Abstract
Objectives
Platinum-based chemotherapy remains a mainstay for bladder cancer treatment, yet resistance often arises through activation of the Fanconi anemia (FA) DNA repair pathway. The monoubiquitination of the FANCI-FANCD2 (ID2) complex by FANCL and UBE2T is a critical step in repairing cisplatin-induced interstrand crosslinks (ICLs). Identifying small molecules that block this process may improve the therapeutic efficacy of cisplatin.
Methods
We investigated the effects of piperine, a natural alkaloid from black pepper, on FA pathway activation in bladder cancer cells. A combination of immunoblotting, immunofluorescence, co-immunoprecipitation, qPCR-blocking assays, dot blot analyses, in vitro ubiquitination/discharge assays, biolayer interferometry (BLI), and differential scanning fluorimetry (DSF) were employed to characterize the molecular mechanism. Xenograft models were used to evaluate in vivo efficacy.
Results
Piperine pretreatment markedly suppressed cisplatin-induced monoubiquitination of FANCI and FANCD2 and reduced FANCD2 foci formation in T24, 5637, and RT4 cells. Co-immunoprecipitation confirmed diminished recruitment of downstream nucleases and repair factors (FANCP, FANCQ, PCNA). qPCR-blocking assays showed delayed ICL repair, while dot blot analyses revealed that intrastrand cisplatin adduct removal was unaffected, indicating selective inhibition of ICL repair. Piperine did not alter mRNA or protein expression of FANCL, UBE2T, USP1, or UAF1, nor did it enhance deubiquitinase activity. Instead, in vitro assays demonstrated that piperine blocked FANCL-mediated ubiquitin transfer from UBE2T∼Ub to the ID2 complex, without impairing E2 charging or FANCL-UBE2T binding. BLI confirmed unaltered binding affinity, whereas DSF revealed a significant ΔTm shift for UBE2T, consistent with allosteric modulation. In xenografts, combined cisplatin and piperine treatment significantly reduced tumor growth and attenuated FANCI/FANCD2 monoubiquitination.
Conclusion
Our findings uncover piperine as a natural compound that allosterically inhibits UBE2T activity within the FA pathway, thereby impairing ID2 monoubiquitination and enhancing cisplatin sensitivity in bladder cancer. This study highlights the therapeutic potential of piperine and provides a rationale for targeting the FA repair axis to overcome platinum resistance.
Keywords: piperine, UBE2T, FA pathway, bladder cancer, cisplatin
Graphical Abstract.
Introduction
Bladder cancer (BC) is one of the most common malignancies of the urinary system, with a relatively high incidence and mortality rate worldwide.1-3 Despite advances in surgical and immunotherapeutic approaches, systemic chemotherapy remains a cornerstone in the treatment of advanced and metastatic BC. Among chemotherapeutic agents, platinum-based drugs such as cisplatin are the most widely used. However, the clinical effectiveness of these agents is limited by the development of drug resistance, which significantly reduces patient survival.4,5 A major contributor to this resistance is the ability of tumor cells to repair chemotherapy-induced DNA damage.6,7 In particular, the enhanced capacity of BC cells to activate DNA repair pathways undermines the cytotoxic effects of platinum drugs, thereby posing a critical challenge for improving therapeutic outcomes.8,9
The Fanconi anemia (FA) signaling pathway plays a central role in the repair of DNA interstrand crosslinks (ICLs), one of the most severe forms of DNA damage induced by platinum-based chemotherapy. 10 Activation of the FA pathway involves the monoubiquitination of the FANCI-FANCD2 (ID2) complex, which functions as a recruitment platform for downstream nucleases and homologous recombination proteins.11-13 This process is tightly regulated by the FA core complex, in which FANCL acts as the E3 ubiquitin ligase. FANCL cooperates with the E2 ubiquitin-conjugating enzyme UBE2T to catalyze the transfer of ubiquitin to the ID2 complex, thus initiating the DNA repair cascade. By facilitating efficient repair of cisplatin-induced ICLs, the FA pathway contributes to chemoresistance in BC.14,15 Understanding the molecular details of FANCL and UBE2T function is therefore critical for identifying novel therapeutic strategies aimed at sensitizing tumor cells to platinum-based chemotherapy.
Piperine, an alkaloid from black pepper, has been widely studied as an anticancer adjuvant that suppresses tumor cell proliferation, invasion and survival through inhibition of NF-κB and STAT3 signaling, attenuation of PI3K/AKT and MAPK pathways, modulation of drug-efflux transporters, and induction of apoptosis and autophagy.16,17 Several preclinical studies further indicate that piperine can potentiate platinum chemotherapy in multiple tumor types, enhancing cisplatin/carboplatin cytotoxicity and apoptosis in cancer cells by dampening prosurvival signaling and/or reducing drug efflux.18,19
To our knowledge, direct interrogation of FA pathway in the context of piperine has not been reported. Here we address this gap in BC. We show that piperine targets a functional hotspot within the FANCL/UBE2T E3-E2 complex, thereby impairing FANCL-dependent monoubiquitination of the ID2 complex. 20 Loss of ID2 monoubiquitination limits stable chromatin engagement of the FA machinery and blunts timely repair of cisplatin-induced ICLs, which in turn sensitizes BC cells to platinum. Mechanistically, our work uncovers a previously unrecognized mode of FA pathway inhibition by a natural product, establishing the FANCL/UBE2T interface as a druggable node. Functionally, piperine’s inhibition of ID2 activation enforces persistence of DNA damage, driving apoptosis under cisplatin challenge. Clinically, these findings nominate piperine-or derivatives optimized around this interface-as a rational chemo-sensitizer for platinum-based regimens in BC, with the potential to lower effective cisplatin doses, broaden responses in FA-proficient tumors, and provide a mechanism-anchored biomarker strategy to guide combination therapy.
