Protocol for RNA-seq library preparation from low-volume total RNA by RNA/cDNA hybrid tagmentation

Summary

RNA sequencing (RNA-seq) is a widely used and powerful technique for studying gene expression. Among the various protocols, SHERRY (sequencing hetero RNA-DNA-hybrid) profiles polyadenylated RNAs by direct tagging of RNA/DNA hybrids and offers a robust and economical way for gene expression quantification. Here, we present a detailed protocol for standard SHERRY library preparation from 200 ng of total RNA. We describe steps of RNA purification, reverse transcription, hybrid tagmentation, and library generation. We then detail procedures for sequencing and data analysis.

For complete details on the use and execution of this protocol, please refer to Di et al.¹

Graphical abstract

Highlights

• •Steps for generating 3′-end RNA-seq libraries from 200 ng of total RNA
• •Instructions for RNA-cDNA tagmentation using in-house Tn5 transposase
• •Guidelines on library quality control

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

RNA sequencing (RNA-seq) is a widely used and powerful technique for studying gene expression. Among the various protocols, SHERRY (sequencing hetero RNA-DNA-hybrid) profiles polyadenylated RNAs by direct tagging of RNA/DNA hybrids and offers a robust and economical way for gene expression quantification. Here, we present a detailed protocol for standard SHERRY library preparation from 200 ng of total RNA. We describe steps of RNA purification, reverse transcription, hybrid tagmentation, and library generation. We then detail procedures for sequencing and data analysis.

Before you begin

General guidelines

• 1.Ensure that all experimental procedures have been reviewed and approved by your institution. All experiments were performed in accordance with relevant institutional guidelines and regulatory standards.
• 2.RNase contamination is always a concern when working with RNA. Use nuclease-free water, tips and tubes, always wear gloves, and maintain a clean and RNase-free work area. Use RNase-free consumables. Work quickly and preferably on ice to minimize degradation during processing.
• 3.Prepare buffers and reagents. Refer to the key resources table and materials and equipment section for details.
• 4.This protocol provides two optional sections at the beginning to guide users working with crude RNA or using unloaded Tn5 in their experiments. If you are starting with purified total RNA and loaded Tn5 transposomes, you may proceed directly to the main steps.

Innovation

This protocol optimizes SHERRY RNA-seq workflow for low volume total RNA input. By eliminating the need for second-strand DNA generation, it saves time and reduces possible biases introduced during cDNA amplification.

Institutional permissions

Procedures involved in the work were approved by the Experimental Center of Biology, Guangzhou Medical University.

Tn5 transposome assembly

Timing: 2.5 h

Tn5 transposomes (transposase enzyme loaded with a transposon DNA sequence) used in this protocol can be purchased from vendors like Illumina (Tagment DNA TDE1 Enzyme and Buffer Kit). Alternatively, you can use unloaded Tn5 transposase, either purified in-house following existing protocols² or purchased from vendors such as Lucigen and Diagenode. In case unloaded transposase are to be used, the transposome must be assembled beforehand.

• 5.Clean the bench sequentially using 75% ethanol, DNA-OFF, RNaseZap, and then 75% ethanol.

CRITICAL: Perform all steps in an RNase-free workspace. We recommend using a flow hood that has been thoroughly cleaned with RNaseZap prior to use.

CRITICAL: Use nuclease-free water for all steps in this protocol.

• 6.Dilute the purified Tn5 to a concentration of 0.5 μg/μL using Tn5 dilution buffer.
• 7.Mix 25 μL of ME_S5 oligo (100 μM) with 25 μL of ME_Bottom oligo (100 μM) in a PCR tube. Anneal the mixture in a thermocycler as follows to generate S5_adapter (50 μM):

Steps	Temperature, Δtemp/cycle, Ramp	Time	Cycles
Denaturation	98°C	3 min	1
Annealing	98°C, −0.5°C/cycle, −0.1°C/s	5 s	90
Annealing	53°C, −0.5°C/cycle, −0.1°C/s	5 s	74
Final store	16°C	∞	1

• 8.Similarly, mix 25 μL of ME_S7 oligo (100 μM) with 25 μL of ME_Bottom oligo (100 μM) in a PCR tube and anneal to generate S7_adapter (50 μM), set the PCR program according to the table above (see step 7).
• 9.Add 75 μL of nuclease-free water to 50 μL of S5_adapter (50 μM) or S7_adapter (50 μM), respectively, to get a final concentration of 20 μM for each annealed adapter.
• 10.Set up the assembly as follows:

Reagent	Final concentration	Amount
S5_adapter	1.5 μM	12 μL
S7_adapter	1.5 μM	12 μL
Unloaded Tn5	0.15 μg/μL	48 μL
Tn5 dilution buffer	N/A	88 μL
Total	N/A	160 μL

• 11.Mix thoroughly by gently pipetting up and down 10 times.
• 12.Incubate at 25°C for 1 h, then store at −20°C.

