Skip to main content
Tropical Parasitology logoLink to Tropical Parasitology
. 2025 Oct 25;15(2):118–124. doi: 10.4103/tp.tp_36_25

Molecular detection and genotyping of Giardia lamblia in diarrheal patients: Analysis of assemblage distribution and risk factors

Heba S Ibrahim 1, Safia S Khalil 1, Mona H El-Sayad 1, Hala A Mohamed 1, Amel Y Shehab 1,
PMCID: PMC12617593  PMID: 41244077

Abstract

Background:

Giardia lamblia (G. lamblia) is a common enteric parasite linked to gastrointestinal illnesses, particularly diarrhea, with its prevalence influenced by various factors.

Aims and Objectives:

This study aimed to detect and genotype G. lamblia in diarrheal patients using real-time PCR with assemblage-specific primers, and to assess associations with potential risk factors.

Materials and Methods:

A total of 332 stool samples were collected and examined microscopically. Genotyping was performed on positive samples using real-time PCR targeting the tpi and gdh genes.

Results:

G. lamblia was detected in 50 samples (15%), with single and mixed infections each accounting for 7.5%. The tpi gene was successfully amplified in all microscopically positive samples, revealing that mixed assemblages A&B (46%) were the most common, followed by assemblage B (32%) and assemblage A (22%). The gdh gene was amplified in 96% of samples, showing a similar pattern: mixed assemblages (42%), assemblage B (36%), and assemblage A (18%). Additionally, dual peaks in the gdh gene suggest genetic variability that may assist in subtyping. Assemblage distribution based on the tpi gene was significantly associated with age, residence, and animal contact but not with gender, water source, or clinical symptoms.

Conclusion:

Real-time PCR effectively detected and genotyped G. lamblia, with a high prevalence of mixed assemblages A&B. The observed genetic variability highlights the importance of molecular tools in understanding Giardia transmission dynamics and supporting targeted public health interventions.

Keywords: Assemblage A, assemblage B, diarrheal disease, glutamate dehydrogenase gene, Giardia lamblia, molecular detection, real-time polymerase chain reaction, triosephosphate isomerase gene

INTRODUCTION

Giardia lamblia (G. lamblia) is a globally prevalent enteric protozoan parasite and the causative agent of giardiasis, an intestinal infection characterized by diarrhea and other gastrointestinal disturbances.[1] Recognizing its public health burden, the World Health Organization included giardiasis in its Neglected Diseases Initiative in 2004, as diarrheal diseases remain among the top 10 causes of mortality worldwide.[2] It is estimated that G. lamblia infects approximately 280 million people annually, with prevalence rates ranging from 2% to 5% in developed countries to as high as 20% to 30% in developing regions.[3,4,5] These disparities are influenced by environmental, socioeconomic, and geographic factors, including water quality, hygiene conditions, and urban–rural differences.[6]

Transmission occurs through the fecal-oral route, primarily via ingestion of cysts in contaminated water or food, or through direct contact with infected individuals or animals.[7] G. lamblia cysts are environmentally resilient, capable of surviving in cold water for extended periods, thereby facilitating persistent environmental contamination and ongoing transmission.[8] Contributing factors such as inadequate sanitation, poor water treatment infrastructure, and overcrowding further exacerbate spread, particularly in resource-limited settings.[9]

Giardiasis presents a broad clinical spectrum, from asymptomatic carriage to acute or chronic gastrointestinal disease.[10] Around half of infections remain asymptomatic, while symptomatic cases can include severe diarrhea, malabsorption, and abdominal discomfort. Disease severity is influenced by host immunity, parasite genotype, and infective dose.[11]

G. lamblia is genetically diverse, comprising eight morphologically indistinguishable assemblages (A–H).[12] Assemblages A and B are the main genotypes infecting humans, with zoonotic potential due to their occurrence in multiple mammalian hosts. While other assemblages (C–H) are typically host-specific, cross-species transmission has been reported, including cases of assemblage E, typically livestock-associated, in human infections.[13]

Molecular diagnostic techniques, particularly polymerase chain reaction (PCR)-based methods, have enhanced the sensitivity and specificity of G. lamblia detection and genotyping, surpassing conventional microscopy. Common genetic markers include small subunit ribosomal RNA (rRNA), β-giardin (bg), glutamate dehydrogenase (gdh), and triosephosphate isomerase (tpi).[14] However, single-locus genotyping may yield inconsistent results, especially in mixed infections. To address this, multilocus genotyping using combinations such as tpi, gdh, and bg has been adopted to improve classification reliability and detect sub-assemblage diversity.[15]

Given the established reliability of the tpi gene and the complementary value of gdh, this study employed real-time PCR with assemblage-specific primers targeting both genes to investigate the distribution of G. lamblia assemblages in diarrheal patients. Additionally, the study explored potential associations between assemblage type and demographic characteristics, risk factors, and clinical presentations.