Materials and Methods
Study Duration
The start and end time of the project execution was June and December 2024.
Cell Culture
Human bladder cancer cell lines T24 (Cat. HTB-4), 5637 (Cat. HTB-9), and RT4 (Cat. HTB-2) were obtained from the American Type Culture Collection (ATCC, USA). T24 and 5637 cells were cultured in RPMI-1640 medium (Gibco, Thermo Fisher Scientific, USA) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin-streptomycin (Gibco). RT4 cells were maintained in McCoy’s 5A medium (Gibco) with 10% FBS and 1% penicillin-streptomycin. All cell lines were grown at 37°C in a humidified incubator containing 5% CO2. Cell line authenticity was confirmed by short tandem repeat (STR) profiling within the past three years, and routine mycoplasma testing consistently yielded negative results.
For drug treatments, cisplatin (Sigma-Aldrich, USA, Cat. P4394) was used at 10 μM for 12 h. Piperine (MedChemExpress, China, Cat. HY-N0144) was dissolved in 100 mM DMSO as a stock and diluted in RPMI-1640 medium to achieve the indicated final concentrations. Piperine was applied as a 24 h pretreatment at 20 μM (0.1% (v/v) DMSO) prior to subsequent assays in all cellular experiments. For USP1 and UAF1 knockdown, siRNA duplexes targeting human USP1 21 (5′- UCGGCAAUACUUGCUAUCUUA -3′, GenePharma, China) and UAF1 22 (5′- GGUCGAGACUCCAUCAUAA -3′, GenePharma) were transfected at a final concentration of 50 nM using Lipofectamine RNAiMAX (Invitrogen, Thermo Fisher Scientific, Cat. 13778150) according to the manufacturer’s instructions.
Western Blot
Cell lysates were prepared in RIPA buffer and protein concentrations measured using the BCA assay (Thermo Fisher Scientific, Cat. 23227). Non-reducing SDS-PAGE is performed using a sample buffer without β-mercaptoethanol or DTT and without heat denaturation prior to loading. Equal amounts (40 µg) of protein were separated by SDS-PAGE, transferred to PVDF membranes, and blocked with 5% non-fat milk in TBST. Membranes were incubated with the following primary antibodies at 1:2000 dilution overnight at 4°C: FANCI (Thermo Fisher Scientific, Cat. A300-212 A), FANCD2 (Thermo Fisher Scientific, Cat. MA1-16570), FANCP/SLX4 (Thermo Fisher Scientific, Cat. PA5-45039), FANCQ/XPF (Thermo Fisher Scientific, Cat. PA5-117118), PCNA (Thermo Fisher Scientific, Cat. 13-3900), FANCL (Abcam, Cat. ab272618), UBE2T/HSPC150 (Abcam, Cat. ab179802), USP1 (Cell Signaling Technology, USA, Cat. 4933), UAF1/WDR48 (Abcam, Cat. ab97343), GAPDH (Cell Signaling Technology, Cat. 2118). After washing, membranes were incubated with HRP-conjugated secondary antibodies (anti-rabbit IgG or anti-mouse IgG, depending on host species; Cell Signaling Technology, Cat. 7074 for rabbit, Cat. 7076 for mouse) at 1:5000 dilution for 1 h at room temperature. Bands were visualized using enhanced chemiluminescence (Promega, USA, Cat. W1001) detection and quantified by densitometry.
Immunofluorescence Assay for FANCD2 Foci
Cells were seeded on sterile glass coverslips and subjected to cisplatin treatments. Where indicated, ice-cold cytoskeleton buffer (10 mM PIPES [pH 6.8], 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 1 mM EGTA, 0.5% Triton X-100, 1 mM DTT, 1× protease/phosphatase inhibitors) was used to remove soluble proteins by 2 min, then 4% paraformaldehyde in PBS was used for immediate fixation in for 10 min at room temperature. After three PBS washes, cells were permeabilized with 0.5% Triton X-100 in PBS for 5 min and blocked in 5% BSA in PBS for 1 h. Coverslips were incubated overnight at 4°C with anti-FANCD2 primary antibody (1:1000 in blocking buffer). After PBS washes, cells were incubated with Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody Alexa Fluor 488 (Invitrogen, Cat. A-11001, 1:1,000, 1 h, room temperature), counterstained with DAPI (Sigma-Aldrich, Cat. D9542), and mounted using ProLong Gold Antifade Mountant (Thermo Fisher Scientific, Cat. P36930). Images were acquired on a laser-scanning confocal microscope (60×/63× oil objective) using matched exposure settings across conditions; z-stacks (0.4 µm steps) were collected and maximum-intensity projections generated in ImageJ. Quantification was performed blinded on ≥100-200 nuclei per condition from at least three independent experiments; cells with ≥5 FANCD2 foci/nucleus were scored as foci-positive, and both percentage of foci-positive cells and mean foci per nucleus were reported. Statistical analysis was carried out using two-tailed t-tests or one-way ANOVA with appropriate post hoc tests, as specified in the figure legends.
