Detection of bla _NDM‐1 and bla _IMP‐1 Metallo‐β‐Lactamases in Meropenem‐Resistant Clinical Escherichia coli Isolates Using Modified Carbapenem Inactivation Method (mCIM) and PCR Techniques

ABSTRACT

Introduction

Escherichia coli , a member of the Enterobacteriaceae family, is a leading cause of various infections. Carbapenems, a potent class of β‐lactam antibiotics, serve as the last line of defense against multidrug‐resistant bacteria. However, the global rise of carbapenemase‐producing E. coli (CP‐Ec), particularly metallo‐β‐lactamases (MBLs), poses a significant public health concern. This study aimed to determine the prevalence of bla _NDM‐1 and bla _IMP‐1 genes in E. coli strains isolated from clinical samples.

Methods

A cross‐sectional study was conducted on 80 meropenem‐resistant E. coli strains isolated from clinical samples. Bacterial identification was performed using biochemical tests, including IMViC. Carbapenemase production was assessed using the modified carbapenem inactivation method (mCIM). Genotypic analysis of carbapenem‐resistant strains was conducted via polymerase chain reaction (PCR) to detect bla _NDM‐1 and bla _IMP‐1 genes.

Results

The mCIM phenotypic test identified 46.25% (37/80) of isolates as carbapenemase producers. PCR analysis revealed that bla _NDM‐1 was more prevalent than bla _IMP‐1 (48.65% vs. 16.22%). Four isolates (10.81%) carried both genes. Notably, 35.14% (13/37) of meropenem‐resistant E. coli isolates tested negative for both bla _NDM‐1 and bla _IMP‐1, indicating the possible involvement of other carbapenemase genes such as bla _VIM or non‐carbapenemase mechanisms.

Conclusion

The detection of bla _NDM‐1 and bla _IMP‐1 genes in E. coli highlights the alarming spread of carbapenem resistance. The presence of resistant strains lacking these genes suggests additional resistance mechanisms, warranting further investigation.

This study examines the prevalence of bla _NDM‐1 and bla _IMP‐1 metallo‐β‐lactamase genes in meropenem‐resistant Escherichia coli isolates using mCIM and PCR. The results indicate a higher prevalence of bla _NDM‐1 and suggest the presence of alternative resistance mechanisms in some strains, emphasizing the need for further research on antimicrobial resistance.

1. Introduction

Carbapenem‐resistant Enterobacterales (CRE), including Escherichia coli ( E. coli ), pose a significant global health threat due to their increasing mortality rates and community transmission [1]. E. coli , a member of the Enterobacteriaceae family, is an opportunistic pathogen responsible for a wide range of infections, including urinary tract infections (UTIs), bloodstream infections (BSIs), hemolytic‐uremic syndrome (HUS), surgical site infection (SSI), septic shock, sepsis, meningitis, and hospital‐acquired infections (HAIs) [2]. The increasing prevalence of CRE is a growing global public health concern [3]. Carbapenems, as potent β‐lactam antibiotics, are considered the last resort for treating infections caused by multidrug‐resistant (MDR) Gram‐positive and Gram‐negative bacteria [4]. The rise and global dissemination of carbapenemase‐producing E. coli (CP‐Ec) strains have compromised empirical carbapenem therapy, presenting a major worldwide health challenge [5, 6].

One of the key mechanisms of carbapenem resistance is the hydrolysis of carbapenems by carbapenemase enzymes, which are primarily plasmid‐encoded and highly transmissible. According to the Ambler classification, β‐lactamases are categorized into four classes—A, B, C, and D—based on their catalytic domain structure and substrate specificity [7]. Carbapenemases in classes A, C, and D possess a serine residue at their active catalytic site, whereas class B carbapenemases contain a zinc (Zn) ion at their active site. Due to this metal dependency, class B enzymes are referred to as metallo‐β‐lactamases (MBLs) [8]. Figure 1 details the classification of carbapenemases based on their molecular structure and functional properties.

FIGURE 1.

Classification of β‐Lactamases. Molecular Classification (Ambler System): According to the Ambler classification, β‐lactamases are categorized into four classes: A, B, C (oxacillinases), and D. Class A, C, and D β‐lactamases utilize serine at their active catalytic site, whereas class B β‐lactamases require zinc (Zn) for their enzymatic activity. Functional Classification (Bush‐Jacobi‐Medeiros System): In the Bush‐Jacobi‐Medeiros classification system, β‐lactamases are grouped into categories 1 to 3 based on their substrate hydrolysis profile and inhibitor susceptibility [7].

