Skip to main content
Regenerative Therapy logoLink to Regenerative Therapy
. 2025 Nov 5;30:1052–1061. doi: 10.1016/j.reth.2025.10.016

Hydrogel microcapsulation technology reduces the DMSO concentration required for stem cell cryopreservation

Zhongqin Tang a,b,c,1, Ying Wang a,b,c,1, Ziling Yang a,b,c, Juan Chen a,b,c, Shuqi Cai a,b,c, Zhiguo Zhang a,d, Jianye Wang a,b,c,, Zhaolian Wei a,b,c,⁎⁎
PMCID: PMC12639263  PMID: 41282490

Abstract

Introduction

Stem cell therapy is increasingly advancing towards clinical applications, with cryopreservation playing a critical role in cell transplantation. Previous studies have demonstrated that hydrogel microcapsules can enhance cell survival during cryopreservation. However, most research has focused on rapid freezing techniques or cryopreservation with high-concentration dimethyl sulfoxide (DMSO). This study aims to investigate the effects of hydrogel microcapsules on the viability, phenotype, and functionality of mesenchymal stem cells (MSCs) following cryopreservation with low-concentration DMSO. The objective is to develop a safer cryopreservation strategy for clinical stem cell applications.

Methods

In this study, We utilized five concentrations of DMSO (0 %, 1.0 %, 2.5 %, 5.0 %, 10.0 %(v/v)) to cryopreserve fabricated MSCs-laden microcapsules. We analyzed the effects of varying DMSO concentrations on the viability of microencapsulated MSCs, and the impact of hydrogel microcapsules on MSCs quality after cryopreservation with 2.5 % DMSO was investigated, including cell viability, morphology, phenotype, the expression of stemness-related genes and multidirectional differentiation potential.

Results

The results showed that when the DMSO concentration was reduced to 2.5 %, cell viability reached the minimum requirement (70 %) for clinical treatment, and it was demonstrated that, under low-concentration DMSO cryopreservation, the microencapsulation technique did not alter the stem cell phenotype and differentiation potential, and improved stem cell viability.

Conclusions

Hydrogel microencapsulation technology can reduce the concentration of DMSO required in stem cell cryopreservation and mitigate cryoinjury to cells. The cryopreservation of three dimensional (3D) cell constructs based on cell-biomaterials provides a highly promising new strategy for efficient stem cell storage and clinical applications.

Keywords: Mesenchymal stem cells, Alginate, Hydrogel, Microcapsule encapsulation, DMSO, Cryopreservation

Highlights

  • Hydrogel microencapsulation enables effective cryopreservation of MSCs with as low as 2.5% DMSO, while sustaining cell viability above the 70% clinical threshold.

  • The cryopreserved microencapsulated MSCs retain their multidifferentiation potential, and 3D culture can enhance the expression of stemness genes.

  • Hydrogel microcapsules facilitate long-term cryopreservation of hUC-MSCs without compromising their viability.

1. Introduction

Stem cells, due to their inherent abilities for self-renewal, tissue repair, and immune modulation, have propelled the rapid development of stem cell therapies in the clinical application [1]. However, the substantial demand for stem cells presents significant challenges. While traditional two dimensional (2D) culture methods can accommodate this demand by enabling long-term in vitro expansion, they are associated with potential challenges, including the onset of mesenchymal stem cell (MSC) senescence and genetic alterations [[2], [3], [4]]. Consequently effective cryopreservation methods are urgently needed to ensure a timely and reliable supply of stem cells for clinical applications.

Alginate, a naturally derived biomaterial, is extensively utilized in various biomedical applications, including tissue engineering, drug delivery, and wound healing [[5], [6], [7]]. Upon crosslinking with divalent cations, alginate forms hydrogels that possess a three-dimensional network structure [8,9]. This structure facilitates the exchange of gases, nutrients, and metabolic byproducts while simultaneously shielding cells from host immune rejection [10,11]. Furthermore, alginate's exceptional biocompatibility and biodegradability make it particularly suitable for immediate use in cell transplantation [12]. Notably, studies have highlighted the cryoprotective properties of alginate-based hydrogels, owing to their unique chemical composition and physical state [13]. Kusano and Huang et al. observed through cryomicroscopy that extracellular ice crystals within microspheres do not damage the encapsulated cells and can protect against devitrification damage during rewarming [14,15].

Cryopreservation is the primary method for long-term cell storage, which includes both slow freezing and rapid (vitrification) freezing methods [16]. Slow freezing involves a controlled, gradual cooling process, whereas vitrification relies on high concentrations of cryoprotectants (CPAs) to achieve ultra-rapid cooling rates, causing the solution to transition into a glass-like state without ice formation [17,18]. This approach prevents mechanical damage introduced by ice crystal formation and overcomes the challenge of optimizing the cooling rate [19]. Despite its advantages, the toxicity associated with high-concentration CPAs remains a significant hurdle for vitrification [20]. Such toxicity can lead metabolic, osmotic, and even chromosomal damage [21]. Furthermore, an essential factor in vitrification is the cooling rate, which must be sufficiently rapid to achieve ultra-fast cooling and minimize ice crystal formation during thawing [22]. However, this necessitates stringent limitations on sample volume [15], which may impede the broader application of vitrification techniques. Currently, slow freezing remains the predominant cryopreservation method for stem cells. DMSO is commonly employed as a cryoprotectant in slow freezing due to its ability to rapidly penetrate cell membranes and mitigate ice-induced damage. Nevertheless, its use can be toxic to cells, with toxicity levels being influenced by both concentration and temperature [23,24]. High concentrations of DMSO are known to exert cytotoxic effects and can induce osmotic stress during the post-thaw DMSO removal process [25]. Consequently, there is growing interest in reducing or eliminating DMSO in cryopreserved cell therapies [[26], [27], [28]]. Notably, adverse reactions associated with DMSO during transplantation—such as nausea, vomiting, arrhythmias, neurotoxicity, and respiratory depression—pose serious concerns for the clinical safety of cell-based treatments [[29], [30], [31], [32], [33], [34], [35]]. Therefore, in this study, we evaluated the feasibility of using low-concentration DMSO cryopreservation for hydrogel microencapsulated stem cells for clinical applications.These findings represent a promising advancement toward the high-efficiency and safe storage of cells.

A variety of cell encapsulation techniques have been developed, including coaxial airflow technology [36], 3D bioprinting [37], microfluidic devices [38], and electrospinning [39].Compared to other technologies, high-voltage electrostatic coaxial spraying devices can enhance encapsulation efficiency and enable the generation of microcapsules with controlled size distributions by adjusting the applied voltage and flow rate [40]. Therefore,in this study, we employed a high-pressure electrostatic spraying device to encapsulate MSCs in sodium alginate microcapsules for cryopreservation.