MATERIALS AND METHODS

Study design

This cross-sectional study was conducted at the Parasitology Department of the Medical Research Institute (MRI), Alexandria University, Egypt. A total of 332 outpatients aged 2–16 years presenting with diarrhea were enrolled in the study. Each participant provided a stool sample and completed a structured questionnaire documenting demographic data, clinical symptoms, water source, and animal contact.

Microscopic examination

All stool samples were examined microscopically for G. lamblia and other intestinal parasites using the formalin-ethyl acetate sedimentation method.[16] Samples that tested negative by microscopy were re-examined as fresh samples on 2 consecutive days. Individuals who remained negative for protozoa and helminths across all examinations were considered confirmed negative.

DNA extraction

Only stool samples confirmed positive for G. lamblia cysts by microscopy were included in the molecular analysis and stored at −-20 °C until further processing. Genomic DNA was extracted using the QIAamp® Fast DNA Stool Mini Kit (QIAGEN, 2020), following the manufacturer’s instructions. DNA quantity and quality were assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). Absorbance ratios at 260/280 and 260/230 nm were used to evaluate purity, with values near 1.8 considered indicative of high-quality DNA. Extracted DNA was stored at − 20°C for subsequent real-time PCR analysis.

Real-time polymerase chain reaction for Giardia lamblia detection and genotyping

To confirm microscopic findings and perform genetic characterization, the 50 samples identified as G. lamblia-positive were analyzed by real-time PCR. Genotyping was conducted using assemblage-specific primers targeting the tpi and gdh genes, which are established markers for distinguishing between assemblages A and B[17] [Table 1].

Table 1.

Oligonucleotide primers targeting the tpi and gdh genes for the detection and amplification of G. lamblia DNA through real-time polymerase chain reaction[18]

Gene Primer sequence Amplified products (bp)
tpi A Forward: 5ʹ-TCGTCATTGCCCCTTCCGCC-3ʹ
Reverse: 3ʹ-CAGTTGAGGATAGCAGCG-5ʹ
77
tpi B Forward: 5ʹ- GATGAACGCAAGGCCAATAA -3ʹ
Reverse: 3ʹ- -AAGAAGGAGATTGGAGAATC -5ʹ
77
gdh A Forward: 5ʹ- CCGGCAACGTTGCCCAGTTT -3ʹ
Reverse: 3ʹ- TCCGAGTTCAAGGACAAGT -5ʹ
180
gdh B Forward: 5ʹ- CGTATTGGCGTCGGCGGT -3ʹ
Reverse: 3ʹ- CTATCAGACCAGAGGCCACA -5ʹ
133

Each PCR reaction was prepared in a 20 µl volume, consisting of 10 µl Maxima SYBR Green PCR Master Mix (Thermo Scientific), 2 µl primer mix (MGX Genotyping Assay), extracted DNA containing 500 ng of template, and nuclease-free water to reach the final volume. Amplification was carried out on a Rotor-Gene PCR system using the following thermal profile: an initial hold at 50°C for 2 min, initial denaturation at 95°C for 10 min, followed by 40–45 cycles of denaturation at 95°C for 15 seconds, annealing at 59°C for 30 s, and extension at 72°C for 30 s. A known Giardia-positive DNA sample and nuclease-free distilled water were included in each run as positive and negative controls, respectively, to ensure assay validity.

Statistical analysis

Data analysis was performed using IBM SPSS software (version 20.0, IBM Corp., Armonk, NY, USA). Qualitative variables were expressed as frequencies and percentages with statistical significance set at P ≤ 0.05. Statistical comparisons between groups were conducted using the Chi-square test, with significance set at P ≤ 0.05. When appropriate, the Monte Carlo test was used to assess statistical significance under nonparametric conditions.