Carbapenemases, among β‐lactamases, display the greatest diversity and broadest activity, enabling them to hydrolyze a wide range of β‐lactam antibiotics. Most of these enzymes exhibit resistance to β‐lactamase inhibitors, including clavulanic acid, sulbactam, tazobactam, and avibactam [9]. Nonenzymatic mechanisms of carbapenem resistance include the loss of porin‐encoding gene expression, mutations in chromosomally encoded porin genes, and the overexpression of efflux pump‐encoding genes [10].

The first acquired metallo‐β‐lactamase (MBL), bla _IMP, was reported in clinical isolates of Pseudomonas aeruginosa and Serratia marcescens in Japan during the 1990s. Since then, the IMP family has expanded to include more than 85 different variants [6]. bla _IMP has become particularly prevalent in Asia, with bla _IMP‐1 being the most commonly identified variant [11].

The metallo‐β‐lactamase bla _NDM‐1, which has become a global concern and is the most widespread MBL in Enterobacteriaceae and Acinetobacter baumannii , was first identified in K. pneumoniae and E. coli isolates from a patient who had traveled from New Delhi to Sweden in 2008. Since then, 41 bla _NDM variants have been documented [12]. As of mid‐August 2010, bla _NDM‐1‐producing bacteria have been identified on every continent except Central and South America, with most cases linked to the Indian subcontinent (Figure 2).

FIGURE 2.

Geographic Distribution of New Delhi Metallo‐β‐Lactamase‐1 (bla _NDM‐1) Producers, July 15, 2011. The size of the stars represents the number of reported cases. Red stars indicate infections linked to India, Pakistan, or Bangladesh. Green stars represent infections traced back to the Balkans or the Middle East. Black stars denote infections with an unknown origin [13].

Numerous reports from around the world confirm the presence of this group of β‐lactamases in Enterobacteriaceae [14, 15]. Currently, E. coli strains producing MBLs are being reported worldwide. These enzymes have a broad substrate spectrum and can hydrolyze all β‐lactams except monobactams (e.g., aztreonam). MBL genes are often embedded within integrons, allowing their incorporation into plasmids or chromosomes, which facilitates their transfer between bacteria and across different Enterobacteriaceae species.

Given the widespread distribution of MBLs and the lack of studies on their prevalence in northwestern Iran, the present study aimed to investigate the occurrence of bla _NDM‐1 (New Delhi metallo‐β‐lactamase‐1) and bla _IMP‐1 (Imipenemase‐1) genes in E. coli isolates from clinical samples using the mCIM phenotypic test and polymerase chain reaction (PCR) in East Azerbaijan Province, Iran.

2. Materials and Methods

This cross‐sectional study was conducted on 80 meropenem‐resistant E. coli strains isolated from clinical samples of patients referred to diagnostic laboratories in East Azerbaijan Province, Iran. Sample collection took place between May and November 2024.

After transferring the microbial samples to the laboratory and identifying E. coli strains, a concentrated suspension was prepared in Tryptic Soy Broth (TSB) medium containing 15% glycerol. A 2 mL aliquot of each bacterial suspension was transferred into a sterile cryotube and stored at −70°C until further testing [16].

Identification of E. coli strains was performed using biochemical tests including the IMViC panel (indole, methyl red, Voges‐Proskauer, and Simmons citrate tests), as well as urease production and triple sugar iron (TSI) tests [17].

The resistance of all isolates to meropenem was assessed using the Kirby–Bauer method with a 10 μg meropenem disk on Mueller–Hinton Agar and confirmed according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (inhibition zone ≤ 19 mm) [18].

2.1. Phenotypic Identification of Carbapenemase‐Producing Strains Using the mCIM Test

Carbapenemase‐producing strains were identified using the Modified Carbapenem Inactivation Method (mCIM) in accordance with the CLSI guidelines [18]. This test is one of the most effective phenotypic methods for detecting carbapenemase‐producing strains. According to previous studies, the sensitivity and specificity of the mCIM have been reported as 99% and 100%, respectively, for Enterobacteriaceae [19, 20].