Immunoprecipitation
1 × 107 BC cells were rinsed in ice-cold PBS and lysed for 30 min on ice in IP lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.5% Triton X-100, 1 mM EDTA, 1 × protease/phosphatase inhibitors). Lysates were cleared by centrifugation (14,000×g, 15 min, 4°C), protein concentration was measured by BCA assay, and equal amounts of protein (1 mg) were precleared with Protein A/G magnetic beads (Thermo Fisher Scientific, Cat. 88803) at 4°C for 30 min. For IP, supernatants were incubated overnight at 4°C with 1 µg anti-FANCD2 antibody with gentle rotation, followed by addition of Protein A/G beads for 2 h at 4°C. Beads were washed 5 times with lysis buffer (first two washes at 150 mM NaCl, then optionally one high-salt wash at 300 mM NaCl to increase stringency), and bound proteins were eluted by boiling in 2× Laemmli sample buffer (65.8 mM Tris-HCl, [pH 6.8], 2.1% SDS, 26.3% (w/v) glycerol, 0.01% bromophenol blue) for 5 min. Eluates and matched inputs (1% of total) were resolved by SDS-PAGE and transferred to PVDF. Western blots were probed with primary antibodies against FANCP/SLX4, FANCQ/XPF, and PCNA to detect co-immunoprecipitated proteins; membranes were also reprobed for FANCD2 to confirm IP efficiency. Isotype IgG control IPs and no-antibody bead controls were included to assess nonspecific binding. Where indicated, lysates were treated with 50 µg/mL ethidium bromideduring incubation to test whether interactions were DNA-bridged. Signals were quantified by densitometry and co-IP levels were normalized to the amount of immunoprecipitated FANCD2 and to input controls.
Long-Fragment Quantitative PCR (qPCR Blocking) Assay
The formation and repair kinetics of DNA ICLs were quantified using this method. Briefly, genomic DNA was extracted from bladder cancer cells at the 0, 6, and 24 h time points after treatment and quantified spectrophotometrically. Genomic DNA from treated and untreated (NC) bladder cancer cells was purified and amplified with SYBR Green using the following human HBB locus primers: long amplicon (∼10.1 kb), Primer F: 5′-GCTGAGTTCTCTGGCTGTGTTC -3’; R: 5′- CCAGGAGAAGTCAGGGTAGGAA -3’; short amplicon (∼122 bp), Primer F: 5′- TGCACGTGGATCTGTCCGAA -3’; R: 5′- GCACCTGACTCTCTCCACCA -3’. Lesion frequency was derived from Ct values as follows: ΔCt_long = Ct(treated)_long - Ct(NC)_long and ΔCt_short = Ct(treated)_short - Ct(NC)short; relative amplification for each amplicon RA = 2^−ΔCt; normalized relative amplification RA_norm = RA_long/RA_short. Assuming a Poisson distribution of blocking lesions, the ICLs frequency per 10 kb was calculated as λ(10 kb) = −ln(RA_norm) × (10,000/L), where L is the long-amplicon length (bp). To confirm assay specificity for ICLs, parallel DNA samples were subjected to de-crosslinking by incubation at 65°C for 2 h in 50 mM Tris-HCl (pH 8.0) prior to amplification, which restored long-amplicon amplification to NC levels.
Dot Blot
Genomic DNA of BC cells was isolated from cells using a phenol-chloroform based kit, RNase A-treated, and quantified by UV spectrophotometry. For each sample, 0.5 µg DNA was brought to equal volume and denatured in 0.4 M NaOH, 10 mM EDTA for 10 min in room temperature, then chilled on ice. 2 µL denatured DNA per spot was applied to a positively charged nitrocellulose membrane using a dot-blot manifold or by manual spotting. Membranes were neutralized in 2× SSC, air-dried, and cross-linked (UV 150 mJ/cm2 for 30 min). After blocking in 5% non-fat milk/TBST for 1 h at room temperature, membranes were incubated overnight at 4°C with an anti-cisplatin DNA adducts antibody, clone ICR4 (Merck, USA, Cat. MABE416, 1:1000 in 5% milk/TBST). Following washing, membranes were incubated with HRP-conjugated secondary antibody at 1:5000 dilution for 1 h at room temperature, and developed by chemiluminescence. To control for loaded DNA, the same membrane was briefly stained with 0.02% methylene blue in 0.3 M sodium acetate (pH 5.2), imaged, and used to normalize signal intensity. Positive control DNA (purified genomic DNA incubated in vitro with cisplatin) and negative control DNA (untreated) were included on each membrane. Dots were quantified by ImageJ, and cisplatin-DNA adduct signal was reported as ECL intensity normalized to methylene blue total-DNA signal and expressed relative to the control sample.
Regular Quantitative PCR (qPCR)
Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Cat. No. 15596018) according to the manufacturer’s protocol. cDNA synthesis was performed using the PrimeScript RT reagent kit (Takara, Japan, Cat. No. RR037 A), and was conducted with TB Green Premix Ex Taq II (Takara, Cat. No. RR820 A) on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Cat. 4 485 691). The mRNA levels of the target gene were normalized to GAPDH. Primer sequence were listed below:
FANCL, F: 5′- GGAGTGCAACAGCACGCAGAAT -3’; R: 5′- CTGCTCAGCTTAATTCCCAGGG -3’; UBE2T, F: 5′- TTGATTCTGCTGGAAGGATTTG -3’; R: 5′- CAGTTGCGATGTTGAGGGAT -3’; USP1, F: 5′- GCTTTGCTGCTAGTGGTTTG -3’; R: 5′- GTTGGCTTTGTGCTCCATTC -3’; UAF1, F: 5′- GGTCGAGACTCTATCATAA -3’; R: 5′- GCAGAGATGTATAGCAACA -3’; GAPDH, F: 5′- GGTGTGAACCATGAGAAGTATGA -3’; R: 5′- GAGTCCTTCCACGATACCAAAG -3’.