RESULTS

Demographic and microscopic findings

Among the 332 study participants, age groups were fairly balanced, with 33.7% aged 2–10 years, 37.7% aged 10–16, and 28.6% over 16 years. Males and females were nearly equal in proportion, as were rural (51.8%) and urban (48.2%) residents. G. lamblia was detected in 50 samples (15%) by microscopy, with single and mixed infections each comprising 7.5% of the total. Mixed infections included Blastocystis spp. (6.0%) and Entamoeba coli (1.5%) (data not shown in any of the tables). The highest infection rate occurred in children aged 2–10 years (23.2%), showing a significant age association (P < 0.05). Infection was more common in males (17.2%) and rural residents (18%) than in females (12.9%) and urban residents (11.9%), though these differences were not statistically significant [Table 2].

Table 2.

Distribution of G. lamblia infection by demographic data

Variables Total (n=332)
P
Total samples Number positive (%)
Age (years)
  2 <10 112 26 (23.2) χ2=8.8, P=0.012*
  10–16 125 14 (11.2)
  >16 95 10 (10.5)
Gender
  Male 169 29 (17.2) χ2=1.2, P=0.276
  Female 163 21 (12.9)
Residence
  Rural 172 31 (18.0) χ2=2.4, P=0.118
  Urban 160 19 (11.9)

*Statistically significant. χ2: Pearson Chi-square

Molecular characterization of Giardia lamblia

Real-time PCR confirmed tpi gene amplification in all 50 (100%) microscopy-positive samples and gdh gene amplification in 48 (96%) of them [Figure 1]. Mixed assemblages A and B were the most prevalent overall (46%), particularly in co-infections with Blastocystis spp. (50%) and in single infections (48%). Assemblage B was more frequently detected in co-infections with E. coli (60%), while assemblage A showed relatively lower frequency across all categories. However, the differences in assemblage distribution across infection types were not statistically significant (Table 3, MCp = 0.708).

Figure 1.

Figure 1

Diagnostic features of Giardia lamblia (G. lamblia) genotypes by real-time polymerase chain reaction using triosephosphate isomerase (tpi) and glutamate dehydrogenase (gdh) genes and their melting curves analysis: (a) G. lamblia assemblage A detected by the tpi gene (Tm = 82°C–88°C), (b) G. lamblia assemblage B detected by the tpi gene (Tm = 80°C–85°C), (c) G. lamblia assemblage A detected by the gdh gene (Tm = 85°C–90°C), (d) G. lamblia assemblage B detected by the gdh gene, showing two distinct peaks (Tm = 70°C–75°C and 80°C–85°C)

Table 3.

Distribution of Giardia lamblia assemblages in single and mixed infections based on tpi gene analysis

A, n (%) B, n (%) A and B, n (%) P
All infections (50) 11 (22) 16 (32) 23 (46) MCP=0.708
Single G. lamblia infections (25) 6 (24) 7 (26) 12 (48)
G. lamblia + Blastocystis spp. (20) 4 (20) 6 (30) 10 (50)
G. lamblia + Entamoeba coli (5) 1 (20) 3 (60) 1 (20)

G. lamblia: Giardia lamblia, MCp: Monte Carlo significance

Association of Giardia lamblia assemblages with demographic characteristics, risk factors, and clinical manifestations

Table 4 shows the distribution of G. lamblia assemblages based on tpi gene analysis across various demographic and risk factors. Mixed assemblages A and B were most prevalent in younger children (61.5%) and declined with age, while assemblage A predominated among individuals over 16 years, a statistically significant association. Males had a higher proportion of mixed infections (55.2%), whereas females more frequently harbored assemblage B; however, this gender difference was not statistically significant. Mixed assemblages were more common among rural residents (64.5%), while urban participants had higher rates of assemblage B. No significant association was found between assemblage type and drinking water source. In contrast, animal contact was strongly associated with mixed infections (62.2%), while individuals without animal exposure were more often infected with assemblage B. Clinically, mixed assemblages were the most frequent genotype in patients presenting with diarrhea alone as well as those with diarrhea and additional gastrointestinal symptoms. However, differences in assemblage distribution across symptom categories were not statistically significant.

Table 4.