2. Materials and methods

2.1. Preparation of reagents in this study

Complete Cell Culture Medium: Under sterile conditions, 10 % fetal bovine serum (FBS, Gibco, USA) and 1 % penicillin/streptomycin (HyClone, USA) were added to DMEM/F12 (Gibco, USA). The mixture was thoroughly mixed and stored in a 4 °C refrigerator. Core Solution: 0.68 g of mannitol (Gibco, USA) and 0.15 g of hydroxypropyl methylcellulose (Gibco, USA) were added to a 15 ml centrifuge tube. Sterile water was then added to dissolve the components thoroughly, and the solution was stored in a 4 °C refrigerator. Sodium Alginate Solution: 0.46 g of mannitol and 0.2 g of sodium alginate (Gibco, USA) were added to a 50 ml centrifuge tube. Sterile water was added to dissolve the components completely, and the solution was stored in a 4 °C refrigerator. Calcium Chloride Solution: 6.0 g of calcium chloride (Gibco, USA) was added to a 50 ml centrifuge tube, followed by sterile water to achieve complete dissolution. The solution was stored in a 4 °C refrigerator. All solutions were filtered through a 0.22 μm sterile-grade filter before use.

2.2. Cell clture

Human umbilical cord mesenchymal stem cells (hUC-MSCs) were isolated and extracted from umbilical cord tissues as previous study [41]. hUC-MSCs were cultured in the complete medium prepared as described above, at 37 °C with 5 % CO2 in a humidified incubator. The medium was replaced every 48 h until the cells reached 80 %–90 % confluence. Once the desired confluence was achieved, the culture medium was discarded, and the cells were washed twice with phosphate-buffered saline (PBS, Gibco, USA). The cells were then trypsinized with trypsin (HyClone, USA) for 2 min. When a significant number of cells appeared rounded and detached under the microscope, digestion was stopped. The cell suspension was centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. The cell pellet was resuspended in an appropriate volume of culture medium, and the cells were passaged at a 1:3 split ratio.

2.3. Preparation of hydrogel microsphere-encapsulated hUC-MSCs

When the cells reached approximately 80 % confluence, they were digested with trypsin and then centrifuged to collect the cell pellet, which was stored at 4 °C for later use. The core solution for encapsulating the stem cells was prepared on ice. Under sterile conditions in a laminar flow hood, 0.1 mol/L NaOH solution (Shanghai Shenggong, China), 5 mg/mL Type I collagen from rat tail (Solvay, China), core solution, and sterile water for injection were sequentially added to a 1.5 mL Eppendorf tube in the appropriate proportions. After thorough mixing by pipetting, the hUCMSCs pellet was resuspended and mixed with the solution to form the core of the microspheres. Using a 3 mL sterile syringe, the hUCMSCs-containing core solution was drawn up and connected to a custom-made coaxial needle assembly via an infusion pump. Another 3 mL syringe was filled with sodium alginate shell solution and connected to a second infusion pump, which was linked to the outer lumen of the coaxial needle. A beaker containing an appropriate amount of calcium chloride solution was placed below the coaxial needle assembly. The distance between the needle tip and the surface of the calcium chloride solution was adjusted, and the voltage was set to 6 kV for electrostatic spraying. The flow rates of the two syringes were adjusted to 25 μL/min and 75 μL/min respectively. The liquid flowing through the coaxial channel formed microdroplets that dropped into the calcium chloride solution, where they rapidly gelled to form the microspheres. Once the reaction was complete, the microspheres were collected. After centrifuging at 600 rpm for 5 min, the upper calcium chloride solution was discarded. The microsphere pellets were resuspended in complete culture medium and transferred to a T75 culture flask for continued culture in a 37 °C, 5 % CO2 incubator. The medium was changed every 48 h, and cell growth was monitored throughout the culture period.

2.4. Cryopreservation of hUCMSCs

DMSO (Sigma, USA) was added to complete culture medium to achieve final concentrations of 1 %, 2.5 %, 5 % and 10 %. The mixture was thoroughly mixed and stored at 4 °C for immediate use. Using a sterile Pasteur pipette, the microspheres were transferred to a 15 mL centrifuge tube, then centrifuged at 600 rpm for 5 min. The supernatant was discarded, and the microspheres were resuspended in PBS. After centrifugation and washing with PBS, the supernatant was discarded, and the microspheres were slowly resuspended in cryopreservation medium containing the appropriate concentration of DMSO. The suspension was centrifuged at 600 rpm for 5 min, and the supernatant was discarded. The microspheres were then resuspended in fresh cryopreservation medium containing the corresponding concentration of DMSO and transferred into cryovials. The vials were placed in a programmed freezing container and cooled at a rate of −1 °C/min to −80 °C, followed by transfer to liquid nitrogen for long-term storage. For cell cryopreservation, when the cells reached 80 %–90 % confluence, they were digested and collected. The cells were resuspended in an appropriate amount of culture medium, and then 2.5 % DMSO was added dropwise while gently shaking. The cell suspension was aliquoted into cryovials at a concentration of 1 × 106 cells/mL and placed in a programmed freezing container, followed by cooling overnight at −80 °C. The vials were then transferred to a liquid nitrogen tank for long-term storage.

2.5. Assessment of cell number per microsphere

After centrifugation at 600 rpm for 5 min, the supernatant was discarded and the MSCs-laden microcapsules were collected. The collected microcapsules were fixed and permeabilized, then stained with DAPI staining solution for 5 min. Finally, Z-stack imaging was acquired using a confocal microscope (Zeiss, Germany) and three-dimensional reconstruction was performed. The cells were counted using the software ImageJ.

2.6. Cell thawing

MSCs were retrieved from the liquid nitrogen tank and rapidly placed in a 37 °C water bath, with continuous gentle shaking for 2 min until the ice crystals completely melted. After disinfecting the cryovial with ethanol, the cell suspension was transferred to a 15 mL centrifuge tube under sterile conditions in a laminar flow hood. The suspension was then centrifuged, and the supernatant containing DMSO was discarded before proceeding to the next step for further analysis.