In Vitro Ubiquitination Assays
In vitro ubiquitination assays were carried out in 50 μL reactions (25 mM Tris-HCl [pH 7.5], 100 mM NaCl, 5 mM MgCl2, 1 mM DTT, 0.01% Tween-20, 0.1 mg/mL BSA, and 2 mM ATP (MedChemExpress, Cat. HY-B2176)). Recombinant human FANCI (Biodragon, China, Cat. BA11877, 0.5 μM), FANCD2 (Biodragon, Cat. BA13691, 0.5 μM), UBA1 (Biodragon, Cat. BA50877, 0.05 μM), UBE2T (Biodragon, Cat. BA11973, 0.5 μM), FANCL (Novus Biologicals, Cat. H00055120-P01, 0.25 μM), dsDNA (200 bp, 100 nM), ubiquitin (Abcam, Cat. ab269109, 10 μM), were mixed in the presence of piperine (10, 20, 40 μM). Reactions were incubated at 37°C for 30 min and terminated by 2× Laemmli buffer; samples were resolved by SDS-PAGE and immunoblotted for FANCD2 and FANCI. Positive control reactions included CU2 (MedChemExpress, Cat. HY-126539, 20 μM).
Two-step E2 Charging and Discharging Assay
UBE2T charging reaction was performed in charging buffer (50 μL containing 50 mM HEPES [pH 7.5], 100 mM NaCl, 5 mM MgCl2, 0.5 mM DTT, 0.01% Tween-20, 2 mM ATP, with UBA1 (0.1 μM), UBE2T (0.5 μM), and ubiquitin (10 μM)). After 10 min at 30°C, the reaction was desalted to remove free ubiquitin and ATP. Samples were passed twice through Zeba Spin Desalting Columns (Thermo Fisher Scientific, Cat. 89882) pre-equilibrated with charging buffer. The resulting UBE2T-Ub thioester conjugates were immediately used in subsequent discharging assays. Discharge reaction was performed in discharge buffer (50 μL containing 25 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl2, 0.01% Tween-20, with FANCL (0.5 μM), FANCI (0.5 μM), FANCD2 (0.5 μM), dsDNA (100 nM), and piperine (20, 40 μM). Reactions were incubated at 30°C for 10, 30 and 60 min, terminated in nonreducing sample buffer. 10% non-reducing SDS-PAGE gel was used to confirm the UBE2T substrate ubiquitination. 5% regular SDS-PAGE gel was used to detect monoubiquitination of ID2 complex.
Biolayer Interferometry (BLI) Assay
FANCL-UBE2T binding was quantified on an Octet RED96e System (Sartorius, Germany). Streptavidin biosensors (Sartorius, Cat. 18-5019) were hydrated in assay buffer (20 mM HEPES [pH 7.4], 150 mM NaCl, 2 mM MgCl2, 0.01% Tween-20, 1 mM TCEP, 0.1 mg/mL BSA) for 30 min. 5 µg/mL Biotinylated FANCL-RING was generated using in-vitro BirA biotinylation by Sangon Biotech (China), desalted into assay buffer, and immobilized to a loading response of 1 nm to avoid mass-transport artifacts. Sensors were baseline-equilibrated, then dipped into UBE2T (25, 50, 100, 200, 400, 800 nM) prepared in assay buffer ± piperine at 0, 10, 20, 40, 60 µM in 0.1% DMSO. Binding responses were recorded in arbitrary units (a.u.), which represented relative optical interference signal shifts caused by changes in the optical thickness at the biosensor surface. These signals were dimensionless values standardized by the instrument software and allow for comparison of binding kinetics between conditions. Association and dissociation phases were each 300 s; double-referencing (sensor without ligand + buffer reference) was applied. Data were globally fitted to a 1:1 model with Octet Data Analysis software to obtain kon, koff, and Kd.
Differential Scanning Fluorimetry (DSF)
DSF was performed to assess ligand-induced thermal shifts of UBE2T and FANCL. Recombinant human UBE2T and FANCL were buffer-exchanged into DSF buffer (20 mM HEPES [pH 7.4], 150 mM NaCl, 2 mM DTT, 0.01% Tween-20). 20 µL reaction system contained 5 µM protein, 5× SYPRO Orange (Thermo Fisher Scientific, Cat. S6650), and piperine (10 and 60 μM) in 0.1% DMSO. Samples were dispensed into an optically clear qPCR plate (Applied Biosystems, Thermo Fisher Scientific, Cat. N8010560) and sealed with optical adhesive film (Applied Biosystems Thermo Fisher Scientific, Cat. 4 311 971). Plates were spun briefly (200×g, 30 s) and measured on a QuantStudio 6 Flex Real-Time PCR System. Temperature was ramped from 25°C to 95°C at 0.5°C/min with continuous fluorescence acquisition. Raw fluorescence (RFU) vs temperature curves were exported from QuantStudio software and Tm values determined as the peak of the -dF/dT derivative or by nonlinear Boltzmann fits; ΔTm = Tm(ligand) - Tm(vehicle). To exclude aggregation artifacts, melt curves were inspected for pre-transition baseline drift or biphasic profiles. Buffer-only and dye-only controls (no protein) were included to confirm background stability; protein + vehicle served as the reference for ΔTm calculations.