The mCIM test is based on the inactivation of meropenem by carbapenemase enzymes produced by the test strain. This assay is particularly important when enzyme production levels are low or when new carbapenemase variants are present [19].

In addition to mCIM, several validated phenotypic methods have been developed for the detection of carbapenemase‐producing organisms. These include the Carba NP test and its improved version (CNPt‐direct), the Modified Rapid Carbapenem Inactivation Method (mrCIM) for expedited detection, the Rapid EDTA‐Modified Carbapenem Inactivation Method (reCIM) for distinguishing MBLs within 4 h, the Blue‐Carba Test (BCT), the Combined Disk Test (CDT), the CarbaLux assay (a novel fluorescence‐based method), and the Rosco Neo‐Rapid CARB Kit [21, 22, 23, 24, 25].

Recent studies have demonstrated that no phenotypic method exhibits complete superiority across all conditions and is subject to limitations depending on the type of carbapenemase and bacterial species. Consequently, the integration of phenotypic methods with molecular techniques, including conventional PCR and real‐time PCR, is considered essential for the precise detection and confirmation of carbapenemase‐encoding genes [21].

2.2. Procedure for the mCIM Test

A loopful of the bacterial suspension was inoculated into 2 mL of TSB (Tryptic Soy Broth) and vortexed for 10–15 s. A 10 μg meropenem (MEM) disk (Patten Teb, Iran) was placed in the TSB medium, ensuring it was completely submerged. The tubes were incubated at 35°C for 4 h. Near the end of the incubation, a suspension of the indicator strain ( E. coli ATCC 25922, carbapenem‐susceptible) was prepared to a turbidity equivalent to 0.5 McFarland and uniformly spread onto Mueller–Hinton Agar (MHA). After 4 h of incubation, the meropenem disks were carefully removed from the TSB medium, excess liquid was drained by pressing the disc against the tube wall, and the disks were placed onto the surface of the MHA plate containing the indicator strain. The plates were incubated at 35°C for 24 h. Following incubation, the diameter of the inhibition zones was measured, as in the standard disk diffusion method, and carbapenemase‐producing strains were selected for further studies [18, 19].

For quality control, K. pneumoniae ATCC BAA‐1705 and K. pneumoniae ATCC BAA‐1706 were used as positive (carbapenemase‐producing) and negative (non‐carbapenemase‐producing) controls, respectively [18].

2.3. mCIM Test Interpretation

Inhibition zone diameters of 6–15 mm, as well as 16–18 mm with the presence of pinpoint colonies, were reported as carbapenemase‐positive. Diameters of ≥ 19 mm without any pinpoint colonies were reported as carbapenemase‐negative. Diameters of 16–18 mm without pinpoint colonies were considered inconclusive, and the test was repeated [18].

Genotypic detection of bla _NDM‐1 and bla _IMP‐1 metallo‐β‐lactamase genes was performed using polymerase chain reaction (PCR).

2.4. DNA Extraction Using the Boiling Method

DNA extraction was performed using the boiling method [26]. Several colonies of meropenem‐resistant E. coli (MREC) strains were transferred to a sterile microtube containing 300 μL of sterile 1X TE buffer and vortexed. The suspension was boiled at 100°C for 10 min in a water bath. The tubes were centrifuged at 13,000 × g for 10 min. The supernatant, containing the extracted template DNA, was transferred to a sterile microtube for PCR analysis. All strains were tested for the presence of carbapenemase genes (bla _NDM‐1 and bla _IMP‐1) using PCR with specific primers.

2.5. Primer Design and Preparation

The primers used in this study were designed de novo using Primer3 (version 2.5.0), an online tool provided by the National Center for Biotechnology Information (NCBI). Reference sequences for the bla _NDM‐1 (accession no. OM937933.1) and bla _IMP‐1 (accession no. MK088089.1) genes were retrieved from the NCBI GenBank database and used for primer design. All designed primers were analyzed for critical parameters, including: length, GC%, melting temperature (Tm), self‐complementarity, and self‐3′ complementarity. After primer design, their specificity and quality were verified before ordering to ensure optimal performance. This validation process included the use of the NCBI Primer‐BLAST tool to confirm the absence of nonspecific binding to unintended genomic regions. The primers were obtained in lyophilized form. These primers amplified 443 and 430 base pairs of the bla _NDM‐1 and bla _IMP‐1 genes, respectively. The final primer sequences and properties are summarized in Table 1.