2.7. Cell viability assay

The viability of cryopreserved cells was determined using the Live/Dead Apoptotic Cells Staining Kit (KeyGen BioTECH, China). According to the manufacturer's instructions, equal volumes of Dye Reagent 1 and Dye Reagent 2 were mixed to form the Mixed Dyes Reagent solution. To the encapsulated hUCMSCs culture medium, an appropriate volume of 12 % sodium citrate solution was added. After observing the dissolution of the sodium alginate shell under a microscope, the suspension was centrifuged, and the supernatant was discarded. The cell pellet, now devoid of the alginate shell, was transferred to a cell culture dish. Trypsin was then added for digestion, and the dissociation of the cells was monitored under the microscope. Once the cell clumps were dissociated into single cells, the digestion was stopped by adding complete culture medium. The cell suspension was centrifuged at 1000 rpm for 5 min, and the pellet was resuspended in PBS. A 25 μL aliquot of the cell suspension was mixed gently with 1 μL of the Mixed Dyes Reagent. A 10 μL sample of the mixture was then placed on a clean glass slide and covered with a coverslip. The cells were observed and photographed using an inverted fluorescence microscope (Olympus/IX73, Japan) at an excitation wavelength of 510 nm. The number of live and dead cells was quantified using ImageJ software.

2.8. Cell apoptosis detection

Cell apoptosis was assessed using flow cytometry. After removing the alginate shell as described previously, the stem cell pellet was obtained and washed twice with pre-cooled PBS. Following the instructions provided with the apoptosis detection kit, 100 μL of Binding Buffer was added to resuspend the cells into a single-cell suspension. Then, 5 μL of Annexin V-FITC and 5 μL of PI Staining Solution were added and gently mixed. The cells were incubated at room temperature in the dark for 10 min. After incubation, 400 μL of Binding Buffer was added to stop the staining process. Apoptosis was then analyzed using a flow cytometer (BD FACSVerse, USA). Data analysis was performed using FlowJo software.

2.9. Cell proliferation assay

Cell proliferation was assessed using a CCK-8 kit. Both encapsulated and non-encapsulated hUCMSCs were thawed for the experiment. For encapsulated cells, the microcapsule shell was dissolved with sodium citrate, followed by trypsin digestion to dissociate cell aggregates into single cells. Cell densities of non-frozen cells, non-encapsulated cryopreserved cells, and encapsulated cryopreserved cells were measured using a cell counting chamber. Cell suspensions were adjusted to a density of 4 × 104 cells/ml and 100 μl was added to each well of a 96-well plate. At 4 h, 24 h, 48 h and 72 h post-culture, 10 μl of CCK-8 solution was added to each well according to the kit instructions. After incubation for an additional 4 h, absorbance was measured at 450 nm using a microplate reader.

2.10. Detection of cell surface markers

Cell surface marker expression on stem cells was analyzed using flow cytometry. Following the procedure described previously to remove the alginate shell, the stem cell pellet was obtained and washed twice with PBS. The cells were then incubated with primary antibodies against CD44-FITC (Abcam, UK), CD90-PE (Abcam, UK) and CD34-PE/Cy5.5 (Abcam, UK) at a dilution of 1:500 (as per the manufacturer's instructions) at 4 °C in the dark for 30 min. After incubation, the cells were centrifuged at 1500 rpm for 5 min at 4 °C, and the supernatant was discarded. The cells were washed twice with PBS and then resuspended in 200 μL PBS before being analyzed by flow cytometry.

2.11. Immunofluorescence

Immunofluorescence staining was performed to analyze the expression of stem cell surface markers. Non-frozen and cryopreserved cell pellets were obtained as described above, and cell counts were performed using a hemocytometer. Equal numbers of cells were then seeded onto confocal culture dishes and cultured until they reached approximately 70 % confluence. The culture medium was discarded, and the cells were washed three times with PBS. To fix the cells, 4 % paraformaldehyde was added, followed by 0.2 % Triton X-100 for permeabilization. The cells were then washed three times with PBS. Blocking was performed at room temperature for 30 min using blocking buffer. Primary antibodies against CD44, CD90 and CD34 (1:200 dilution) were added, and the cells were incubated overnight at 4 °C in a refrigerator. After washing three times with PBS, the cells were incubated with the secondary antibody, Alexa Fluor 488 (Abclonal, China), at room temperature for 1 h in the dark. The cells were then washed three times with PBS and stained with DAPI (Biosharp, China) for 5 min at room temperature to label the nuclei. Finally, fluorescence images were captured using a confocal microscope (Zeiss, Germany).

2.12. Evaluation of stemness gene expression

The expression of stemness genes Oct4, Sox2 and Nanog was assessed by qRT-PCR. The primer sequences are as shown in Table 1. After thawing the cryopreserved cells, cell pellets were obtained as described above. Total RNA was extracted using the RNA Fast Extraction Kit (Sichuojie, China) according to the manufacturer's instructions. Following RNA extraction, cDNA was synthesized using a reverse transcription kit (TOLOBIO, China) according to the provided protocol. The qRT-PCR reaction mixture was prepared according to the instructions of the 2 × Q3 SYBR qRT-PCR Master Mix (with fluorescent dye). Gene expression levels were quantified using a real-time PCR system (Roche LightCycler 480), and expression data were normalized to GAPDH to determine the relative expression of the target genes.

Table 1.

Primer sequences.

Gene name Primer name Sequence (5′- 3′)
GAPDH GAPDH-F AACTTTGGTATCGTGGAAGGACTC
GAPDH-R CAGTAGAGGCAGGGATGATGTTC
OCT-4 OCT-4-F GAGAACCGAGTGAGAGGCAACC
OCT-4-R CTGGGCGATGTGGCTGATCTG
SOX2 SOX2-F GCCCAGGAGAACCCCAAGATG
SOX2-R GCAGCCGCTTAGCCTCGTC
NANOG NANOG-F AGAACTCTCCAACATCCTGAACCTC
NANOG-R CCTGCGTCACACCATTGCTATTC

2.13. Assessment of induced multi-lineage differentiation

HUC-MSCs (P4) were seeded and cultured in 12-well plates for osteogenic and adipogenic induction. And cells were seeded in 15 ml centrifuge tubes for chondrogenic induction. According to the instruction of hUCMSC induction differentiation kits (PD-017/018/019, Procell, Wuhan,China), the adipogenic, osteogenic and chondrogenic differentiation medium was added for further culture with the medium being changed every 2 days. After induction of differentiation, the cells were fixed with 4 % paraformaldehyde for 30 min. The fixed cells were stained with Alizarin red S or Oil red O stain for 30 min. After embedding the chondrospheres in paraffin, the sections were stained with Alcian blue for 30 min. The images of staining were observed and evaluated under inverted fluorescence microscope.

2.14. Statistical analysis

Data are presented as mean ± standard deviation (SD) of three biological replicates (n = 3). Statistical comparisons between two groups were performed using a t-test. For comparisons among multiple groups, a one-way ANOVA was employed, followed by Tukey's post hoc test if the ANOVA result was significant. The analysis was conducted using GraphPad Prism 10.0. Significance between groups is indicated as follows: ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.