Note: The assembled Tn5 transposome can be stored at −20°C for at least 1 year without significant loss of activity.

Genomic DNA digestion and RNA purification

Timing: 1 h

This protocol is optimized for 200 ng of purified total RNA and utilizes an oligo-dT primer to capture polyadenylated transcripts. For RNA extracted using Trizol reagent or other commercial kits that do not include genomic DNA (gDNA) elimination, a DNase pretreatment is crucial. This step digests residual DNA and prevents tagging and amplification of the gDNA, thus avoiding unwanted signal in the final data. If already purified RNA is used as an input this step can be skipped.

CRITICAL: Equilibrate beads to 20°C–25°C before use. Using beads at low temperatures may lead to a reduced yield of the purified sample.

• 13.Clean the bench sequentially using 75% ethanol, DNA-OFF, RNaseZap, and then 75% ethanol.
• 14.Equilibrate VAHTS RNA Clean beads to 20°C–25°C for at least 30 min. Mix thoroughly by vortexing before use.

Optional: You may also use other commercially available RNA clean beads, or the RNA Clean & Concentrator-5 kit (Zymo Research, Cat R1015) for RNA purification.

• 15.Calculate the required volume (X μL) to obtain 1 μg of total RNA for each sample.
• 16.Set up the DNase digestion reaction (10 μL per sample) in PCR tubes as follows:

Reagent	Final concentration	Amount
10× Reaction Buffer	1×	1 μL
RQ1 RNase-Free DNase	0.2 U/μL	1 μL
Total RNA	N/A	X μL
Nuclease-free water	N/A	(8-X) μL
Total	N/A	10 μL

• 17.Gently pipette up and down 6–8 times to mix the reaction, be careful to avoid bubbles.
• 18.Incubate at 37°C for 30 min.
• 19.Add 1 μL of RQ1 DNase Stop Solution (20 mM EGTA) to each sample and mix by pipetting to terminate the reaction.
• 20.Incubate at 65°C for 10 min to inactivate the DNase.
• 21.
  Perform RNA clean beads purification with a ratio of 1.8×.

  • a.
    Add 1.8 volumes of RNA clean beads (18 μL) to each volume of the RNA sample (10 μL). Mix thoroughly by pipetting up and down 10 times.
  • b.
    Incubate at 25°C for 5 min.
  • c.
    Place the tube on a magnet rack. Wait 2–3 min until the slurry clears and carefully remove the supernatant.
  • d.
    Keep the tube on the magnet and add 200 μL of freshly prepared 80% ethanol to wash the beads without disturbing the beads pellet.
  • e.
    Incubate on the magnet for 30 sec at 25°C, then remove all supernatant.
  • f.
    Repeat step d-e for an additional wash.
  • g.
    Spin down and place the tube back on the magnet, remove all supernatant using a P200 pipette with a 10 μL tip fitted on top of a 200 μL tip as shown in Figure 1.
  • h.
    Keep the tube open and wait 2–3 min until the beads are dry.

    CRITICAL: Air-dry time depends on the humidity and temperature in the room. If the beads pellet begins to crack, proceed immediately to the next step to avoid over-drying.

  • i.
    Remove from the magnet. Resuspend the beads with 10 μL of nuclease-free water.
  • j.
    Incubate at 25°C for 1 min.
  • k.
    Place the tube on the magnet and wait 2–3 min until the slurry clears, then transfer the supernatant to a pre-chilled new tube.
• 22.Place the samples on ice, measure the concentration of eluted RNA using a NanoDrop.
• 23.Assess RNA integrity by 1% agarose gel electrophoresis. troubleshooting 1.

Pause point: The purified products can be stored at −20°C for 2 months or at −80°C for long term storage.

Note: This stage typically results in a 20%–30% loss of the initial 1 μg of RNA, yielding an expected concentration of 70–80 ng/μL. Check the RNA integrity before and after DNase treatment. As shown in Figure 2, minor degradation is observed after DNase treatment and is considered acceptable.

Figure 1.

Aspirating the supernatant from the sample

Figure 2.

Checking the RNA integrity before and after DNase treatment

800 ng of total RNA were loaded per lane on a 1% agarose gel.

