zheng J.-x., Li S.-h., Han S.-h. Eriodictyol attenuates cisplatin-induced kidney injury by inhibiting oxidative stress and inflammation. Eur. J. Pharmacol. 2016;772:124–130. doi: 10.1016/j.ejphar.2015.12.042. [DOI] [PubMed] [Google Scholar]
- Liu S., Gao X.T., Wang Y.Q., Wang J., Qi X.J., Dong K.H., Shi D.Y., Wu X.C., Guo C.L. Baicalein-loaded silk fibroin peptide nanofibers protect against cisplatin-induced acute kidney injury: Fabrication, characterization and mechanism. Int. J. Pharm. 2022;626 [Google Scholar]
- Maekawa H., Inoue T., Ouchi H., Jao T.M., Inoue R., Nishi H., Fujii R., Ishidate F., Tanaka T., Tanaka Y., Hirokawa N., Nangaku M., Inagi R. Mitochondrial damage causes inflammation via cGAS-STING signaling in acute kidney injury. Cell Rep. 2019;29(5):1261–1273.e6. doi: 10.1016/j.celrep.2019.09.050. [DOI] [PubMed] [Google Scholar]
- Malyugina S., Skalickova S., Skladanka J., Slama P., Horky P. Biogenic selenium nanoparticles in animal nutrition: a review. Agriculture. 2021;11(12):1244. [Google Scholar]
- Mariadoss A.V.A., Vinyagam R., Rajamanickam V., Sankaran V., Venkatesan S., David E. Pharmacological Aspects and potential use of Phloretin: a Systemic Review. Mini-Rev. Med. Chem. 2019;19(13):1060–1067. doi: 10.2174/1389557519666190311154425. [DOI] [PubMed] [Google Scholar]
- Nakhate K.T., Badwaik H., Choudhary R., Sakure K., Agrawal Y.O., Sharma C., Ojha S., Goyal S.N. Therapeutic potential and pharmaceutical development of a multitargeted flavonoid phloretin. Nutrients. 2022;14(17):3638. doi: 10.3390/nu14173638. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nassar A.-R.A., Eid A.M., Atta H.M., El Naghy W.S., Fouda A. Exploring the antimicrobial, antioxidant, anticancer, biocompatibility, and larvicidal activities of selenium nanoparticles fabricated by endophytic fungal strain Penicillium verhagenii. Sci. Rep. 2023;13(1):9054. doi: 10.1038/s41598-023-35360-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ogura Y., Kitada M., Koya D. Sirtuins and renal oxidative stress. Antioxidants. 2021;10(8):1198. doi: 10.3390/antiox10081198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pieczyńska J., Grajeta H. The role of selenium in human conception and pregnancy. J. Trace Elem. Med. Biol. 2015;29:31–38. doi: 10.1016/j.jtemb.2014.07.003. [DOI] [PubMed] [Google Scholar]
- Qi J., Luo Q., Zhang Q., Wu M., Zhang L., Qin L., Xue Q., Nie X. Yi-Shen-Xie-Zhuo formula alleviates cisplatin-induced AKI by regulating inflammation and apoptosis via the cGAS/STING pathway. J. Ethnopharmacol. 2023;309 [Google Scholar]
- Qi X.J., Wang J., Fei F.S., Gao X.T., Wu X.C., Shi D.Y., Guo C.L. Myricetin-loaded nanomicelles protect against cisplatin-induced acute kidney injury by inhibiting the DNA damage-cGAS-STING signaling pathway. Mol. Pharm. 2023;20(1):136–146. doi: 10.1021/acs.molpharmaceut.2c00520. [DOI] [PubMed] [Google Scholar]
- Rai M., Yadav A., Gade A. Silver nanoparticles as a new generation of antimicrobials. Biotechnol. Adv. 2009;27(1):76–83. doi: 10.1016/j.biotechadv.2008.09.002. [DOI] [PubMed] [Google Scholar]
- Rashid M.A., Tang J.J., Yoo K.-H., Corujo-Ramirez A., Oliveros A., Kim S.H., Ullah F., Altawell R., Hawse J.R., Cole P.D., Jang M.-H. The selective cyclooxygenase-2 inhibitor NS398 ameliorates cisplatin-induced impairments in mitochondrial and cognitive function. Front. Mol. Neurosci. 2023;16 [Google Scholar]
- Roman M., Jitaru P., Barbante C. Selenium biochemistry and its role for human health. Metallomics. 2013;6(1):25–54. [Google Scholar]
- Sakurai E., Ishizawa H., Kiriyama Y., Michiba A., Hoshikawa Y., Tsukamoto T. γH2AX, a DNA double-strand break marker, correlates with PD-L1 expression in smoking-related lung adenocarcinoma. Int. J. Mol. Sci. 2022;23(12):6679. doi: 10.3390/ijms23126679. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schubert D., Dargusch R., Raitano J., Chan S.-W. Cerium and yttrium oxide nanoparticles are neuroprotective. Biochem. Biophys. Res. Commun. 2006;342(1):86–91. doi: 10.1016/j.bbrc.2006.01.129. [DOI] [PubMed] [Google Scholar]