3. Results

3.1. Preparation of hydrogel microencapsulated MSCs and evaluation of cell number per microcapsule

We employed a high-pressure electrostatic spraying system to fabricate hydrogel microcapsules encapsulating MSCs. As depicted in Fig. 1, the experimental setup comprises two independent fluid channels: one for the injection of the cell suspension (core solution) and the other for the injection of the sodium alginate solution (shell solution). Both solutions are simultaneously ejected through a coaxial needle. Under the influence of a high-voltage electrostatic field, the core and shell solutions are atomized into microdroplets, which are then directed into a CaCl2 solution. Upon contact with Ca2+ ions, the sodium alginate undergoes ionic crosslinking, resulting in the formation of calcium alginate hydrogel microcapsules. The fabricated MSC-laden microcapsules were cultured in vitro for 48 h. Microscopic observation revealed that the encapsulated MSCs within the microcapsules gradually aggregated from single cell into cell clusters (Fig. S1 A), suggesting that the microcapsules structure did not impede cell proliferation and more closely recapitulated the in vivo microenvironment. This configuration facilitates intercellular interactions and supports the formation of tissue-like architectures. To assess changes in cell numbers within individual microcapsules, mesenchymal stem cells (MSCs) were quantified at 0 h and 48 h post-encapsulation. The initial encapsulation efficiency was approximately 7–10 cells per microsphere. After 48 h of culture, the cell number per microsphere increased to 20–24, indicating active proliferation within the hydrogel matrix (Fig. S1B and C).

Fig. 1.

Fig. 1

Preparation of hydrogel microencapsulated MSCs. Schematic diagram of hydrogel microcapsule fabrication using a high-pressure electrostatic spraying device and the cryopreservation protocol for microencapsulated MSCs.

3.2. Hydrogel microcapsules reduce the DMSO concentration for cryopreservation

Following thawing, the morphology of the MSC-laden microcapsules subjected to various DMSO concentrations was examined under a microscope. In the absence of DMSO, the microcapsules lost their smooth, spherical structure and appeared shrunken and wrinkled. In contrast, microcapsules cryopreserved with DMSO—regardless of concentration—retained their original morphology, consistent with that observed prior to freezing (Fig. 2 A). To assess cell viability, the hydrogel shells were dissolved using sodium citrate, and MSCs were stained with acridine orange/ethidium bromide (AO/EB) for fluorescence imaging (Fig. 2 B). The results revealed no significant differences in viability between 5.0 % and 10.0 % DMSO groups, with both maintaining post-thaw viabilities above 80 %. Notably, even at a reduced DMSO concentration of 2.5 %, cell viability remained above 70 % (Fig. 2 C). To further investigate the effects of DMSO concentration on post-thaw cell health, apoptosis was analyzed via flow cytometry. The apoptosis rates in the 5.0 % and 10 % DMSO groups were comparable, while the 2.5 % DMSO group exhibited only a modest increase in apoptosis (5.37 % ± 0.40 %) (Fig. 3 A, B), consistent with the viability results (Fig. 3C). As the number of cells within the microcapsules increased with prolonged culture duration, to evaluate the effect of cell density at the time of cryopreservation on cellular viability, microencapsulated MSCs were cryopreserved with 2.5 % DMSO at 0 h and 48 h post-encapsulation. Cell viability was subsequently assessed by flow cytometry. The results revealed no significant changes in viability(Fig. S2 A, B).

Fig. 2.

Fig. 2

Effect of DMSO concentration on cell viability of hydrogel microencapsulated MSCs. (A) Microscopic morphology of hydrogel microencapsulated MSCs after cryopreservation with different concentrations of DMSO. (B) AO/EB staining showing cell viability of hydrogel microencapsulated MSCs after thawing (red indicates dead cells, green indicates live cells). (C) Quantitative analysis of cell viability after cryopreservation with different concentrations of DMSO (n = 3, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001). Scale bar = 100 μm.

Fig. 3.

Fig. 3

Effect of DMSO concentration on cell apoptosis of hydrogel microencapsulated MSCs. (A) Flow cytometric analysis of cell apoptosis after treatment with different concentrations of DMSO. (B) Quantitative analysis of apoptosis rate of hydrogel microencapsulated MSCs after cryopreservation with different concentrations of DMSO. (C) Quantitative analysis of cell viability of hydrogel microencapsulated MSCs after cryopreservation with different concentrations of DMSO. (n = 3, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗∗p < 0.0001).

3.3. Hydrogel microcapsules enhance cell viability after cryopreservation

As the encapsulated MSCs exhibited a cell viability exceeding 70 % at a DMSO concentration as low as 2.5 %, which meets the minimum standards for clinical cell applications set by FDA guidelines, we further evaluated the protective effect of hydrogel microcapsules under low DMSO cryopreservation conditions. Specifically, we compared the cell viability of encapsulated MSCs and non-encapsulated MSCs after cryopreservation in 2.5 % DMSO. The results from live/dead cell staining images and quantitative analysis demonstrated that hydrogel encapsulation significantly enhanced cell viability after cryopreservation (Fig. 4 A, B). CCK-8 assays revealed that, while the proliferation capacity of cryopreserved MSCs decreased significantly compared to fresh cells, the proliferation of encapsulated MSCs remained significantly higher than that of non-encapsulated cells (Fig. 4 C). Microscopic observation indicated that, after 72 h of culture following thawing, the morphology of the cryopreserved MSCs was similar to that of non-frozen cells, both exhibiting a spindle shape (Fig. 4 D), and the cell confluence of hydrogel-encapsulated MSCs was higher than that of non-encapsulated cells(Fig. 4 E). These findings confirm that hydrogel microcapsules protect MSCs from cryogenic damage and improve cell viability. To assess the stability of microencapsulated human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) cryopreserved with 2.5 % DMSO under prolonged frozen storage conditions, cell viability was evaluated after 15 days, 2 months, and 6 months of cryopreservation. The results showed no significant changes in cellular viability (Fig. 4F and G), indicating that hydrogel microcapsules facilitate long-term cryopreservation of hUC-MSCs without compromising their viability. 3.4 The surface markers of MSCs after the cryopreservation.

Fig. 4.