Optional: Assess RNA integrity using an Agilent 2100 bioanalyzer or other systems such as Agilent TapeStation, Qsep100 Bio-Fragment Analyzer, Caliper LabChip GX if needed.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Chemicals, peptides, and recombinant proteins
RNaseZap	Ambion	AM9780
DNA-OFF	Takara Bio	Cat# 9036
Triton X-100 solution	Sigma	Cat# 93443
1 M DL-dithiothreitol solution (DTT)	Sigma	Cat# 43816-10ML
1 M Tris-HCl pH 7.5	Sangon Biotech	B548124-0500
1 M Tris-HCl pH 8.0	Sangon Biotech	B548127-0500
0.5 M EDTA, pH 8.0	Thermo Fisher Scientific	AM9260G
Glycerol	Sigma	G5516
N, N-dimethylformamide (DMF)	Sigma	D4551-250ML
1 M MgCl2	Thermo Fisher Scientific	AM9530G
RiboLock RNase inhibitor	Thermo Fisher Scientific	E00381
RQ1 RNase-free DNase	Promega	M6101
Maxima H Minus reverse transcriptase	Thermo Fisher Scientific	EP0752
dNTP mixture	Sangon Biotech	B500056
Adenosine 5′-triphosphate (ATP)	NEB	P0756
VAHTS RNA Clean beads	Vazyme	N412-01
VAHTS DNA Clean beads	Vazyme	N411-01
Q5 High-Fidelity 2× master mix	NEB	M0492S
10% (wt/vol) SDS	Sigma	L4509
Ethanol	Sangon Biotech	A500737-0500
UltraPure DNase/RNase-free distilled water (nuclease-free water)	Invitrogen	Cat# 10977015
SYBR Green I nucleic acid gel stain	Thermo Fisher Scientific	S7563
Critical commercial assays
DNA clean & concentrator-5	Zymo	D4014
Tagment DNA TDE1 enzyme and buffer kit	Illumina	Cat# 20034197
Equalbit 1× dsDNA HS assay kit	Vazyme	EQ121-02
Software and algorithms
Fastp3	Chen et al.3	https://github.com/OpenGene/fastp
Hisat24	Kim et al.4	https://github.com/DaehwanKimLab/hisat2
Samtools5	Li et al.5	http://www.htslib.org/
Other
Qubit assay tubes	Thermo Fisher Scientific	Q32856
0.2 mL PCR 8-strip tubes (attached cap)	Gunster Biotech	MB-P08-A
MicroAmp optical 8-cap strip	Applied Biosystems	Cat#:4323032
MicroAmp fast reaction tubes (8 tubes/strip)	Applied Biosystems	Cat#:4358293
QuantStudio 1	Applied Biosystems	A40426
Centrifuge	Eppendorf	5910R
NanoDrop	Thermo Fisher Scientific	Cat# 840-317400
ThermoMixer C	Eppendorf	Cat# 5382000074
PCR thermal cycler	LongGene	A300
Magnetic rack	Thermo Fisher Scientific	Cat# 492025
Qubit 4	Thermo Fisher Scientific	Q33238

Materials and equipment

Timing: 1–2 h

Prepare the following buffers.

Annealing buffer (store at −20°C for up to 1 year)

Reagent	Final concentration	Amount
1 M Tris-HCl (pH=8.0)	10 mM	10 μL
5 M NaCl	50 mM	10 μL
0.5 M EDTA (pH=8.0)	1 mM	2 μL
Nuclease-free water	N/A	978 μL
Total	N/A	1 mL

Tn5 dilution buffer (store at −20°C for up to 1 year)

Reagent	Final concentration	Amount
1 M Tris-HCl (pH=7.5)	50 mM	50 μL
5 M NaCl	100 mM	20 μL
0.5 M EDTA	0.1 mM	0.2 μL
10% Triton X-100	0.1%	10 μL
100 mM DTT	1 mM	10 μL
Glycerol	50%	500 μL
Nuclease-free water	N/A	409.8 μL
Total	N/A	1 mL

5x Tagmentation buffer (store at −20°C for up to 1 year)

Reagent	Final concentration	Amount
1 M Tris-Cl (pH 7.6)	50 mM	50 μL
1 M MgCl2	25 mM	25 μL
DMF	50%	500 μL
Nuclease-free water	N/A	425 μL
Total	N/A	1 mL

• •0.2% SDS.

Dilute the 10% SDS solution at a ratio of 1:50 with nuclease-free water. Store at 20°C–25°C for up to 1 year.

• •100 mM DTT.