TABLE 1.

Primer specifications for amplification of bla _NDM‐1 and bla _IMP‐1 genes.

NCBI reference sequence	Target gene	Sequence (5′ → 3′)	Product length	GC%	Tm	Self‐3՛ complementarity
OM937933.1	bla NDM‐1	F: GGCCAGCAAATGGAAACTGG	443 bp	55	60.04	0.00
		R: AATACCTTGAGCGGGCCAAA		50	59.96	2.00
MK088089.1	bla IMP‐1	F: CACTTGGTTTGTGGAGCGTG	430 bp	55	59.97	0.00
		R: TGCGTCTCCAACTTCACTGT		50	59.54	3.00

2.6. Primer Reconstitution and Storage

Before opening, the lyophilized primers were spun at high speed for 10 min. Based on the manufacturer's instructions, an appropriate volume of sterile double‐distilled water was added to reconstitute the primers. The primers were thoroughly mixed, and master stock (100 pmol) and working stock (10 pmol) solutions were prepared. The primer solutions were stored at −20°C. To prevent contamination, all primer preparation steps were conducted in a sterile laminar flow hood.

2.7. PCR Optimization

To optimize the PCR conditions and obtain the best results, the reaction parameters were refined by determining the optimal annealing temperature. Annealing temperature is a critical factor in optimizing PCRs; therefore, a temperature gradient approach was applied. An initial PCR test was performed for each primer using genomic DNA extracted from K. pneumoniae . The optimal annealing temperature was determined and saved in the Eppendorf Gradient Mastercycler system.

2.8. PCR Setup

PCRs were carried out in a total volume of 25 μL (as shown in Table 2) using a thermal cycler with a temperature gradient function (Eppendorf, Germany).

TABLE 2.

PCR components and their volumes.

Component	Volume (μL)	Final concentration
Taq DNA polymerase 2× master mix (MgCl2: 2 mM)	12.5 μL	1X
Template DNA	1 μL	< 1 ng
Forward primer (10 pmol)	0.5 μL	0.2 pmol
Reverse primer (10 pmol)	0.5 μL	0.2 pmol
Nuclease‐free water	10.5 μL	—
Total volume	25 μL	—

2.9. PCR Thermal Cycling Conditions

The PCR conditions for amplifying bla _NDM‐1 and bla _IMP‐1 were as follows:

1. Initial denaturation: 95°C for 4 min

2. 35 cycles of:

   • ○
     Denaturation: 94°C for 30 s
   • ○
     Annealing: 65°C for 30 s
   • ○
     Extension: 72°C for 50 s

3. Final extension: 72°C for 10 min

4. Hold: 4°C

2.10. PCR Product Analysis

For electrophoretic analysis of the PCR amplicons, 3 μL of each PCR product was loaded onto a 1.5% agarose gel for electrophoresis. After electrophoresis, the gel was stained with Gel Red DNA stain and visualized under UV light using a Gel Doc system (ATP Co.). The size of PCR bands was determined using a 100 bp + 3 K DNA ladder. For quality control, carbapenemase‐producing strains were included as positive controls, while nuclease‐free water was used instead of template DNA as a negative control.

3. Results

The results of the mCIM test, demonstrating the differential hydrolysis of meropenem by carbapenemase‐positive and ‐negative E. coli strains, are depicted in Figure 3. Out of the 80 meropenem‐resistant E. coli strains analyzed, 37 strains tested positive in the mCIM phenotypic test, indicating that 46.25% of the isolates harbored at least one carbapenemase gene.

FIGURE 3.

Second stage of the mCIM test. Meropenem discs were placed on MHA plates inoculated with the carbapenem‐susceptible strain ( E. coli ATCC 25922). Carbapenemase‐positive strains hydrolyze meropenem in the TSB‐meropenem medium, preventing inhibition of the susceptible E. coli strain on the MHA plate. Carbapenemase‐negative strains do not affect meropenem, allowing it to inhibit E. coli growth around the disc.

Genotypic analysis using PCR revealed the following: 18 isolates (48.65%) carried the bla _NDM‐1 gene, 6 isolates (16.22%) carried the bla _IMP‐1 gene, and 4 isolates (10.81%) harbored both bla _NDM‐1 and bla _IMP‐1 genes. Thirteen isolates (35.14%) tested positive in the mCIM test but did not show amplification of either gene in PCR analysis. Genotypic analysis of the bla _NDM‐1 and bla _IMP‐1 genes among mCIM‐positive E. coli isolates (n = 37) is shown in Chart 1, and the frequency distribution of bla _NDM‐1 and bla _IMP‐1 genes is detailed in Table 3.

