Table 1.
Oligonucleotides used in this study
| Primers for the sequencing of ggt and ggh genes, and RT-PCR (for ggt-9 and ggt-10) | ||||
| Oligonucleotide name | Position in sequence | Length (bp) | Sequence (5'-3') | Reference |
| ggt-3 | *1265–1286 | 21 | GACTGCTGATGACATTAGCGG | [49] |
| ggt-4 | *3250–3228 | 22 | GATTACTCACAATTTCCCCCTA | [49] |
| ggt-5 | *1791–1811 | 20 | CGATGCGTGCGACGCCGGAA | [25] |
| ggt-6 | *2676–2654 | 23 | ATAGCACATTGCCCGCCTTATCC | [25] |
| ggt-7 | *2241–2262 | 22 | CAAGATTTATCTGATTATCAAG | [25] |
| ggt-9 | *2779–2800 | 21 | GGGCAAACAGGTCGCCAATCG | [25] |
| ggt-10 | *2089–2068 | 21 | TGTAGCGGCACACCATTCGGC | [25] |
| ggt-18 | *1554–1534 | 21 | CGGTCAGTCCCGTTGCATGTT | [25] |
| Primers for RT-PCR | ||||
| ggt-29 | *1452–1475 | 24 | GGATGTCAAGTCATCCATGCCAAT | This study |
| ggt-20 | *1682–1659 | 24 | TGTCGTCTGCACCGCCACCATCGC | This study |
| ggt-31 | *1878–1901 | 24 | GGTACGCCTGCTATCCCTAAACTG | This study |
| ggt-22 | *3079–3056 | 24 | CGCACATCAGTCTTATAGCCCAAA | This study |
| Primer for primer extension | ||||
| primer-ext-2 | *1492–1467 | 26 | GTATTAACCTTACCTTGATTGGCATG (Biotin-labeled at the 5'-terminus) | This study |
*Numbers of positions indicate the position from the 5'-nucleotide of the ggt locus in N. meningitidis strain H44/76 [DDBJ:AB175033].