Dilute the 1 M DTT solution at a ratio of 1:10 with nuclease-free water. Aliquot and store at −20°C for up to 6 months.

• •80% ethanol.

Mix 8 mL of ethanol with 2 mL of nuclease-free water, mix thoroughly by vortexing. Make fresh.

• •10× SYBR Green stain.

Prepare a 100× SYBR Green stock by diluting the 10,000× SYBR Green I nucleic acid gel stain 1:100 in nuclease-free water. Store the 100× stock at −20°C for up to 1 year. For 10× SYBR Green stain, dilute the 100× stock at a ratio of 1:10 in nuclease-free water. Make fresh and protect from light.

• •Dissolve the ME_bottom, ME_S5, and ME_S7 oligonucleotides in annealing buffer to a stock concentration of 100 μM. Store at −20°C for up to 6 months.
• •Dissolve TSO, Oligo-dT, N7xx and S5xx oligonucleotides in nuclease-free water to a stock concentration of 100 μM, store at −20°C for up to 1 year. See Table 1 below for sequences.
• •Aliquot the TSO primer in small quantities, such as 2 μL in 200 μL nuclease-free PCR tubes. Store at −80°C for up to 1 year.

Note: The TSO primer contains three riboguanosines (rG) at the 3′ end. Avoid freeze-thaw cycles which may leads to degradation.

Table 1.

Oligos used in this protocol

Oligo name	Sequence (5′ to 3′)	Purification	Description
ME_bottoma	5′P- CTGTCTCTTATACACATCT -3′NH2-C7	HPLC	For Tn5 transposomes assembly
ME_S5	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG	HPLC
ME_S7	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG	HPLC
TSOb	AAGCAGTGGTATCAACGCAGAGTACAT/rG//rG//rG/	HPLC	For RNA/cDNA hybrid formation
Oligo-dTc	TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN	HAP
N701	CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG	HAP	For Library amplification, provide sample idx 1
N702	CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGG	HAP
N703	CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGG	HAP
N704	CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGG	HAP
S518	AATGATACGGCGACCACCGAGATCTACACCTATTAAGTCGTCGGCAGCGTC	HAP	For Library amplification, provide sample idx 2
S520	AATGATACGGCGACCACCGAGATCTACACAAGGCTATTCGTCGGCAGCGTC	HAP
S521	AATGATACGGCGACCACCGAGATCTACACGAGCCTTATCGTCGGCAGCGTC	HAP
S522	AATGATACGGCGACCACCGAGATCTACACTTATGCGATCGTCGGCAGCGTC	HAP

All oligos were ordered from Sangon Biotech.

Bold: indexes, italic: s5/s7 adapters.

^a5′P: 5′ Phosphorylation; 3′NH2-C7: 3′ 7-carbon spacer with a terminal amino group (NH2).

^brG: RNA base G.

^cV= A/C/G (any nucleotide except T).

Step-by-step method details

RNA/cDNA hybrid formation

Timing: 1.5 h

This section describes the procedures to generate RNA/cDNA hybrid via reverse transcription (RT), and following steps to purify the resulting product using DNA clean beads.

CRITICAL: Work quickly and preferably on ice unless otherwise indicated.

CRITICAL: Use nuclease-free water for all steps in this protocol.

CRITICAL: Equilibrate beads to 20°C–25°C before use. Using beads at low temperatures may lead to a reduced yield of the purified sample.

• 1.Clean the bench sequentially using 75% ethanol, DNA-OFF, RNaseZap, and then 75% ethanol.
• 2.Equilibrate VAHTS DNA Clean beads to 20°C–25°C for at least 30 min. Mix thoroughly by vortexing before use.
• 3.Dilute the 100 μM Oligo-dT stock to 10 μM using nuclease-free water.
• 4.Calculate the required volume (X μL) to obtain 200 ng of purified RNA for each sample.
• 5.Set up reaction (10 μL per sample) as follows:

Reagent	Final concentration	Amount
Oligo-dT primer	1 μM	1 μL
dNTP	1 μM	1 μL
Purified RNA (200 ng)	N/A	X μL
Nuclease-free water	N/A	8-X μL
Total	N/A	10 μL

• 6.Spin down and incubate the samples at 70°C on a thermoblock for 3 min, then immediately put the tubes back on ice to unfold RNA secondary structures.
• 7.Spin down the samples to collect the liquid at the bottom of the tubes, hold on ice.
• 8.Set up RT reaction mix (20 μL per sample) as follows:

Reagent	Final concentration	Amount
TSO	5 μM	1 μL
Maxima H Minus Reverse Transcriptase	5 U/μL	0.5 μL
RNase inhibitor	1 U/μL	0.5 μL
5× RT buffer	1×	4 μL
Nuclease-free water	N/A	4 μL
Denatured RNA/oligo-dT/dNTP from above (step 7)	N/A	10 μL
Total	N/A	20 μL

• 9.Mix the reaction by gently pipetting up and down 6-8 times without forming bubbles.
• 10.Incubate in a PCR machine with the heated lid on:

Steps	Temperature	Time	Cycles
Reverse transcription	42°C	90 min	1
Denaturation	85°C	5 min	1
Hold	16°C	∞	1

• 11.
  Purify the RNA/cDNA hybrid by 1× beads purification using VATHS DNA clean beads:

  • a.
    Add 1 volume of DNA Clean beads (20 μL) to each volume of the RT mixture (20 μL). Mix thoroughly by pipetting up and down 10 times.
  • b.
    Incubate at 25°C for 5 min.
  • c.
    Place the tube on a magnet rack. Wait 2–3 min until the slurry clears and carefully remove the supernatant.
  • d.
    Keep the tube on the magnet and add 200 μL of freshly prepared 80% ethanol to wash the beads without disturbing the beads pellet.
  • e.
    Incubate on the magnet for 30 sec, then remove all supernatant.
  • f.
    Repeat step d–e for an additional wash.
  • g.
    Spin down and place the tube back on the magnet, remove all supernatant using a P200 pipette with a 10 μL tip fitted on top of a 200 μL tip.
  • h.
    Keep the tube open and wait 2–3 min until the beads are dry.

    CRITICAL: Air-dry time depends on the humidity and temperature in the room. If the beads pellet begins to crack, proceed immediately to the next step to avoid over-drying.

  • i.
    Remove from the magnet. Resuspend the beads with 15 μL of nuclease-free water.
  • j.
    Incubate at 25°C for 1 min.
  • k.
    Place the tube on the magnet and wait 2–3 min until the slurry clears, then transfer the supernatant to a pre-chilled new tube and hold on ice.

    Note: There is no need to quantify the hybrid concentration at this stage. Use all for the next step.

    Pause point: The purified products can be stored at −20°C for several months.

RNA/cDNA hybrid tagmentation

Timing: 1 h

This section describes the procedures to add sequencing adapters via Tn5 tagmentation, and the following steps to purify the resulting product using DNA clean beads.

CRITICAL: Work quickly when starting and stopping the tagmentation reaction.

• 12.Dilute the Tn5 transposome at a ratio of 1:10 with Tn5 dilution buffer and mark it as 1:10 Tn5.
• 13.Set up tagmentation mix, prepare 25 μL for each sample:

Reagent	Final concentration	Amount
5× Tagmentation buffer	1×	5 μL
10 mM ATP	0.85 mM	2.13 μL
RNA/cDNA hybrid from above	N/A	15 μL
1:10 Tn5	0.3 ng/μL	0.5 μL
Nuclease-free water	N/A	2.37 μL
Total	N/A	25 μL

• 14.Mix the reaction by gently pipetting up and down 6–8 times.
• 15.Incubate at 55°C for 30 min.
• 16.Add 1 μL of 0.2% SDS to each sample, and mix thoroughly to stop tagmentation.
• 17.
  Perform 1.2× beads purification using DNA clean beads:

  • a.
    Add 1.2 volume of DNA Clean beads (30 μL) to each volume of the hybrid mixture (25 μL). Mix thoroughly by pipetting up and down 10 times.
  • b.
    Incubate at 25°C for 5 min.
  • c.
    Place the tube on a magnet rack. Wait 2–3 min until the slurry clears and carefully remove the supernatant.
  • d.
    Keep the tube on the magnet and add 200 μL of freshly prepared 80% ethanol to wash the beads without disturbing the beads pellet.
  • e.
    Incubate on the magnet for 30 sec, then remove all supernatant.
  • f.
    Repeat step d–e for an additional wash.
  • g.
    Spin down and place the tube back on the magnet, remove all supernatant using a P200 pipette with a 10 μL tip fitted on top of a 200 μL tip.
  • h.
    Keep the tube open and wait 2–3 min until the beads are dry.

    CRITICAL: Air-dry time depends on the humidity and temperature in the room. If the beads pellet begins to crack, proceed immediately to the next step to avoid over-drying.

  • i.
    Remove from the magnet. Resuspend the beads with 20 μL of nuclease-free water.
  • j.
    Incubate at 25°C for 1 min.
  • k.
    Place the tube on the magnet and wait 2–3 min until the slurry clears, then transfer the supernatant to a pre-chilled new tube and hold on ice.