Fig. 4

Cell proliferation and viability assessment of microencapsulated MSCs. (A) AO/EB staining to assess the cell viability of unencapsulated MSCs and microencapsulated MSCs (hydrogel microencapsulated MSCs), with red indicating live cells and green indicating dead cells. (B) Quantitative analysis of cell viability for unencapsulated MSCs and microencapsulated MSCs. (C) CCK-8 assay to evaluate the proliferation of fresh, non-cryopreserved MSCs, cryopreserved unencapsulated MSCs, and microencapsulated MSCs. (D) Microscopic observation of cell morphology and growth status for fresh MSCs, cryopreserved unencapsulated MSCs, and microencapsulated MSCs. (E) Quantitative analysis of cell confluence. (n = 3, ∗∗p < 0.01), scale bar = 100 μm. (F) AO/EB staining to assess the cell viability of microencapsulated MSCs after cryopreservation for different durations. (G) Quantitative analysis of cell viability. (n = 3, ns: p > 0.05).

To assess whether cryopreservation affects the phenotype of MSCs, we examined the expression of cell surface markers. CD44 and CD90 are common positive surface markers for MSCs, while CD34 serves as a negative marker. Flow cytometry was used for the quantitative analysis of these three markers, and the results showed that the expression of CD44, CD90 and CD34 in both microcapsule-encapsulated and non-encapsulated MSCs after cryopreservation did not significantly differ from the non-cryopreserved group (Fig. 5A). To further evaluate the impact of cryopreservation on the expression of cell surface markers, we performed immunofluorescence staining for CD44, CD90 and CD34. The results demonstrated that both before and after cryopreservation, the MSCs expressed CD44 and CD90, while CD34 expression was absent (Fig. 5B).

Fig. 5.

Fig. 5

Detection of MSCs surface markers before and after cryopreservation. (A) Flow cytometric analysis of MSCs surface markers CD44, CD90, and the negative marker CD34 expression. (B) Immunofluorescence analysis of CD44, CD90, and CD34 expression.

3.4. Stemness and multi-lineage differentiation

The self-renewal and multipotent differentiation capabilities of stem cells are primarily regulated by pluripotency-associated genes. To evaluate the impact of cryopreservation on stem cell functionality, we assessed the expression of stemness markers Sox2, Oct4 and Nanog using RT-qPCR. As shown in Fig. 6 A, B and C, the expression of stemness genes in MSCs significantly decreased after cryopreservation. However, encapsulated MSCs exhibited higher expression levels of these pluripotency genes compared to non-encapsulated MSCs. To exclude the inherent effect of 3D culture, we evaluated the expression of stemness genes in MSCs cryopreserved immediately after encapsulation and after 48 h of post-encapsulation culture. The results revealed that 3D culture increased the expression levels of stemness genes(Fig. S3 A-C). Moreover, we further evaluated the multilineage differentiation potential of hUC-MSCs. No significant difference in differentiation potential was observed between fresh and cryopreserved cells, as indicated by adipogenic, osteogenic, and chondrogenic differentiation assays(Fig. 6D). Thus, the multi-lineage differentiation potential was preserved in hUC-MSCs after cryopreservation.

Fig. 6.

Fig. 6

Stemness genes in MSCs and multilineage differentiation before and after cryopreservation. (A–C) Quantitative analysis of the expression of three pluripotency genes in MSCs before and after cryopreservation by RT-qPCR. (n = 3, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001). (D) Qualitative evaluation of osteogenic, adipogenic, and chondrogenic differentiation of cells using Alizarin Red S staining, Oil Red O staining, and Alcian Blue staining, respectively.

4. Discussion

In the study, the fabricated MSC-laden microcapsules were cryopreserved using DMSO at concentrations ranging from 0 % to 10 %. Post-thaw analysis revealed that only microbeads cryopreserved without DMSO underwent significant morphological changes. This preservation may be attributed to DMSO's ability to lower the freezing point of water. Without DMSO, ice crystallization occurs earlier, promoting water redistribution within the hydrogel matrix. This leads to internal structural disruption and deformation of the microcapsule architecture [42]. AO/EB staining results demonstrated that microencapsulated cells preserved with 10 % DMSO maintained a high viability of 86.3 %, while those preserved with 5 % DMSO also exhibited relatively high viability. In contrast, conventional laboratory slow freezing protocols for non-encapsulated MSCs typically yield viability in the range of 70–80 % [43]. These findings indicate that hydrogel microencapsulation may mitigate cellular damage caused by intra-capsular ice crystal formation, thereby enhancing post-thaw cell viability. This protective effect is also supported by cryomicroscopy observations from researchers such as Tomokazu et al. [44], who demonstrated that hydrogel microcapsules can shield hepatocytes from physical damage induced by extracellular ice crystal formation. Furthermore, post-thaw viability was closely associated with cell density. In standard cryopreservation protocols, cell concentrations are typically maintained within the range of 0.5 × 106 to 1 × 107 cells/ml [25]. In this study, as shown in Fig. S2 A and B, the viability of cryopreserved cells was comparable when assessed either immediately after encapsulation or after 48 h of encapsulated culture. This suggests that cryopreservation effectively maintains stable cell viability within a specific cell density range.

Dimethyl sulfoxide (DMSO) remains the preferred cryoprotectant in cell cryopreservation [45]. However, its toxicity has long been a concern. For clinical applications, DMSO concentrations in cryopreserved cell products are typically 10 %. Although the cryoprotectant is removed by centrifugation prior to transplantation, residual DMSO may still cause adverse effects [46]. As indicated earlier, several known side effects of cell transplantation are potentially linked to DMSO content. Studies suggest that lower DMSO concentrations do not compromise transplantation efficacy while diminishing DMSO-induced side effects [[47], [48], [49]]. Consequently, reducing cryoprotectant concentration could mitigate such risks at the source. Zhao et al. demonstrated that hydrogel encapsulation enables stem cell vitrification with low-concentration cryoprotectants [50]. In our study, The results showed that when the DMSO concentration was as low as 2.5 %, although cell viability was lower compared to cells preserved with 10 % DMSO, the survival rate still exceeded 70 %, meeting the minimum viability requirements for clinical cell transplantation [51]. In stark contrast, non-encapsulated MSCs under identical conditions showed ∼50 % survival. This demonstrates that hydrogel microcapsules protect MSCs from freezing damage at low DMSO concentrations, likely through the hydrogel's retained fluidity at low temperatures, which buffers extracellular ice crystal damage [52]. These findings indicate that cryopreserving microencapsulated stem cells with low-concentration DMSO offers dual advantages for clinical translation: reducing DMSO-related toxicity while enhancing post-transplant cell survival [53,54].