Xenograft Model
Fifteen BALB/c nude mice (4-6 weeks old, 16-20 g) were kept under sterile conditions with unrestricted access to standard chow and water. Human T24 bladder carcinoma cells (5 × 106 in 100 µL PBS mixed 1:1 with Matrigel) were implanted subcutaneously into the right flank. Once tumors grew to ∼100 mm3, animals were randomly allocated into three cohorts (n = 5 each): (1) vehicle control (intraperitoneal injection), (2) cisplatin-treated group (5 mg/kg, intraperitoneally, every 5 days), and (3) combination group receiving piperine (20 mg/kg, oral gavage daily) 23 together with cisplatin at the same dose and schedule. Tumor dimensions were recorded, and volume was estimated using the formula V = (length × width 2 )/2. After 4 weeks, mice were sacrificed, and tumors were excised, weighed, and preserved for downstream biochemical and histological evaluation. All procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Soochow University and performed according to ethical guidelines.
Statistical Analysis
Data are expressed as mean ± SEM unless stated otherwise. The sample size (n) for each experiment is indicated in the corresponding figure legend. Comparisons between two groups were performed using two-tailed unpaired Student’s t-test, while analyses involving more than two groups were evaluated by one-way or two-way ANOVA. Statistical analyses were carried out with SPSS version 20.0, and results with a two-sided P value <0.05 were considered statistically significant.
Results
Inhibition of Cisplatin-Induced FA Pathway Activation in BC Cells by Piperine
Piperine was found to interfere with cisplatin-induced activation of the FA pathway in BC cells. Three representative BC cell lines-T24 (high-grade invasive urothelial carcinoma, Grade III, p53Y126*, poorly differentiated), 5637 (invasive urothelial carcinoma, Grade II, p53R280 T, moderately differentiated), and RT4 (non-invasive papillary urothelial carcinoma, Grade I, wild-type p53, well differentiated)-were treated with cisplatin. Despite their distinct histological origins, p53 genotypes, and levels of differentiation, all three cell lines exhibited monoubiquitination of FANCI and FANCD2 following cisplatin exposure (Figure 1A-C), suggesting that FA pathway activation is a conserved response in BC. Strikingly, pretreatment with piperine markedly suppressed this cisplatin-induced monoubiquitination of FANCI and FANCD2 (Figure 1A-C), and immunofluorescence staining further demonstrated a pronounced reduction in FANCD2 nuclear foci (Figure 1D-F). Consistently, immunoprecipitation analysis revealed that the interactions of FANCD2 with FANCP, FANCQ, and PCNA were significantly weakened after piperine treatment (Figure 1G-I).
Figure 1.
Piperine suppresses cisplatin-induced ID2 monoubiquitination and downstream complex assembly in bladder cancer cells. (A-C) Immunoblotting of FANCI and FANCD2 monoubiquitination in T24 (A), 5637 (B), and RT4 (C) cells under different treatments: negative control (NC), cisplatin alone (Cis), and piperine pretreatment followed by cisplatin (P/Cis). GAPDH served as a loading control. Top bands indicate the monoubiquitinated FANCI or FANCD2 highlighted by red arrows. (D-F) Representative immunofluorescence images showing FANCD2 nuclear foci (blue, DAPI; puncta, FANCD2) in T24 (D), 5637 (E), and RT4 (F) cells under the indicated conditions. Scale bar, 10 μm. Ratio of FANCD2 foci-positive cells is shown in the bar graph (lower panel). Data are presented as mean ± SEM from three independent experiments. *P < 0.05 compared with NC; #P < 0.05 compared with Cis. (G-I) Co-immunoprecipitation analysis of FANCD2-interacting proteins in T24 (G), 5637 (H), and RT4 (I) cells. Lysates were immunoprecipitated with anti-FANCD2 or IgG control, followed by immunoblotting for FANCI, FANCP, FANCQ, and PCNA. Reduced the recruitment of downstream repair factors to FANCD2 upon P/Cis are highlighted by red arrows
To evaluate DNA damage processing, ICLs and intrastrand crosslinks were measured over time using qPCR-blocking and dot blot assays. Cisplatin alone generated both types of crosslinks, but piperine pretreatment selectively impaired the repair of ICLs, as indicated by their prolonged persistence during the recovery phase compared with cisplatin-only treatment (Figure 2A-C). In contrast, removal of intrastrand crosslinks proceeded with similar kinetics regardless of piperine exposure (Figure 2D-F), pointing to a specific inhibition of FA-dependent ICL repair rather than intrastrand crosslink processing.
Figure 2.
Piperine inhibits interstrand crosslink (ICL) repair without affecting intrastrand cisplatin adduct removal in bladder cancer cells. (A-C) Quantification of DNA interstrand crosslinks (ICLs) in T24 (A), 5637 (B), and RT4 (C) cells using qPCR-blocking assays at the indicated times after cisplatin treatment. Cisplatin alone (Cis) induced rapid removal of ICLs, whereas piperine pretreatment followed by cisplatin (P/Cis) significantly delayed ICL repair. De-crosslinking controls (Cis-decrosslink, P/Cis-decrosslink) confirmed specificity of the assay. Data are shown as mean ± SEM from three independent experiments. *P < 0.05 compared with Cis at the same time point. (D-F) Dot blot analysis of intrastrand cisplatin-DNA adducts in T24 (D), 5637 (E), and RT4 (F) cells. Representative dot blots (upper panels) and quantitative analysis of relative adduct intensity (lower panels) show comparable removal of intrastrand cisplatin adducts over time in Cis versus P/Cis conditions, indicating that piperine selectively interferes with ICL repair but not intrastrand adduct repair
Taken together, the results above suggested that piperine was able to block FA pathway activation to disrupt downstream repair events involving nucleotide excision repair (NER) and homologous recombination (HR).