    Note: There is no need to quantify the hybrid concentration at this stage. Use all for the next step.

    Pause point: The purified products can be stored at −20°C for several months.

Gap fill-in and library preparation

Timing: 4 h

This section describes the procedures to fill in the gap left by Tn5 tagmentation using Maxima H Minus Reverse Transcriptase, followed by library amplification and purification of the final library.

• 18.Set up the reaction as follows:

Reagent	Final concentration	Amount
Maxima H Minus Reverse Transcriptase	5 U/μL	1 μL
Q5 High-Fidelity 2× Master Mix	1×	20 μL
Purified RNA/DNA hybrid from above	N/A	19 μL
Total	N/A	40 μL

• 19.Mix the reaction by gently pipetting up and down 6–8 times.

Note: The Maxima H Minus Reverse Transcriptase possesses an RNA and DNA-dependent polymerase activity, allowing it to fill in gaps within the RNA/cDNA hybrid.

Note: There is no need to quantify the hybrid concentration at this stage. Use all for the next step.

• 20.Incubate at 50°C for 15 min.
• 21.Inactivate Maxima H Minus Reverse Transcriptase by heating at 85°C for 5 min.
• 22.Set up PCR reaction (50 μL):

Reagent	Final concentration	Amount
S5xx (10 μM)	0.5 μM	2.5 μL
N7xx (10 μM)	0.5 μM	2.5 μL
Q5 High-Fidelity 2× Master Mix	1×	25 μL
Hybrid from above	N/A	20 μL
Total	N/A	50 μL

• 23.Mix the reaction by gently pipetting up and down 6–8 times.

Note: The combination of S5xx and N7xx primers identifies a sample. Use different combinations of S5xx and N7xx primers if you want to sequence them in the same lane. If you do not have many samples, it is recommended to use different N7xx primers, because the index in the N7xx primer is sequenced first on an Illumina NovaSeq 6000 or X Plus machine.

• 24.Take out 9 μL of the reaction, mix with 1 μL of 10x SYBR Green stain and perform a qPCR analysis to decide the optimal cycle number. Leave the rest 41 μL reaction on ice.
• 25.Use the following cycling condition to perform a qPCR analysis, and monitor the amplification curve in linear scale.

Steps	Temperature	Time	Cycles
Initial Denaturation	98°C	30 s	1
Denaturation	98°C	20 s	25
Annealing	63°C	20 s
Extension	72°C	45 s

• 26.Determine the cycle number N, where the amplification curve reach half way of saturation. In the examples shown in the Figure 3 below, N = 12 and 13 for the two different samples. troubleshooting 2.

Note: The cycle number should be chosen at the exponential phase, before reaching saturation. When handling samples with different optimal cycle numbers, run them in separate machines if available. Otherwise, run all samples together for the minimal required number of cycles. Then, take out the samples that have reached their optimal cycle number, and continue additional denaturation-annealing-extension cycles for the remaining samples until all reactions are complete.

• 27.Perform PCR as follows: amplify the rest 41 μL reaction for a further of N cycles, using the following condition:

Steps	Temperature	Time	Cycles
Initial Denaturation	98°C	30 s	1
Denaturation	98°C	20 s	N
Annealing	63°C	20 s
Extension	72°C	45 s
Final extension	72°C	1 min	1
Hold	10°C	∞	1

• 28.Equilibrate all the components in the Vazyme Equalbit 1 × dsDNA HS Assay Kit to 20°C–25°C before use.
• 29.
  Purify the library using 1× DNA clean beads as described in step 17, and elute in 20 μL of nuclease-free water.

  • a.
    Add 1× volume of DNA Clean beads (41 μL) to each volume of the PCR mixture (41 μL). Mix thoroughly by pipetting up and down 10 times.
  • b.
    Incubate at 25°C for 5 min.
  • c.
    Place the tube on a magnet rack. Wait 2–3 min until the slurry clears and carefully remove the supernatant.
  • d.
    Keep the tube on the magnet and add 200 μL of freshly prepared 80% ethanol to wash the beads without disturbing the beads pellet.
  • e.
    Incubate on the magnet for 30 sec, then remove all supernatant.
  • f.
    Repeat step d-e for an additional wash.
  • g.
    Spin down and place the tube back on the magnet, remove all supernatant using a P200 pipette with a 10 μL tip fitted on top of a 200 μL tip.
  • h.
    Keep the tube open and wait 2–3 min until the beads are dry.