- Sun C.C., Zhao X.H., Wang X.H., Yu Y.Y., Shi H., Tang J., Sun S.Y., Zhu S.P. Astragalus polysaccharide mitigates rhabdomyolysis-induced acute kidney injury via inhibition of M1 macrophage polarization and the cGAS-STING pathway. J. Inflamm. Res. 2024;17:11505–11527. doi: 10.2147/JIR.S494819. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Taguchi T., Mukai K., Takaya E., Shindo R. Sting operation at the ER/Golgi Interface. Front. Immunol. 2021;12 [Google Scholar]
- Tang L., Jiang W.H., Wu L., Yu X.L., He Z., Shan W.G., Fu L.L., Zhang Z.H., Zhao Y.C. TPGS2000-DOX prodrug micelles for improving breast cancer therapy. Int. J. Nanomed. 2021;16:7875–7890. [Google Scholar]
- Torres S.K., Campos V.L., León C.G., Rodríguez-Llamazares S.M., Rojas S.M., González M., Smith C., Mondaca M.A. Biosynthesis of selenium nanoparticles by Pantoea agglomerans and their antioxidant activity. J. Nanopart. Res. 2012;14(11):1236. [Google Scholar]
- Un H., Ugan R.A., Gurbuz M.A., Bayir Y., Kahramanlar A., Kaya G., Cadirci E., Halici Z. Phloretin and phloridzin guard against cisplatin-induced nephrotoxicity in mice through inhibiting oxidative stress and inflammation. Life Sci. 2021;266 [Google Scholar]
- Valente D., Gentileschi M.P., Guerrisi A., Bruzzaniti V., Morrone A., Soddu S., Verdina A. Factors to consider for the correct use of γH2AX in the evaluation of DNA double-strand breaks damage caused by ionizing radiation. Cancers. 2022;14(24):6204. doi: 10.3390/cancers14246204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Volovat S., Apetrii M., Stefan A., Vlad C., Voroneanu L., Hogas M., Haisan A., Volovat C., Hogas S. Cisplatin and AKI: an ongoing battle with new perspectives—a narrative review. Int. Urol. Nephrol. 2023;55(5):1205–1209. doi: 10.1007/s11255-022-03418-8. [DOI] [PubMed] [Google Scholar]
- Wang L., Zhang Y., Li Y., Chen J., Lin W. Recent advances in engineered nanomaterials for acute kidney injury theranostics. Nano Res. 2021;14(4):920–933. [Google Scholar]
- Wei Y., Zhang J., Memon A.H., Liang H. Molecular model and in vitro antioxidant activity of a water-soluble and stable phloretin/hydroxypropyl-β-cyclodextrin inclusion complex. J. Mol. Liq. 2017;236:68–75. [Google Scholar]
- Yahyaa M., Ali S., Davidovich-Rikanati R., Ibdah M., Shachtier A., Eyal Y., Lewinsohn E., Ibdah M. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.) Phytochemistry. 2017;140:125–133. doi: 10.1016/j.phytochem.2017.04.022. [DOI] [PubMed] [Google Scholar]
- Yao Q., Wen J.C., Chen S.M., Wang Y., Wen X.R., Wang X.L., Li C.W., Zheng C.Y., Li J.J., Ma Z.J., Zhan X.Y., Xiao X.H., Bai Z.F. Shuangdan Jiedu Decoction improved LPS-induced acute lung injury by regulating both cGAS-STING pathway and inflammasome. J. Ethnopharmacol. 2025;336 [Google Scholar]
- Ye J., Bao S., Zhao S., Zhu Y., Ren Q., Li R., Xu X., Zhang Q. Self-assembled micelles improve the oral bioavailability of dihydromyricetin and anti-acute alcoholism activity. AAPS PharmSciTech. 2021;22(3):111. doi: 10.1208/s12249-021-01983-2. [DOI] [PubMed] [Google Scholar]
- Yu D., Zha Y., Zhong Z., Ruan Y., Li Z., Sun L., Hou S. Improved detection of reactive oxygen species by DCFH-DA: New insight into self-amplification of fluorescence signal by light irradiation. Sens. Actuators B. 2021;339 [Google Scholar]
- Yu H., Liu D., Shu G., Jin F., Du Y. Recent advances in nanotherapeutics for the treatment and prevention of acute kidney injury. Asian J. Pharm. Sci. 2021;16(4):432–443. doi: 10.1016/j.ajps.2020.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu Q., Sun S., Yang N., Pei Z., Chen Y., Nie J., Lei H., Wang L., Gong F., Cheng L. Self-cascaded pyroptosis-STING initiators for catalytic metalloimmunotherapy. J. Am. Chem. Soc. 2025;147(4):3161–3173. doi: 10.1021/jacs.4c12552. [DOI] [PubMed] [Google Scholar]
- Zhu Y., Zhang J., Li C., Deng G., Li J., Liu X., Wan B., Tian Y. Porous Se@SiO2 nanoparticles attenuate radiation-induced cognitive dysfunction via modulating reactive oxygen species. ACS Biomater Sci. Eng. 2022;8(3):1342–1353. doi: 10.1021/acsbiomaterials.1c01571. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data will be made available on request.