Distribution of Giardia lamblia assemblages based on tpi gene analysis in relation to demographic data, risk factors, and clinical manifestations

Factors Number positive A (n=11), n (%) B (n=16), n (%) A and B (n=23), n (%) P
Age/years
  2<10 26 2 (7.7) 8 (30.8) 16 (61.5) MCp=0.007*
  10–16 14 3 (21.4) 5 (35.7) 6 (42.9)
  >16 10 6 (60) 3 (30) 1 (10)
Gender
  Male 29 6 (20.7) 7 (24.1) 16 (55.2) χ2=2.6, P=0.305
  Female 21 5 (23.8) 9 (42.9) 7 (33.3)
Residence
  Rural 31 5 (16.1) 6 (19.4) 20 (64.5) χ2=11.4, P=0.003*
  Urban 19 6 (31.6) 10 (52.6) 3 (15.8)
Source of drinking water
  Tap 32 7 (21.9) 9 (28.1) 16 (50) χ2=0.72, P=0.75
  Filter 18 4 (22.2) 7 (38.9) 7 (38.9)
Animal contact
  Yes 37 8 (21.6) 6 (16.2) 23 (62.2) χ2=19.2, P<0.001*
  No 13 3 (23.1) 10 (76.9) 0
Symptoms
  Diarrhea with other symptoms (nausea, vomiting, anorexia) 39 10 (25.6) 12 (30.8) 17 (43.6) MCp=0.566
  Isolated diarrhea 11 1 (9.1) 4 (36.4) 6 (54.5)

*Statistically significant. χ2: Pearson Chi-square. MCp: Monte Carlo significance

DISCUSSION

Giardiasis remains a significant contributor to diarrheal illness worldwide, particularly among children. The present study provides insights into the detection and genotyping of G. lamblia in diarrheal patients using real-time PCR, along with the distribution of assemblages in relation to demographic, environmental, and clinical factors. The overall detection rate of Giardia infection in diarrheal stool samples, as determined by microscopy, was 15%. This result is consistent with prior studies in Egypt conducted by Elhadad et al., who reported an 18.1% prevalence, and Ismail et al., who recorded a prevalence of 11.4%.[19,20] Similarly, Basheer Mohammed documented a 6.15% infection rate among children in Iraq, which falls within the range commonly reported in comparable regional studies.[21]

In the current study, children aged 2 <10 years exhibited significantly higher infection rates than older age groups. This trend is attributed to age-related behaviors such as inadequate hygiene and closer contact in communal settings, coupled with an immature immune response. Similar patterns of age-related vulnerability have been reported by Abozahra et al.,[22] as well as in studies from Ethiopia and Brazil.[5,23] Although males and rural residents showed higher infection rates in the present study, differences were not statistically significant. These trends parallel findings from the study by Khattak et al.,[24] who also reported nonsignificant gender differences but identified rural residency as a risk factor likely, due to limited access to clean water and sanitation.

All 50 microscopy-positive samples in the present study were confirmed by real-time PCR targeting the tpi gene, while the gdh gene was successfully amplified in 48 samples (96%). The tpi gene appears to be a more reliable target for detecting G. lamblia DNA, likely due to its genetic heterogeneity and reduced susceptibility to primer mismatches or DNA degradation, particularly in low-concentration or inhibitor-rich samples. Previous studies have similarly reported high tpi amplification rates, Elhadad et al.[19] observed 100% positivity in microscopy-confirmed samples, while Ahmad et al. and Huey et al. found tpi to outperform gdh.[25,26] These findings are further supported by a comparative study conducted by Weinreich et al.,[27] which demonstrated that while 18S rRNA assays achieved the highest sensitivity due to their multi-copy nature, tpi and bg genes still outperformed the single-copy gdh gene in both sensitivity and cycle threshold values, likely due to more efficient primer binding and amplification. Variability in amplification efficiency may also be influenced by factors such as sample quality, primer design, and regional strain diversity.[28]