    CRITICAL: Air-dry time depends on the humidity and temperature in the room. If the beads pellet begins to crack, proceed immediately to the next step to avoid over-drying.

  • i.
    Remove from the magnet. Resuspend the beads with 20 μL of nuclease-free water.
  • j.
    Incubate at 25°C for 1 min.
  • k.
    Place the tube on the magnet and wait 2-3 min until the slurry clears, then transfer the supernatant to a pre-chilled new tube and hold on ice.
• 30.
  Measure the library concentration using a Qubit 4:

  • a.
    Label the lid of standard 1, standard 2, and sample Qubit assay tubes correctly.

    Note: Do not label the side of the tube as this could interfere with the sample read.

  • b.
    Mix 190 μl of Equalbit 1 × dsDNA HS Working Solution with 10 μl of Equalbit 1 × dsDNA HS Standard # 1 and Standard # 2 in corresponding standard PCR tubes.
  • c.
    Gently vortex for 2–3 sec to mix thoroughly, avoid bubbles.
  • d.
    Add 199 μl of Equalbit 1 × dsDNA HS Working Solution into sample PCR tubes, then add 1 μl of samples respectively, the final volume of each testing sample is 200 μl.
  • e.
    Gently vortex for 2–3 sec, avoid bubbles.
  • f.
    Incubated at 25°C for 2 min and protect from light.
  • g.
    According to the operating instructions of the Qubit Fluorometer, select the dsDNA High Sensitivity Assay program to assay the concentration.

    Note: Mix thoroughly standards and samples by vortex before use to avoid inaccurate results.

• 31.Check the quality and quantity of the purified library by capillary electrophoresis machine like Agilent Bioanalyzer 2100 or Qsep100 Bio-Fragment Analyzer. A schematic view of library construction steps can be found in Figure 4 below.

Figure 3.

Amplification Plot of qPCR

Figure 4.

Schematic view of library construction steps

Expected outcomes

A final library concentration of 5–20 ng/μL is expected, with fragment sizes mainly in the 200–1000 bp range. Figure 5 shows a successful library, along with three sub-optimal examples and a failed one. troubleshooting 3, 4, 5, and 6.

Note: Typical SHERRY libraries show a bell-shaped size distribution with a peak between 200–400 bp. Some samples may exhibit a broader distribution, ranging from 200-800 bp. Fragments larger than 1000 bp may indicate insufficient tagmentation.

Figure 5.

Examples of successful, sub-optimal, and failed library distribution

(A) A successful library with a dominant peak around 200 bp.

(B) A sub-optimal library with large fragments.

(C) A sub-optimal library with low peak.

(D) A sub-optimal library with hedgehog-like peaks between 200-300 bp.

(E) A failed one shows no visible library.

If the libraries appear to be of the expected size, send for sequencing. We normally perform 150 bp pair-end sequencing, and aim for 20-40 million reads per sample. The amount of sequencing needed for a given sample is determined by the goals of the experiment and the nature of the RNA sample. Note that libraries constructed from low quality RNA will generally produce fewer reads.

Quantification and statistical analysis

Even with a proper library distribution, specific issues such as microbial contamination, sequencing errors, and sample degradation can still lead to poor data quality. Therefore, some preliminary computational analysis on the data needs to be performed. Further quality control or estimation of gene expression levels can be done by following dedicated protocols.^6,7

Adapter trimming

Timing: 10 min to h depending on computing power and sequencing depth

Run the following command in a terminal for adapter trimming:

fastp -w {threads} -l 25 -i {read1.fq.gz} -I {read2.fq.gz} --detect_adapter_for_pe -o trimmed_{sample}_R1.fq.gz -O trimmed_{sample}_R2.fq.gz -h {sample}_fastp.html

Note: The above command is in one single line. Change {threads} to the number of cores you want to use, {read1.fq.gz} and {read2.fq.gz} to your sequencing read file names, {sample} to your sample name.

-l 25: Reads shorter than 25 bases will be discarded.

--detect_adapter_for_pe: Automatically detect adapter sequences for paired-end data.

-h: Specifies the name of the HTML report, which will contain quality control and trimming statistics for your sample.