Stem cells are clinically utilized for treating various diseases due to their self-renewal capacity and multipotent differentiation potential [55]. The differentiation potential of stem cells is closely related to the expression levels of their pluripotency-associated genes. Therefore, we quantified the relative mRNA levels of key markers (Sox2, Oct4, Nanog) via RT-qPCR. Results revealed that cryopreservation significantly reduced pluripotency gene expression. Notably, microencapsulated MSCs retained higher expression levels of these genes compared to non-encapsulated(p < 0.01). Studies have reported that mesenchymal stem cell spheroids formed in 3D culture exhibit higher expression of pluripotency marker genes [56,57]. Thus, this observed enhancement may be attributed to the 48-h culture period following encapsulation, as demonstrated in Fig. S3 A-C. Although the expression levels of stemness genes were reduced following cryopreservation, the multilineage differentiation capacity was well preserved. Furthermore, phenotypic characterization demonstrated stable expression of MSC-positive markers (CD44, CD90) pre- and post-cryopreservation, while the hematopoietic marker CD34 (negative control) remained undetectable.These results confirm that hydrogel-based cryopreservation preserves the characteristic MSC phenotype and multilineage differentiation potential [58]. Nevertheless, as stem cell functionality extends beyond these parameter, future studies should investigate, the protective effects of microencapsulation on critical functions such as immunomodulation–a paramount determinant, of efficacy in stem cell-based immunotherapies.

This study demonstrates that hydrogel microencapsulation enhances cryoprotection during slow freezing and reduces requisite DMSO concentrations for stem cell preservation. However, comprehensive mechanistic investigations are warranted to elucidate critical factors governing cryopreservation efficacy—including microcapsule diameter, shell thickness, and optimized freeze-thaw protocols—all of which critically influence post-thaw cell viability and functionality. Furthermore, while our assessment focused on short-term cryopreservation outcomes, the ability of hydrogel microcapsules to maintain cellular integrity during extended storage remains unverified. Addressing these knowledge gaps will advance the translational development of microencapsulation-based cryopreservation platforms for clinical-grade MSCs.

5. Conclusion

Hydrogel microencapsulation establishes a three-dimensional growth niche for stem cells, enabling scalable cell production. Direct cryopreservation of microencapsulated MSCs mitigates cryoinjury and facilitates the use of reduced DMSO concentrations. This strategy offers considerable promise for ensuring the safe application of large quantities of ready-to-use cells in clinical settings.

Authors contributions

Zhongqin Tang and Ying Wang conducted the experiments, analyzed the data, prepared figures, and contributed to drafting or reviewing the paper. Ziling Yang, Juan Chen and Shuqi Cai collected materials. Zhiguo Zhang guided the experiments. Zhaolian Wei and Jianye Wang designed the study, guided the experiments, and revised this manuscript. All authors wrote parts of the manuscript, read and approved the final manuscript

Author disclosure statement

The authors declare no conflict of interests in carrying out this research.

Funding information

This work was supported by grants from National Natural Science Foundation of China (No.82171619), Anhui Institute of Translational Medicine Funding Project (No. 2024zh-05).

Footnotes

Peer review under responsibility of the Japanese Society for Regenerative Medicine.

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.reth.2025.10.016.

Contributor Information

Jianye Wang, Email: wangjianye9@126.com.

Zhaolian Wei, Email: weizhaolian_1@126.com.

Appendix A. Supplementary data

The following is the supplementary data to this article:

Multimedia component 1
mmc1.docx (879.5KB, docx)