G. lamblia shows significant genetic diversity, with assemblages A and B most frequently linked to human infections. Their differences in host range and genetic traits make genotyping essential. Assemblage genotyping in the present study revealed a predominance of mixed A and B assemblages, comprising 46% of tpi-positive and 42% of gdh-positive samples. Assemblage B was the next most common, followed by assemblage A. Mixed assemblage infection arises when a host is exposed to genetically distinct Giardia strains, either simultaneously or through repeated exposure, and is particularly common in endemic regions.[29,30] The high frequency of such infections may reflect a complex transmission environment involving contaminated water sources, animal reservoirs, and recurrent exposure in the absence of full immune clearance.[11] These findings align with reports from Egypt by Elhadad et al.[19] who also detected mixed assemblages at a very similar rate (47.4%). Elsewhere, a study by Almeida et al.[18] in Portugal detected frequent mixed assemblages using real-time PCR, and Cuellar et al.[31] in Honduras found mixed infections in 61.1% of tpi-amplified cases. In contrast, lower rates of mixed infections have been documented in India and Canada, where assemblage B typically dominates.[32,33] Such differences may reflect regional variation in exposure routes, diagnostic tools, sanitation practices, water access, public health infrastructure, as well as levels of population immunity and strain diversity within communities.

Dual melting peaks observed in gdh gene analysis in the current study suggest intra-assemblage variability or subgenotypic diversity, potentially indicating genetic recombination or co-infection with closely related strains. Frickmann et al. (2021)[34] similarly reported this heterogeneity in assemblage B, highlighting its potential impact on pathogenicity, transmission dynamics, and treatment response across genotypes.

Assemblage distribution in the present study showed significant associations with age, residence, and animal contact. Mixed assemblages were more prevalent among younger children, rural dwellers, and those reporting direct contact with animals. These associations support the hypothesis of environmental and zoonotic transmission, particularly in endemic areas. Similar findings have been reported in Egypt by Taha et al.[35] and Naguib et al.,[36] and in Portugal by Almeida et al.,[18] while other studies from high-income settings have shown weaker or inconsistent associations, possibly due to differences in hygiene infrastructure and exposure risks.[37,38] Although waterborne transmission of Giardia is well established, the specific distribution of assemblages in water remains unclear. In this study, tap water consumption was linked to higher rates of mixed infections, although the association was not statistically significant. Similar observations were made by Fahmy et al.,[39] while Abd Ellatif et al.[40] highlighted the protective role of water filtration. No significant association was observed between assemblage type and clinical presentation in the present study, which may be attributed to the influence of host-related factors that can modulate symptom severity regardless of the infecting Giardia genotype. Mixed assemblages were common among individuals with diarrhea alone as well as those with additional gastrointestinal symptoms. This is in line with studies from Zajaczkowski et al.,[15] and Ahmad et al.,[25] and other countries, including Ghana,[34] Malaysia,[41] and Iran,[42] which collectively suggest that clinical outcomes may depend more on host immunity, nutritional status, or co-infections than on parasite genotype. While some reports have linked assemblage B to more severe or prolonged symptoms,[43,44] others including Choy et al.[45] found no clear correlation between assemblage and symptom severity. These discrepancies may also reflect differences in intra-assemblage variation, endemicity, or the introduction of novel genotypes, which may provoke stronger symptoms in immunologically naïve populations.[46]

CONCLUSION

This study supports the efficacy of real-time PCR targeting the tpi and gdh genes in the detection and molecular characterization of G. lamblia among diarrheal patients. The high prevalence of mixed assemblages A and B, particularly among young children, rural residents, and individuals with animal contact, highlights the interaction between environmental and zoonotic transmission routes. Additionally, the detection of dual melting peaks in the gdh gene reflects underlying genetic heterogeneity, which warrants further investigation.

Ethical considerations

The study was conducted in accordance with the guidelines of the Research Ethics Committee of the MRI (IORG 0008812). Informed consent was obtained from the participants involved in the study.

Conflicts of interest

There are no conflicts of interest.

Funding Statement

Nil.