CHART 1.

Genotypic analysis of the bla _NDM‐1 and bla _IMP‐1 genes among mCIM‐positive E. coli isolates (n = 37), with percentages calculated based on these carbapenemase‐producing isolates.

TABLE 3.

Frequency distribution of bla _NDM‐1 and bla _IMP‐1 genes in E. coli isolates from clinical samples (n = 80).

	mCIM phenotypic test results	PCR results	Mechanism of resistance	n (% of 37)	n (% of 80)
Total strains (n = 80)	Negative (n = 43) 53.75%	—	Meropenem‐resistant (mechanism undetermined)	—	43/80 (53.75%)
	Positive (n = 37) 46.25%	Identified with PCR	bla IMP‐1 gene	6/37 (16.22%)	6/80 (7.50%)
			bla NDM‐1 gene	18/37 (48.65%)	18/80 (22.50%)
			bla IMP‐1 and bla NDM‐1 genes	4/37 (10.81%)	4/80 (5.00%)
		Unidentified with PCR	Other mechanisms (not bla IMP‐1 and bla NDM‐1)	13/37 (35.14%)	13/80 (16.25%)

This table summarizes the distribution of carbapenemase‐producing E. coli strains identified through phenotypic (mCIM) and genotypic (PCR) testing.

Figure 4 presents the PCR results confirming the presence of bla _NDM‐1 and bla _IMP‐1 genes in the examined E. coli strains. Due to the limited capacity of the electrophoresis gel (12 wells) and the impracticality of running all positive and negative samples simultaneously, 5 bla _NDM‐1‐positive and 2 bla _IMP‐1‐positive isolates were selectively loaded and co‐electrophoresed to generate a single representative image.

FIGURE 4.

Electrophoresis of PCR‐positive products on 1.5% agarose gel. Lanes 1–5: PCR products for the bla _NDM‐1 gene. Lanes 8–9: PCR products for the bla _IMP‐1 gene. Lanes 6–7: Empty wells left intentionally for spacing. M: Marker (100 bp + 3 k DNA ladder). Pos: Positive control ( E. coli IMP⁺). Neg: Negative control. Due to the limited capacity of the electrophoresis gel (12 wells), only 5 of the 18 bla _NDM‐1‐positive and 2 of the 6 bla _IMP‐1‐positive isolates were selectively co‐electrophoresed to generate a single representative image.

4. Discussion

Bacteria develop resistance to antibiotics through various mechanisms, ranging from efflux pumps to the production of degradative enzymes, ensuring their survival. The emergence of carbapenemase‐producing bacteria, particularly bla _NDM‐ and bla _IMP‐type metallo‐β‐lactamases (MBLs), has raised significant public health concerns worldwide. These genes hydrolyze a broad spectrum of β‐lactam antibiotics, including carbapenems, which are often considered the last resort for treating infections caused by resistant strains [27].

Although the bla _IMP and bla _NDM genes were first reported in 1990 (in Japan) and 2008 (in Sweden), respectively [6, 28], they have since been identified in numerous countries, including Austria, Spain, Australia, Ukraine, Germany, the United Kingdom, Uganda, the United States, Iran, Belgium, Thailand, China, Japan, Sweden, Serbia, Saudi Arabia, France, the Philippines, Canada, Kuwait, Norway, the Netherlands, India, Vietnam, Greece, and all neighboring countries of Iran [27, 29, 30, 31, 32].

Over the past few years, various genetic variants of bla _NDM and bla _IMP have evolved, with previous studies reporting more than 85 variants of the bla _IMP gene [6] and 41 variants of the bla _NDM gene [12], highlighting their widespread dissemination.