Read alignment

Timing: 10 min to h depending on computing power and sequencing depth

Run the following command in a terminal for the read alignment and format conversion: troubleshooting 7.

hisat2 -p {threads} -x {genome} -1 trimmed_{sample}_R1.fq.gz -2 trimmed_{sample}_R2.fq.gz --summary-file mapping_stats.txt | samtools view -@ {threads} -ShuF 4 -q 30 - | samtools sort - -T {factor}_tmp -o {factor}_q30_sorted.bam

Note: The above command is in one single line. Change {threads} to the number of cores you want to use, {genome} to the hisat2 genome index, {read1.fq.gz} and {read2.fq.gz} to your sequencing read file names, {factor} to the name of the factor that is being investigated. The commands align the reads to the genome, remove un-aligned reads, sort the reads by coordinates and only keep reads with mapping quality higher than 30.

-ShuF 4: -S, input is in SAM format; -h, include the header in the output; -u, write uncompressed BAM output; -F 4, exclude unmapped reads, which have the SAM flag 4.

-q 30: Only include reads with a mapping quality ≥ 30.

Limitations

This protocol is selective for polyadenylated RNA, and will not provide information on poly(A)-negative RNAs. Furthermore, the reads do not retain the strand specificity of the RNA. We have applied this protocol to freshly prepared total RNA from human K562 and mouse E14 cells, and obtained high quality data. However, this protocol may not perform well with degraded RNA from FFPE tissues or other materials.

Troubleshooting

Problem 1

Degraded RNA with severe smearing below the 28S and 18S RNA bands or loss of the 28S band (before you begin-step 23).

Potential solution

Although pure RNA could be store at −80°C for months with minimal degradation, using freshly extracted total RNA is recommended to ensure optimal integrity.

Problem 2

No amplification curve was observed in the qPCR results (Step 26).

Potential solution

Ensure the final SYBR Green stain concentration in the reaction is 1×. Using a 100x or 10,000x stock solution may impair signal detection.

Use RNase-free consumables. Work quickly and preferably on ice to minimize degradation during processing.

Problem 3

Large fragments dominate the final library as shown in Figure 5B (expected outcomes).

Potential solution

This may be due to insufficient Tn5 tagmentation. Use the Tn5 transposase from the kit within its expiry date. Do not use Tn5 that has been improperly stored.

Problem 4

Very low peaks after final amplification as shown in Figure 5C (expected outcomes).

Potential solution

Perform qPCR analysis to determine the cycle number N as indicated in step 24–26. Increase the number of PCR cycles if necessary.

Problem 5

The library presents a saw-like curve as shown in Figure 5D (expected outcomes).

Potential solution

This may be due to the large excess of TSO relative to the RNA. TSO can form concatamers during PCR amplification. Verify the quantity and integrity of the input RNA, or reduce the amount of TSO used.

Problem 6

No visible library but only primers as shown in Figure 5E (expected outcomes).

Potential solution

Confirm the quantity and integrity of the input RNA. Use reagents within their expiry date.

Problem 7

Low genome mapping rate (<80%) (Reads alignment).

Potential solution

A low mapping rate can result from nucleic acid contamination, and short library inserts caused by RNA degradation or over-tagmentation during library preparation. To minimize contamination, clean the bench using 75% ethanol, DNA-OFF, RNaseZap, and ethanol before you start. Sterilize in-house buffers with 0.22 μm filters. Additionally, validate the absence of mycoplasma contamination in the original cell materials.

To optimize insert size, first verify the quantity and integrity of the input RNA. If using a new batch of Tn5 transposome, perform a titration to determine the optimal transposome concentration. Test a range of Tn5 volumes (e.g., 0.05, 0.25. 0.5, and 1 μL) during tagmentation, and check the resulting library insert size.

During data processing, a low mapping rate can result from using an incorrect reference genome. Ensure that the reference genome corresponds to the species you investigated. Next, check the trimmed reads for residual adapter contamination. If contamination is present, further trimming of the 3′ end of reads may be necessary.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Wei Xu (xuwei2023@gzhmu.edu.cn).

Technical contact

Questions about the technical specifics of performing the protocol should be directed to and will be fulfilled by the technical contact, Xi Chen (chenx9@sustech.edu.cn) and Wei Xu (xuwei2023@gzhmu.edu.cn).

Materials availability

All the materials used in this protocol are commercially available.

Data and code availability

This study did not generate new data or code.

Acknowledgments

We thank all members from the Chen lab for the help with the experiments. This study was supported by the National Natural Science Foundation of China (32470674 to W.X.), Science and Technology Projects in Guangzhou (2024A04J5074 to W.X.), Shenzhen Medical Research Fund (C2301007 to X.C.), and The Guangdong Program (2021QN02Y165 to X.C.).

Author contributions

W.X. and X.C. conceived and supervised the project. Y.C. and Y.H. carried out the experiments. All authors contributed to the writing.

Declaration of interests

The authors declare no competing interests.