REFERENCES

  • 1.Bartelt LA, Sartor RB. Advances in understanding Giardia: Determinants and mechanisms of chronic sequelae. F1000Prime Rep. 2015;7:62. doi: 10.12703/P7-62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Savioli L, Smith H, Thompson A. Giardia and cryptosporidium join the ‘neglected diseases initiative’. Trends Parasitol. 2006;22:203–8. doi: 10.1016/j.pt.2006.02.015. [DOI] [PubMed] [Google Scholar]
  • 3.Ankarklev J, Jerlström-Hultqvist J, Ringqvist E, Troell K, Svärd SG. Behind the smile: Cell biology and disease mechanisms of Giardia species. Nat Rev Microbiol. 2010;8:413–22. doi: 10.1038/nrmicro2317. [DOI] [PubMed] [Google Scholar]
  • 4.Hill DR, Nash TE. Intestinal flagellate and ciliate infections. In: Guerrant RL, Walker DH, Weller PF, editors. Tropical Infectious Diseases: Principles, Pathogens & Practice. 3rd. Philadelphia: Churchill Livingtson; 2011. pp. 623–32. [Google Scholar]
  • 5.Hajare ST, Chekol Y, Chauhan NM. Assessment of prevalence of Giardia lamblia infection and its associated factors among government elementary school children from Sidama zone, SNNPR, Ethiopia. PLoS One. 2022;17:e0264812. doi: 10.1371/journal.pone.0264812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Yibeltal M, Simenew K. A systematic review on neglected important protozoan zoonoses. Int J Adv Res Biol Sci. 2015;2:53–65. [Google Scholar]
  • 7.Reses HE, Gargano JW, Liang JL, Cronquist A, Smith K, Collier SA, et al. Risk factors for sporadic Giardia infection in the USA: A case-control study in Colorado and Minnesota. Epidemiol Infect. 2018;146:1071–8. doi: 10.1017/S0950268818001073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Thompson RC, Monis P. Giardia – From genome to proteome. Adv Parasitol. 2012;78:57–95. doi: 10.1016/B978-0-12-394303-3.00003-7. [DOI] [PubMed] [Google Scholar]
  • 9.Melese B, Paulos W, Astawesegn FH, Gelgelu TB. Prevalence of diarrheal diseases and associated factors among under-five children in Dale District, Sidama zone, Southern Ethiopia: A cross-sectional study. BMC Public Health. 2019;19:1235. doi: 10.1186/s12889-019-7579-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Currie SL, Stephenson N, Palmer AS, Jones BL, Hawkins G, Alexander CL. Under-reporting giardiasis: Time to consider the public health implications. Epidemiol Infect. 2017;145:3007–11. doi: 10.1017/S0950268817001959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Halliez MC, Buret AG. Extra-intestinal and long term consequences of Giardia duodenalis infections. World J Gastroenterol. 2013;19:8974–85. doi: 10.3748/wjg.v19.i47.8974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Berrilli F, D’Alfonso R, Giangaspero A, Marangi M, Brandonisio O, Kaboré Y, et al. Giardia duodenalis genotypes and Cryptosporidium species in humans and domestic animals in Côte d’Ivoire: Occurrence and evidence for environmental contamination. Trans R Soc Trop Med Hyg. 2012;106:191–5. doi: 10.1016/j.trstmh.2011.12.005. [DOI] [PubMed] [Google Scholar]
  • 13.Pantchev N, Broglia A, Paoletti B, Globokar Vrhovec M, Bertram A, Nöckler K, et al. Occurrence and molecular typing of Giardia isolates in pet rabbits, chinchillas, guinea pigs and ferrets collected in Europe during 2006-2012. Vet Rec. 2014;175:18. doi: 10.1136/vr.102236. [DOI] [PubMed] [Google Scholar]
  • 14.Feng Y, Xiao L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin Microbiol Rev. 2011;24:110–40. doi: 10.1128/CMR.00033-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Zajaczkowski P, Lee R, Fletcher-Lartey SM, Alexander K, Mahimbo A, Stark D, et al. The controversies surrounding Giardia intestinalis assemblages A and B. Curr Res Parasitol Vector Borne Dis. 2021;1:100055. doi: 10.1016/j.crpvbd.2021.100055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Garcia LS, Procop GW. Manual of Commercial Methods in Clinical Microbiology. 2nd. Washington, DC: ASM Press; 2016. Diagnostic Medical Parasitology; pp. 284–308. [Google Scholar]