In the present study, 46.25% (37 out of 80) of E. coli strains were identified as carbapenem‐resistant, indicating a relatively high resistance rate. Additionally, the prevalence of the bla _NDM‐1 gene was higher compared to bla _IMP‐1. However, 13 out of 37 isolates (35.14%) were found to be resistant to meropenem in the phenotypic mCIM test, but PCR‐based genotypic analysis did not confirm the presence of bla _NDM‐1 or bla _IMP‐1 genes. This suggests that genes other than bla _NDM‐1 and bla _IMP‐1, such as bla _VIM, may be responsible for carbapenemase production (Figure 1). Alternatively, other non‐carbapenemase resistance mechanisms, such as reduced drug permeability due to porin modifications, overexpression of efflux pumps, or the production of extended‐spectrum β‐lactamases (ESBLs) combined with porin loss, may have contributed to resistance in these strains.

The detection of bla _NDM‐1 and bla _IMP‐1 genes in the examined E. coli strains, potentially associated with mobile genetic elements such as plasmids, suggests a high potential for horizontal gene transfer of resistance determinants to other pathogens. Such elements are known to occasionally harbor multiple antibiotic resistance genes, which could increase the likelihood of widespread resistance to carbapenems and other antibiotics in bacterial populations. In this study, four isolates (approximately 10.81% of the 37 carbapenemase‐positive strains) were identified that simultaneously carried both bla _NDM‐1 and bla _IMP‐1 genes. This finding highlights the high potential for horizontal transfer of resistance‐determining genes in clinical settings. Such phenomena emphasize the importance of rapid detection of these genes using methods such as mCIM and PCR to guide precise therapeutic strategies and prevent the spread of antibiotic resistance.

Several studies in Iran, regardless of their methodologies, have reported the prevalence of bla _NDM and bla _IMP genes in Gram‐negative bacteria, including E. coli [29, 33, 34, 35, 36]. The first report of bla _NDM‐1 in Iran was by Eyvazi et al., who identified two E. coli strains isolated from burn wounds of hospitalized patients at Motahari Hospital in Tehran [29]. Before this, Shahcheraghi et al. had reported the first K. pneumoniae strain producing bla _NDM‐1 in Iran. Among 360 Enterobacter isolates from clinical samples, 67.7% were E. coli , and 12.5% were K. pneumoniae . Regarding carbapenemase gene production, K. pneumoniae had the highest prevalence (52.1%), followed by E. coli (39.1%) [34].

A subsequent study conducted three years later by Fazeli et al. in Isfahan evaluated the presence of four metallo‐β‐lactamases (bla _IMP, bla _VIM, bla _NDM, and bla _SPM‐1) in K. pneumoniae strains isolated from clinical samples. Their findings indicated that only bla _NDM‐1 was detected in 12.2% of strains, while bla _IMP, bla _VIM, and bla _SPM‐1 genes were not identified [37].

Most studies in Iran have used phenotypic methods other than mCIM (such as MHT, E‐test, or disk diffusion) to detect carbapenemase‐producing strains. However, these methods have lower sensitivity and specificity compared to mCIM. According to research, if the goal is to detect metallo‐β‐lactamases, the mCIM phenotypic method has nearly 100% sensitivity and specificity [19, 20], which is why it was used in the present study.

In a study conducted in Zabol, Iran, Rashedi et al. isolated 100 E. coli strains from various clinical samples. Their results showed that 30% of the samples were multidrug‐resistant (MDR), and all carbapenemase‐positive strains were also positive for metallo‐β‐lactamases. The prevalence of bla _NDM in their study was 75% [35]. In Qom, Iran, the prevalence of metallo‐β‐lactamases bla _IMP, bla _VIM, and bla _NDM in K. pneumoniae strains was reported as 15.6%, 2.42%, and 1.92%, respectively [36].

A global study by Peirano et al. [32] conducted between 2008 and 2013 across 16 countries spanning five continents examined E. coli ST131 carbapenemase‐producing strains. Among 47,843 E. coli strains analyzed, 407 isolates were found to be non‐susceptible to both ertapenem and imipenem. Of these, 116 isolates (28.5%) tested positive for various carbapenemase genes, including bla _NDM, bla _KPC, bla _{OXA‐48‐like}, bla _VIM, and bla _IMP. The most frequently detected genes were bla _NDM (38%), bla _KPC (33%), bla _{OXA‐48‐like} (26%), and bla _VIM and bla _IMP (2% each).

The presence of KPC carbapenemases in 33% of E. coli strains was unexpected, as KPC genes are rarely reported in E. coli . Given that 35% of isolates belonged to the ST131 lineage and 58% of these ST131 strains were bla _KPC‐positive, it appears that E. coli ST131 is frequently associated with bla _KPC and plays a significant role in the dissemination of this resistance gene. Additionally, their study revealed that NDM variants are particularly prevalent in India and Vietnam, identifying these countries as hotspots for the spread of bla _NDM‐producing strains.