Piperine Fails to Affect the Expression of Ubiquitinase or Deubiquitinase and the Deubiquitinase Activity
However, both mRNA (Figure 3A-C) and protein (Figure 3D-F) levels of FANCL and UBE2T (responsible for ID2 complex monoubiquitination), as well as USP1 and UAF1 (responsible for ID2 complex deubiquitination), remained unchanged across these BC cells upon piperine treatment. Moreover, even when USP1 or UAF1 were individually silenced in BC cells, piperine continued to reduce ID2 complex monoubiquitination (Figure 3G-I), indicating that its effect was not mediated through enhanced deubiquitinase activity. Taken together, these results demonstrate that piperine did not alter the expression of either ubiquitinase or deubiquitinase, nor did it modulate deubiquitinase activity toward the ID2 complex in BC cells.↓
Figure 3.
Piperine does not alter the expression or activity of ubiquitinase or deubiquitinase involved in ID2 regulation. (A-C) Quantitative PCR analysis of FANCL, UBE2T, USP1, and UAF1 mRNA levels in T24 (A), 5637 (B), and RT4 (C) cells treated with vehicle control (NC), cisplatin (Cis), or piperine plus cisplatin (P/Cis). Data are presented as mean ± SEM from three independent experiments. (D-F) Immunoblot analysis of FANCL, UBE2T, USP1, and UAF1 protein expression under the same treatment conditions in T24 (D), 5637 (E), and RT4 (F) cells. GAPDH was used as a loading control. (G-I) FANCI and FANCD2 monoubiquitination is examined in T24 (G), 5637 (H), and RT4 (I) cells upon cisplatin treatment alone or in combination with piperine. To test the role of deubiquitinase activity, cells were additionally subjected to USP1 knockdown (S↓) or UAF1 knockdown (A↓). Piperine consistently reduced ID2 monoubiquitination independent of USP1/UAF1 modulation, indicating that its effect is not mediated through enhanced deubiquitinase activity
Allosterical Inhibition the UBE2T-Mediated Ubiquitination Cascade by Piperine
In vitro ubiquitination assays demonstrated that addition of piperine led to a dose-dependent decrease in the monoubiquitinated FANCD2 and FANCI bands, while the loading controls remained unchanged. This inhibition was comparable to the effects of the positive control CU2, confirming that piperine directly interferes with the ubiquitination cascade (Figure 4A). Next, a two-step charging/discharge assay determined that UBE2T was readily charged with ubiquitin in the presence of E1 ubiquitin ligase UBA1 and ATP, and this charging step was unaffected by piperine (Figure 4B). However, during the discharge reaction catalyzed by FANCL, FANCD2, and FANCI, piperine markedly slowed the release of ubiquitin from UBE2T, resulting in persistent UBE2T-ub thioesters and diminished substrate ubiquitination (Figure 4C). These results indicate that piperine does not impair E2 activation but specifically blocks the FANCL-mediated ubiquitin transfer step. Nevertheless, BLI measurements showed overlapping binding affinity of FANCL-UBE2T in vehicle vs piperine (10, 20, 40 and 60 µM) across a 25-800 nM UBE2T titration (Figure 4D), and the association/dissociation kinetics indicated that piperine with different concentrations did not measurably weaken the physical interaction of FANCL-UBE2T (Figure 4E). Furthermore, DSF also revealed significant ΔTm shifts for UBE2T rather than FANCL by the dose-dependent of piperine (Figure 4F). Together, these data support an allosteric inhibition model in which piperine leaves the FANCL-UBE2T complex assembled yet impairs the catalytic configuration or activation of UBE2T-Ub, thereby blocking ubiquitin transfer to ID2.
Figure 4.
Piperine inhibits FANCL-UBE2T-mediated ubiquitin transfer through an allosteric mechanism. (A) In vitro ubiquitination assays using recombinant FANCL, UBE2T, and FANCI-FANCD2 (ID2) complex. Piperine (P; 10-40 μM) reduced ID2 monoubiquitination in a dose-dependent manner, comparable to the positive control compound CU2 (FANCL inhibitor). (B) Charging assay showing that UBE2T is efficiently loaded with ubiquitin by UBA1 in the presence of ATP. Piperine does not affect the charging of UBE2TUb thioesters. (C) Discharge assays with pre-charged UBE2T-Ub demonstrated that piperine slowed ubiquitin transfer to FANCI/FANCD2, leading to persistent UBE2T∼Ub bands at 30-60 min. FANCL protein levels remained unchanged. (D, E) Bio-layer interferometry (BLI) analysis of FANCL-UBE2T interaction. (D) Saturation binding curves (25-800 nM UBE2T) revealed indistinguishable Kd values between vehicle and piperine (10, 20, 40, 60 μM). (E) Representative sensorgrams showed overlapping association/dissociation kinetics, indicating that piperine does not disrupt FANCL-UBE2T binding. (F) Differential scanning fluorimetry (DSF) revealed a significant positive ΔTm shift (>1°C) for UBE2T and the UBE2T-FANCL complex in the presence of piperine, while FANCL alone showed minimal changes, consistent with ligand-induced conformational modulation of UBE2T
Piperine Potentiates Cytotoxicity of Cisplatin Against BC Cells in Vivo
Given the central function of the FA signaling pathway in repairing DNA lesions caused by platinum compounds and other anticancer agents, piperine emerges as a promising adjuvant to radiotherapy and chemotherapy. In a xenograft mouse model generated by subcutaneous implantation of T24 BC cells, intraperitoneal administration of cisplatin in combination with piperine produced a significant suppression of tumor growth compared with cisplatin alone (Figure 5A). Consistently, piperine markedly reduced the monoubiquitination of FANCI and FANCD2 (Figure 5B).