  • 17.Wu Y, Yao L, Chen H, Zhang W, Jiang Y, Yang F, et al. Giardia duodenalis in patients with diarrhea and various animals in Northeastern China: Prevalence and multilocus genetic characterization. Parasit Vectors. 2022;15:165. doi: 10.1186/s13071-022-05269-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Almeida A, Pozio E, Caccio SM. Genotyping of Giardia duodenalis cysts by new real-time PCR assays for detection of mixed infections in human samples. Appl Environ Microbiol. 2010;76:1895–901. doi: 10.1128/AEM.02305-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Elhadad H, Abdo S, Tolba M, Salem AI, Mohamed MA, El-Abd EA, et al. Detection of Giardia intestinalis assemblages A and B among children from three villages in the West Delta region, Egypt using assemblage specific primers. J Parasit Dis. 2021;45:655–63. doi: 10.1007/s12639-020-01338-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ismail M, Eassa A, Mahgoub AM, El-Dib N. Review of parasitic zoonotic infections in Egypt. Kasr Al Ainy Med J. 2018;24:91–100. [Google Scholar]
  • 21.Basheer Mohammed A. Incidence and molecular detection of genotypes for Giardia lamblia isolated from children in Zakho District, Duhok Province, Kurdistan Region, Iraq. Cureus. 2024;16:e66626. doi: 10.7759/cureus.66626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Abozahra R, Mokhles M, Baraka K. Molecular genotyping of Giardia lamblia assemblages by conventional PCR in rural and urban areas in Egypt. Microbes Infect Dis. 2021;2:378–85. [Google Scholar]
  • 23.Newman RD, Moore SR, Lima AA, Nataro JP, Guerrant RL, Sears CL. A longitudinal study of Giardia lamblia infection in North-East Brazilian children. Trop Med Int Health. 2001;6:624–34. doi: 10.1046/j.1365-3156.2001.00757.x. [DOI] [PubMed] [Google Scholar]
  • 24.Khattak I, Yen WL, Usman T, Nasreen N, Khan A, Ahmad S, et al. Individual and community-level risk factors for giardiasis in children under five years of age in Pakistan: A prospective multi-regional study. Children (Basel) 2023;10:1087. doi: 10.3390/children10061087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ahmad AA, El-Kady AM, Hassan TM. Genotyping of Giardia duodenalis in children in upper Egypt using assemblage- specific PCR technique. PLoS One. 2020;15:e0240119. doi: 10.1371/journal.pone.0240119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Huey CS, Mahdy MA, Al-Mekhlafi HM, Nasr NA, Lim YA, Mahmud R, et al. Multilocus genotyping of Giardia duodenalis in Malaysia. Infect Genet Evol. 2013;17:269–76. doi: 10.1016/j.meegid.2013.04.013. [DOI] [PubMed] [Google Scholar]
  • 27.Weinreich F, Hahn A, Eberhardt KA, Kann S, Feldt T, Sarfo FS, et al. Comparative evaluation of real-time screening PCR assays for Giardia duodenalis and of assays discriminating the assemblages A and B. Microorganisms. 2022;10:1310. doi: 10.3390/microorganisms10071310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Thompson RC, Ash A. Molecular epidemiology of Giardia and Cryptosporidium infections. Infect Genet Evol. 2016;40:315–23. doi: 10.1016/j.meegid.2015.09.028. [DOI] [PubMed] [Google Scholar]
  • 29.Cacciò SM, Ryan U. Molecular epidemiology of giardiasis. Mol Biochem Parasitol. 2008;160:75–80. doi: 10.1016/j.molbiopara.2008.04.006. [DOI] [PubMed] [Google Scholar]
  • 30.Sprong H, Cacciò SM, van der Giessen JW, ZOOPNET Network and Partners Identification of zoonotic genotypes of Giardia duodenalis. PLoS Negl Trop Dis. 2009;3:e558. doi: 10.1371/journal.pntd.0000558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Cuellar E, Pinto MA, Mendoza JL, Fontecha G. Genotyping of Giardia intestinalis from schoolchildren in honduras. Rev Panam Enferm Infecc. 2018;1:64–7. [Google Scholar]
  • 32.Laishram S, Kang G, Rao Ajjampur S. Giardiasis: A review on assemblages distribution and epidemiology in India. Indian J Gastroentrol. 2012;31:3–12. doi: 10.1007/s12664-012-0161-9. [DOI] [PubMed] [Google Scholar]