In the study by Govindaswamy et al. [3] conducted in India, the prevalence of carbapenemases in E. coli strains isolated from clinical samples was examined. According to their results, 91.26% of the strains (94 out of 103) were carbapenemase producers, with bla _NDM‐1 being the most common gene detected (58 out of 94, 61.7%). The prevalence of other carbapenemases was reported as follows: bla _VIM (30.8%), bla _KPC (10.6%), bla _{OXA‐48‐like} (5.3%), and bla _IMP (2.1%). Several other studies from India have also reported the high prevalence of bla _NDM in carbapenem‐resistant E. coli strains, indicating the widespread presence of bla _NDM‐producing Enterobacteriaceae, including E. coli , in India [38, 39, 40].

Han et al. [14] in China studied the dissemination of carbapenemases among Enterobacteriaceae. According to their findings, 97.4% of the strains carried a carbapenemase gene, with bla _KPC present in 51.6% of cases, bla _NDM in 35.7%, and bla _{OXA‐48‐like} in 3.7%. The most common carbapenemase genes in K. pneumoniae and E. coli strains were bla _KPC‐2 (64.6%) and bla _NDM (96%), respectively.

Based on the findings of Liu et al. [41], among 204 NDM‐producing Enterobacterales strains collected from clinical patients in China between 2018 and 2022, 74.5% (152 strains) carried the bla _NDM‐5 gene, 20.1% (41 strains) harbored bla _NDM‐1, 2.5% (5 strains) carried bla _NDM‐4, and 2.0% (4 strains) possessed bla _NDM‐9. Additionally, one E. coli strain was identified that simultaneously expressed both bla _NDM‐1 and bla _IMP‐4 genes. Moreover, the study's results indicated that novel β‐lactam/inhibitor combinations, particularly cefiderocol, represent promising therapeutic options for infections caused by NDM‐producing Enterobacterales.

Additionally, a study in Taiwan reported an increasing trend in the prevalence of bla _NDM‐producing E. coli among carbapenem‐resistant Enterobacteriaceae populations between 2016 and 2018. This concerning increase indicates the rapid spread of antibiotic resistance across different geographic regions. Such an upward trend highlights the vital importance of continuous monitoring and molecular epidemiological studies to track and control the dissemination of resistance genes such as bla _NDM [42].

According to the study by Bagay et al. [31] in Uganda, among carbapenem‐resistant E. coli (CREC) strains, 64% were resistant to meropenem and 60% to imipenem. The predominant gene was bla _KPC (75%), followed by bla _NDM (30%), while no bla _{OXA‐48‐like}, bla _IMP‐1, or bla _IMP‐2 genes were detected.

Recent studies published between 2024 and early 2025 highlight the alarming rise in the prevalence of carbapenemase‐producing Enterobacteriaceae (CPE), particularly in K. pneumoniae and E. coli , across clinical and nonclinical settings. A study in Spain reported a high prevalence of the bla _OXA‐48 gene, with bla _NDM‐1, bla _NDM‐5, and bla _VIM‐1 also contributing to carbapenem resistance in hospital‐acquired infections [43]. Additionally, a bibliometric analysis of 1946 CRE‐related articles published between 2020 and 2024 identified key research themes, including the epidemiology of CRE, resistance mechanisms such as carbapenemase production mediated by bla _NDM, bla _IMP, bla _VIM, and bla _KPC, and infection control strategies [44]. Collectively, these findings underscore the urgent need for robust surveillance, rapid diagnostics, and innovative therapeutic approaches to mitigate the growing global threat of CRE.

5. Conclusion and Recommendations

The findings of the present study, along with various previous studies, indicate that carbapenemases are spreading at an alarming rate, and their prevalence may be influenced by geographical, healthcare, and environmental factors. Understanding these factors is essential for developing effective strategies to combat the spread of carbapenemase‐producing strains.

Therefore, it is recommended that further comprehensive studies be conducted using molecular methods such as PCR for other carbapenemase genes, whole genome sequencing (WGS), gene expression analysis, and the investigation of additional resistance mechanisms to accurately identify carbapenem resistance mechanisms.