Figure 5.
Piperine enhances the antitumor efficacy of cisplatin in vivo by suppressing FA pathway activation. (A) Representative images of xenograft tumors excised from T24 cell-derived mouse models following treatment with vehicle control (NC), cisplatin alone (Cis), or piperine plus cisplatin (P/Cis). Tumor size was significantly reduced in the P/Cis group compared with Cis alone. The lower panel shows quantitative analysis of tumor volume. Data are presented as mean ± SEM (n = 5 per group). *P < 0.05 vs NC; #P < 0.05 vs Cis. (B) Immunoblot analysis of FANCI and FANCD2 in xenograft tumor tissues. Piperine markedly attenuated cisplatin-induced monoubiquitination of FANCI and FANCD2, indicating suppression of FA pathway activation in vivo. GAPDH served as a loading control
In conclusion, our findings demonstrated that piperine disrupted the catalytic activation of UBE2T-bound ubiquitin, thereby preventing FA pathway activation and enhancing cisplatin-induced cytotoxicity in BC.
Discussion
Platinum-based chemotherapy remains the cornerstone of BC treatment, yet its efficacy is often compromised by intrinsic or acquired resistance.24,25 A major challenge is the tumor cells’ ability to mount robust DNA damage repair responses, which mitigate the cytotoxic effects of platinum-induced DNA lesions and allow cancer cells to survive under therapeutic pressure.4,26 This underscores the urgent need to identify strategies that can sensitize tumor cells to platinum agents by disrupting their DNA repair machinery.
In recent years, DNA damage repair proteins have emerged as critical therapeutic targets in cancer therapy. PARP inhibitors, for example, have demonstrated clinical utility in tumors with homologous recombination deficiency. 27 Similarly, efforts to exploit vulnerabilities in the Fanconi anemia (FA) pathway have gained traction, as this pathway is essential for resolving DNA ICLs generated by platinum drugs.28,29 Thus, pharmacological interventions that interfere with FA signaling components hold promise in overcoming resistance and enhancing chemotherapy efficacy. 30 Targeting the FA signaling cascade in BC has been proposed as an innovative strategy, and preliminary studies have explored small-molecule inhibitors of key FA proteins.31,32 Beyond synthetic compounds, natural products with defined structural motifs also represent an underexplored resource. Nature-derived molecules, often characterized by aromatic scaffolds and heterocyclic moieties, may exert modulatory effects on protein-protein interactions within repair complexes. 33 Investigating such compounds offers not only a pharmacological opportunity but also a chemical rationale for designing new FA pathway inhibitors.
Our study provides novel evidence that piperine, a naturally occurring alkaloid, enhances cisplatin sensitivity in BC by selectively targeting UBE2T enzymatic activity. Mechanistically, piperine impaired the FANCL-mediated transfer of ubiquitin to the FANCI-FANCD2 complex, thereby suppressing ID2 monoubiquitination and subsequent FA pathway activation. 34 Functionally, this blockade prevented timely DNA repair in cisplatin-treated cells and substantially increased their susceptibility to cytotoxicity. 35 These findings not only uncover a new molecular target of piperine but also highlight its potential as a chemosensitizer in platinum-based regimens. 36 A recent report on CU1/2 compounds emphasized a rational design strategy involving a rigid aromatic heterocyclic core paired with a flexible basic tail, enabling hydrophobic stacking and salt-bridge interactions within acidic binding pockets of target proteins. 37 Piperine shares a similar architecture, consisting of a piperidine ring fused with a substituted aromatic amide, which fits the “aromatic heterocycle + basic tail” motif common among bioactive natural products. This structural resemblance lends strong chemical plausibility to our finding that piperine modulates UBE2T activity at the FANCL-UBE2T interface. 38 Compared with previously reported compound such as CU1/237, piperine displays distinct chemical and mechanistic features. CU1/2 compounds are synthetic, high-affinity molecules rationally designed to occupy the catalytic groove of UBE2T and disrupt its interaction with FANCL, achieving nanomolar-level inhibition. BI-6727 (volasertib), originally developed as a PLK1 inhibitors 39 and have no primary evidence of directly targeting UBE2T or FANCL. Reports linking PLK1 inhibition to the FA pathway largely describe synthetic-lethal vulnerability in FA-deficient settings rather than enzymatic inhibition of the UBE2T-FANCL axis. 40 In contrast, piperine is a naturally occurring alkaloid with a simpler aromatic-heterocyclic framework that exerts allosteric rather than active-site inhibition, leading to partial suppression of ubiquitin transfer. Although its potency is lower than that of CU1/2 or BI-6727, piperine’s favorable safety profile and oral availability support its potential utility as a natural FA pathway modulator and chemosensitizer. Given this structural basis, other natural compounds possessing comparable aromatic-heterocyclic frameworks may also exhibit inhibitory effects on FA pathway proteins. Such compounds could represent a broader class of natural FA modulators. However, their efficacy and specificity remain to be systematically tested. Expanding this line of inquiry may reveal a new repertoire of natural molecules with therapeutic relevance in DNA repair-targeted oncology.