References

  • 1.Ankrum J.A., Ong J.F., Karp J.M. Mesenchymal stem cells: immune evasive, not immune privileged. Nat Biotechnol. 2014;32(3):252–260. doi: 10.1038/nbt.2816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Turinetto V., Vitale E., Giachino C. Senescence in human mesenchymal stem cells: functional changes and implications in stem cell-based therapy. Int J Mol Sci. 2016;17(7) doi: 10.3390/ijms17071164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ben-David U., Mayshar Y., Benvenisty N. Large-scale analysis reveals acquisition of lineage-specific chromosomal aberrations in human adult stem cells. Cell Stem Cell. 2011;9(2):97–102. doi: 10.1016/j.stem.2011.06.013. [DOI] [PubMed] [Google Scholar]
  • 4.RøSLAND G.V., Svendsen A., Torsvik A., et al. Long-term cultures of bone marrow-derived human mesenchymal stem cells frequently undergo spontaneous malignant transformation. Cancer Res. 2009;69(13):5331–5339. doi: 10.1158/0008-5472.CAN-08-4630. [DOI] [PubMed] [Google Scholar]
  • 5.Trucillo P. Biomaterials for drug delivery and human applications. Materials (Basel, Switzerland) 2024;17(2) doi: 10.3390/ma17020456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Wang H., Yang L., Yang Y. A review of sodium alginate-based hydrogels: structure, mechanisms, applications, and perspectives. Int J Biol Macromol. 2025;292 doi: 10.1016/j.ijbiomac.2024.139151. [DOI] [PubMed] [Google Scholar]
  • 7.Gryshkov O., Mutsenko V., Tarusin D., et al. Coaxial alginate hydrogels: from self-assembled 3D cellular constructs to long-term storage. Int J Mol Sci. 2021;22(6) doi: 10.3390/ijms22063096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Pawar S.N., Edgar K.J. Alginate derivatization: a review of chemistry, properties and applications. Biomaterials. 2012;33(11):3279–3305. doi: 10.1016/j.biomaterials.2012.01.007. [DOI] [PubMed] [Google Scholar]
  • 9.Fang Y., Al-Assaf S., Phillips G.O., et al. Multiple steps and critical behaviors of the binding of calcium to alginate. J Phys Chem B. 2007;111(10):2456–2462. doi: 10.1021/jp0689870. [DOI] [PubMed] [Google Scholar]
  • 10.Agarwal P., Choi J.K., Huang H., et al. Vol. 32. 2015. A biomimetic core-shell platform for miniaturized 3D cell and tissue engineering; pp. 809–816. (Particle & particle systems characterization : measurement and description of particle properties and behavior in powders and other disperse systems). 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Abbas S.E.M., Maged G., Wang H., et al. Mesenchymal stem/stromal cells microencapsulation for cell therapy. Cells. 2025;14(3) doi: 10.3390/cells14030149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Augst A.D., Kong H.J., Mooney D.J. Alginate hydrogels as biomaterials. Macromol Biosci. 2006;6(8):623–633. doi: 10.1002/mabi.200600069. [DOI] [PubMed] [Google Scholar]
  • 13.Lv J., Yao X., Zheng Y., et al. Antiadhesion organogel materials: from liquid to solid. Adv Mater (Deerfield Beach, Fla) 2017;29(45) doi: 10.1002/adma.201703032. [DOI] [PubMed] [Google Scholar]
  • 14.Kusano T., Aoki T., Yasuda D., et al. Microencapsule technique protects hepatocytes from cryoinjury. Hepatol Res. 2008;38(6):593–600. doi: 10.1111/j.1872-034X.2007.00311.x. [DOI] [PubMed] [Google Scholar]
  • 15.Huang H., Choi J.K., Rao W., et al. Alginate hydrogel microencapsulation inhibits devitrification and enables large-volume Low-CPA cell vitrification. Adv Funct Mater. 2015;25(44) doi: 10.1002/adfm.201503047. 6939-850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Parihar A., Kumar A., Panda U., et al. Cryopreservation: a comprehensive overview, challenges, and future perspectives. Adv Biol. 2023;7(6) doi: 10.1002/adbi.202200285. [DOI] [PubMed] [Google Scholar]
  • 17.Hunt C.J. Cryopreservation: vitrification and controlled rate cooling. Methods Mol Biol. 2017;1590:41–77. doi: 10.1007/978-1-4939-6921-0_5. [DOI] [PubMed] [Google Scholar]
  • 18.Pegg D.E. Principles of cryopreservation. Methods Mol Biol. 2015;1257:3–19. doi: 10.1007/978-1-4939-2193-5_1. [DOI] [PubMed] [Google Scholar]
  • 19.Fahy G.M., Wowk B. Principles of ice-free cryopreservation by vitrification. Methods Mol Biol. 2021;2180:27–97. doi: 10.1007/978-1-0716-0783-1_2. [DOI] [PubMed] [Google Scholar]
  • 20.Khaydukova I.V., Ivannikova V.M., Zhidkov D.A., et al. Current state and challenges of tissue and organ cryopreservation in biobanking. Int J Mol Sci. 2024;25(20) doi: 10.3390/ijms252011124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Best B.P. Cryoprotectant toxicity: facts, issues, and questions. Rejuvenation Res. 2015;18(5):422–436. doi: 10.1089/rej.2014.1656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Edgar D.H., Gook D.A. A critical appraisal of cryopreservation (slow cooling versus vitrification) of human oocytes and embryos. Hum Reprod Update. 2012;18(5):536–554. doi: 10.1093/humupd/dms016. [DOI] [PubMed] [Google Scholar]
  • 23.Wang X., Hua T.C., Sun D.W., et al. Cryopreservation of tissue-engineered dermal replacement in Me2SO: toxicity study and effects of concentration and cooling rates on cell viability. Cryobiology. 2007;55(1):60–65. doi: 10.1016/j.cryobiol.2007.05.006. [DOI] [PubMed] [Google Scholar]
  • 24.Crowley C.A., Smith W.P.W., Seah K.T.M., et al. Cryopreservation of human adipose tissues and adipose-derived stem cells with DMSO and/or Trehalose: a systematic review. Cells. 2021;10(7) doi: 10.3390/cells10071837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Baust J.M., Campbell L.H., Harbell J.W. Best practices for cryopreserving, thawing, recovering, and assessing cells. In Vitro Cell Dev Biol Anim. 2017;53(10):855–871. doi: 10.1007/s11626-017-0201-y. [DOI] [PubMed] [Google Scholar]
  • 26.Shivakumar S.B., Bharti D., Subbarao R.B., et al. DMSO- and serum-free cryopreservation of Wharton's jelly tissue isolated from human umbilical cord. J Cell Biochem. 2016;117(10):2397–2412. doi: 10.1002/jcb.25563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Halle P., Tournilhac O., Knopinska-Posluszny W., et al. Uncontrolled-rate freezing and storage at -80 degrees C, with only 3.5-percent DMSO in cryoprotective solution for 109 autologous peripheral blood progenitor cell transplantations. Transfusion. 2001;41(5):667–673. doi: 10.1046/j.1537-2995.2001.41050667.x. [DOI] [PubMed] [Google Scholar]
  • 28.Murray K.A., TomáS R.M.F., Gibson M.I. Low DMSO cryopreservation of stem cells enabled by macromolecular cryoprotectants. ACS Appl Bio Mater. 2020;3(9):5627–5632. doi: 10.1021/acsabm.0c00638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Awan M., Buriak I., Fleck R., et al. Dimethyl sulfoxide: a central player since the dawn of cryobiology, is efficacy balanced by toxicity? Regen Med. 2020;15(3):1463–1491. doi: 10.2217/rme-2019-0145. [DOI] [PubMed] [Google Scholar]
  • 30.Morris C., De Wreede L., Scholten M., et al. Should the standard dimethyl sulfoxide concentration be reduced? Results of a european group for blood and marrow transplantation prospective noninterventional study on usage and side effects of dimethyl sulfoxide. Transfusion. 2014;54(10):2514–2522. doi: 10.1111/trf.12759. [DOI] [PubMed] [Google Scholar]
  • 31.Cox M.A., Kastrup J., Hrubiško M. Vol. 13. 2012. Historical perspectives and the future of adverse reactions associated with haemopoietic stem cells cryopreserved with dimethyl sulfoxide; pp. 203–215. (Cell and tissue banking). 2. [DOI] [PubMed] [Google Scholar]