  • 33.Prystajecky N, Tsui CK, Hsiao WW, Uyaguari-Diaz MI, Ho J, Tang P, et al. Giardia spp. Are commonly found in mixed assemblages in surface water, as revealed by molecular and whole-genome characterization. Appl Environ Microbiol. 2015;81:4827–34. doi: 10.1128/AEM.00524-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Frickmann H, Hoffmann T, Köller T, Hahn A, Podbielski A, Landt O, et al. Comparison of five commercial real-time PCRs for in-vitro diagnosis of Entamoeba histolytica, Giardia duodenalis, Cryptosporidium spp., Cyclospora cayetanensis, and Dientamoeba fragilis in human stool samples. Travel Med Infect Dis. 2021;41:102042. doi: 10.1016/j.tmaid.2021.102042. [DOI] [PubMed] [Google Scholar]
  • 35.Taha SA, Abd Al Aal Z, Saleh NS, El-Badry AA. Giardia intestinalis assemblages among Egyptian symptomatic children: Prevalence and seasonal distribution in Cairo, Egypt. J Egypt Soc Parasitol. 2018;48:661–8. [Google Scholar]
  • 36.Naguib D, El-Gohary AH, Roellig D, Mohamed AA, Arafat N, Wang Y, et al. Molecular characterization of Cryptosporidium spp. and Giardia duodenalis in children in Egypt. Parasit Vectors. 2018;11:403. doi: 10.1186/s13071-018-2981-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Vanni I, Cacciò SM, van Lith L, Lebbad M, Svärd SG, Pozio E, et al. Detection of Giardia duodenalis assemblages A and B in human feces by simple, assemblage-specific PCR assays. PLOS Neglect Trop Dis. 2012;6:e1776. doi: 10.1371/journal.pntd.0001776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wang Y, Moreno OG, Roellig DM, Oliver L, Huguet J, Guo Y, et al. Epidemiological distribution of genotypes of Giardia duodenalis in humans in Spain. Parasit Vectors. 2019;12:432. doi: 10.1186/s13071-019-3692-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Fahmy HM, El-Serougi AO, El Deeb HK, Hussein HM, Abou-Seri HM, Klotz C, et al. Giardia duodenalis assemblages in Egyptian children with diarrhea. Eur J Clin Microbiol Infect Dis. 2015;34:1573–81. doi: 10.1007/s10096-015-2389-7. [DOI] [PubMed] [Google Scholar]
  • 40.Abd Ellatif N, Mohamed M, El-Taweel H, Hamam M, Saudi M. Intestinal protozoa in diarrheic children in an Egyptian rural area: Role of water contamination and other possible risk factors. Parasitol United J. 2018;11:82–9. [Google Scholar]
  • 41.Mahdy AM, Surin J, Wan KL, Mohd-Adnan A, Al-Mekhlafi MH, Lim YA. Giardia intestinalis genotypes: Risk factors and correlation with clinical symptoms. Acta Trop. 2009;112:67–70. doi: 10.1016/j.actatropica.2009.06.012. [DOI] [PubMed] [Google Scholar]
  • 42.Bahrami F, Zamini GH, Haghighi A, Khademerfan MB. Detection and molecular identification of human Giardia isolates in the West of Iran. Biomed Res. 2017;28:5687–92. [Google Scholar]
  • 43.Pelayo L, Nunez FA, Rojas L, Furuseth Hansen E, Gjerde B, Wilke H, et al. Giardia infections in Cuban children: The genotypes circulating in a rural population. Ann Trop Med Parasitol. 2008;102:585–95. doi: 10.1179/136485908X355247. [DOI] [PubMed] [Google Scholar]
  • 44.Hussein EM, Ismail OA, Mokhtar AB, Mohamed SE, Saad RM. Nested PCR targeting intergenic spacer (IGS) in genotyping of Giardia duodenalis isolated from symptomatic and asymptomatic infected Egyptian school children. Parasitol Res. 2017;116:763–71. doi: 10.1007/s00436-016-5347-0. [DOI] [PubMed] [Google Scholar]
  • 45.Choy SH, Al-Mekhlafi HM, Mahdy MA, Nasr NN, Sulaiman M, Lim YA, et al. Prevalence and associated risk factors of Giardia infection among indigenous communities in rural Malaysia. Sci Rep. 2014;4:6909. doi: 10.1038/srep06909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Robertson LJ, Hanevik K, Escobedo AA, Mørch K, Langeland N. Giardiasis-why do the symptoms sometimes never stop? Trends Parasitol. 2010;26:75–82. doi: 10.1016/j.pt.2009.11.010. [DOI] [PubMed] [Google Scholar]

Articles from Tropical Parasitology are provided here courtesy of Wolters Kluwer -- Medknow Publications

RESOURCES