  • 32.Abdelkefi A., Lakhal A., Moojat N., et al. Severe neurotoxicity associated with dimethyl sulphoxide following PBSCT. Bone Marrow Transplant. 2009;44(5):323–324. doi: 10.1038/bmt.2009.13. [DOI] [PubMed] [Google Scholar]
  • 33.Ataseven E., TüFEKçI Ö., Yilmaz Ş., et al. Neurotoxicity associated with dimethyl sulfoxide used in allogeneic stem cell transplantation. J Pediatr Hematology/oncol. 2017;39(5):e297–e299. doi: 10.1097/MPH.0000000000000784. [DOI] [PubMed] [Google Scholar]
  • 34.ZenhäUSERN R., Tobler A., Leoncini L., et al. Fatal cardiac arrhythmia after infusion of dimethyl sulfoxide-cryopreserved hematopoietic stem cells in a patient with severe primary cardiac amyloidosis and end-stage renal failure. Ann Hematol. 2000;79(9):523–526. doi: 10.1007/s002770000186. [DOI] [PubMed] [Google Scholar]
  • 35.Benekli M., Anderson B., Wentling D., et al. Severe respiratory depression after dimethylsulphoxide-containing autologous stem cell infusion in a patient with AL amyloidosis. Bone Marrow Transplant. 2000;25(12):1299–1301. doi: 10.1038/sj.bmt.1702452. [DOI] [PubMed] [Google Scholar]
  • 36.Sugiura S., Oda T., Aoyagi Y., et al. Microfabricated airflow nozzle for microencapsulation of living cells into 150 micrometer microcapsules. Biomed Microdevices. 2007;9(1):91–99. doi: 10.1007/s10544-006-9011-9. [DOI] [PubMed] [Google Scholar]
  • 37.Stanton M.M., Samitier J., SáNCHEZ S. Bioprinting of 3D hydrogels. Lab Chip. 2015;15(15):3111–3115. doi: 10.1039/c5lc90069g. [DOI] [PubMed] [Google Scholar]
  • 38.Agarwal P., Zhao S., Bielecki P., et al. One-step microfluidic generation of pre-hatching embryo-like core-shell microcapsules for miniaturized 3D culture of pluripotent stem cells. Lab Chip. 2013;13(23):4525–4533. doi: 10.1039/c3lc50678a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.De Mori A., PeñA FernáNDEZ M., Blunn G., et al. 3D printing and electrospinning of composite hydrogels for cartilage and bone tissue engineering. Polymers. 2018;10(3) doi: 10.3390/polym10030285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Nguyen D.K., Son Y.M., Lee N.E. Hydrogel encapsulation of cells in core-shell microcapsules for cell delivery. Adv Healthcare Mater. 2015;4(10):1537–1544. doi: 10.1002/adhm.201500133. [DOI] [PubMed] [Google Scholar]
  • 41.Xu X., Xing Q., Liu R., et al. Therapeutic effects and repair mechanism of HGF gene-transfected mesenchymal stem cells on injured endometrium. Stem Cell Int. 2022;2022 doi: 10.1155/2022/5744538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Mandumpal J.B., Kreck C.A., Mancera R.L. A molecular mechanism of solvent cryoprotection in aqueous DMSO solutions. Phys Chem Chem Phys : Phys Chem Chem Phys. 2011;13(9):3839–3842. doi: 10.1039/c0cp02326d. [DOI] [PubMed] [Google Scholar]
  • 43.Wang J., Li R. Effects, methods and limits of the cryopreservation on mesenchymal stem cells. Stem Cell Res Ther. 2024;15(1):337. doi: 10.1186/s13287-024-03954-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Zhao G., Takamatsu H., He X. The effect of solution nonideality on modeling transmembrane water transport and diffusion-limited intracellular ice formation during cryopreservation. J Appl Phys. 2014;115(14) doi: 10.1063/1.4870826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Jahan S., Kaushal R., Pasha R., et al. Current and future perspectives for the cryopreservation of cord blood stem cells. Transfus Med Rev. 2021;35(2):95–102. doi: 10.1016/j.tmrv.2021.01.003. [DOI] [PubMed] [Google Scholar]
  • 46.Traversari G., Delogu F., Aparicio S., et al. Vol. 119. 2022. hMSCs in contact with DMSO for cryopreservation: experiments and modeling of osmotic injury and cytotoxic effect; pp. 2890–2907. (Biotechnology and bioengineering). 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Mitrus I., Smagur A., Giebel S., et al. A faster reconstitution of hematopoiesis after autologous transplantation of hematopoietic cells cryopreserved in 7.5% dimethyl sulfoxide if compared to 10% dimethyl sulfoxide containing medium. Cryobiology. 2013;67(3):327–331. doi: 10.1016/j.cryobiol.2013.09.167. [DOI] [PubMed] [Google Scholar]
  • 48.AkköK C.A., Liseth K., Nesthus I., et al. Autologous peripheral blood progenitor cells cryopreserved with 5 and 10 percent dimethyl sulfoxide alone give comparable hematopoietic reconstitution after transplantation. Transfusion. 2008;48(5):877–883. doi: 10.1111/j.1537-2995.2008.01648.x. [DOI] [PubMed] [Google Scholar]
  • 49.Mitrus I., Smagur A., Fidyk W., et al. Reduction of DMSO concentration in cryopreservation mixture from 10% to 7.5% and 5% has no impact on engraftment after autologous peripheral blood stem cell transplantation: results of a prospective, randomized study. Bone Marrow Transplant. 2018;53(3):274–280. doi: 10.1038/s41409-017-0056-6. [DOI] [PubMed] [Google Scholar]
  • 50.Zhao G., Liu X., Zhu K., et al. Hydrogel encapsulation facilitates rapid-cooling cryopreservation of stem cell-laden core-shell microcapsules as cell-biomaterial constructs. Adv Healthcare Mater. 2017;6(23) doi: 10.1002/adhm.201700988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Guadix J.A., LóPEZ-Beas J., Clares B., et al. Principal criteria for evaluating the quality, safety and efficacy of hMSC-Based products in clinical practice: current approaches and challenges. Pharmaceutics. 2019;11(11) doi: 10.3390/pharmaceutics11110552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Jian Y., Handschuh-Wang S., Zhang J., et al. Biomimetic anti-freezing polymeric hydrogels: keeping soft-wet materials active in cold environments. Mater Horiz. 2021;8(2):351–369. doi: 10.1039/d0mh01029d. [DOI] [PubMed] [Google Scholar]
  • 53.Regmi S., Raut P.K., Pathak S., et al. Enhanced viability and function of mesenchymal stromal cell spheroids is mediated via autophagy induction. Autophagy. 2021;17(10):2991–3010. doi: 10.1080/15548627.2020.1850608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Barron C., He J.Q. Alginate-based microcapsules generated with the coaxial electrospray method for clinical application. J Biomater Sci Polym Ed. 2017;28(13):1245–1255. doi: 10.1080/09205063.2017.1318030. [DOI] [PubMed] [Google Scholar]
  • 55.Zhao C.H. Concept of mesenchymal stem cells: bring more insights into functional research of MSC] Zhongguo shi yan xue ye xue za zhi. 2013;21(2):263–267. doi: 10.7534/j.issn.1009-2137.2013.02.001. [DOI] [PubMed] [Google Scholar]
  • 56.Li Y., Guo G., Li L., et al. Vol. 360. 2015. Three-dimensional spheroid culture of human umbilical cord mesenchymal stem cells promotes cell yield and stemness maintenance; pp. 297–307. (Cell and tissue research). 2. [DOI] [PubMed] [Google Scholar]
  • 57.Zhang S., Liu P., Chen L., et al. The effects of spheroid formation of adipose-derived stem cells in a microgravity bioreactor on stemness properties and therapeutic potential. Biomaterials. 2015;41:15–25. doi: 10.1016/j.biomaterials.2014.11.019. [DOI] [PubMed] [Google Scholar]
  • 58.Yong K.W., Wan Safwani W.K., Xu F., et al. Vol. 13. 2015. Cryopreservation of human mesenchymal stem cells for clinical applications: current methods and challenges; pp. 231–239. (Biopreservation and biobanking). 4. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.docx (879.5KB, docx)

Articles from Regenerative Therapy are provided here courtesy of Japanese Society for Regenerative Medicine

RESOURCES