Despite our findings, several limitations must be acknowledged. First, the precise chemical mechanism underlying piperine’s action on UBE2T remains unresolved. The specific peptide segments, conformational transitions, or domain alterations involved in this allosteric inhibition could not be fully elucidated in this study, as they extend beyond our current structural and biochemical scope. Advanced structural biology approaches such as cryo-EM or NMR will be required to provide atomic-level insight. 41 Another limitation pertains to the pharmacological behavior of piperine itself. While our experiments demonstrate its efficacy in cell-based and xenograft models, the upstream metabolic fate of piperine in vivo remains largely uncharacterized. Whether piperine undergoes biotransformation, modification, or conjugation that influences its intracellular activity is unknown. A thorough pharmacokinetic and metabolomic assessment is therefore essential before translational applications can be considered.
Conclusion
In summary, our study reveals a previously unrecognized role of piperine as an inhibitor of the UBE2T-FANCL axis in the FA pathway, thereby potentiating cisplatin efficacy against BC. These results suggest that natural compounds with rationally compatible structural motifs can be exploited as DNA repair-targeted therapeutics. Clinically, our findings propose a feasible strategy for enhancing the outcomes of standard chemotherapy. For the field at large, this study provides proof-of-concept that natural-product-inspired FA pathway inhibitors can emerge as valuable adjuncts in precision oncology.
Supplemental Material
Supplemental material for Piperine Targets the FANCL/UBE2T Complex to Inhibit the FA Pathway and Sensitize Bladder Cancer to Cisplatin by Chen Li, Guanglin Lv, Ying Yue, Gui Ma, Bing Lu in Dose-Response.
Author contributions: Li C. performed all experiments and drafted manuscript. Lv G. and Yue Y. assisted performing experiments. Ma G. assisted analysing the data. Lu B. designed the whole project, and revised the manuscript.
Funding: The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The work was supported by the personal contributions of the investigators.
The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Supplemental Material: Supplemental material is available online.
ORCID iDs
Chen Li https://orcid.org/0009-0007-8601-9296
Guanglin Lv https://orcid.org/0009-0008-2635-5412
Ying Yue https://orcid.org/0009-0007-5605-5739
References
- 1.Lopez-Beltran A, Cookson MS, Guercio BJ, Cheng L. Advances in diagnosis and treatment of bladder cancer. Br Med J. 2024;384:e076743. doi: 10.1136/bmj-2023-076743 [DOI] [PubMed] [Google Scholar]
- 2.Raychaudhuri R, Khaki AR, Redman MW, et al. Neoadjuvant pembrolizumab and accelerated methotrexate, vinblastine, Doxorubicin, and cisplatin in nonurothelial histologic subtypes of muscle-invasive bladder cancer: a phase 2 trial. Eur Urol. 2025;88:559-563. doi: 10.1016/j.eururo.2025.07.002 [DOI] [PubMed] [Google Scholar]
- 3.Zeng Y, Wang F, Li S, Song B. Regulatory network of methyltransferase-like 3 in stem cells: mechanisms and medical implications. Cell Transplant. 2024;33:9636897241282792. doi: 10.1177/09636897241282792 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Patel VG, Oh WK, Galsky MD. Treatment of muscle-invasive and advanced bladder cancer in 2020. CA Cancer J Clin. 2020;70(5):404-423. doi: 10.3322/caac.21631 [DOI] [PubMed] [Google Scholar]
- 5.Zhang Z, Yuan C, Ge Q, et al. Bavachalcone targets transferrin receptor and sensitizes gemcitabine to affect bladder cancer progression. iMeta. 2025;4(5):e70071. doi: 10.1002/imt2.70071 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Duan M, Ulibarri J, Liu KJ, Mao P. Role of nucleotide excision repair in Cisplatin resistance. Int J Mol Sci. 2020;21(23):9248. doi: 10.3390/ijms21239248 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Xie R, Cheng L, Huang M, et al. NAT10 drives Cisplatin chemoresistance by enhancing ac4C-Associated DNA repair in bladder cancer. Cancer Res. 2023;83(10):1666-1683. doi: 10.1158/0008-5472.CAN-22-2233 [DOI] [PubMed] [Google Scholar]
- 8.Li T, Zhu K, Tong H, et al. Cancer-associated fibroblast derived CXCL14 drives cisplatin chemoresistance by enhancing nucleotide excision repair in bladder cancer. J Exp Clin Cancer Res. 2025;44(1):265. doi: 10.1186/s13046-025-03487-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hu J, Yan L, Liu J, et al. Efficacy and biomarker analysis of neoadjuvant disitamab vedotin (RC48-ADC) combined immunotherapy in patients with muscle-invasive bladder cancer: a multi-center real-world study. iMeta. 2025;4(3):e70033. doi: 10.1002/imt2.70033 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Shen Y, Lee YH, Panneerselvam J, Zhang J, Loo LW, Fei P. Mutated Fanconi anemia pathway in non-Fanconi anemia cancers. Oncotarget. 2015;6(24):20396-20403. doi: 10.18632/oncotarget.4056 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Shen Y, Zhang J, Yu H, Fei P. Advances in the understanding of Fanconi anemia complementation group D2 protein (FANCD2) in human cancer. Cancer Cell Microenviron. 2015;2(4):e986. doi: 10.14800/ccm.986 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Jayabal P, Ma C, Nepal M, et al. Involvement of FANCD2 in energy metabolism via ATP5alpha. Sci Rep. 2017;7(1):4921. doi: 10.1038/s41598-017-05150-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ma C, Hokutan K, Shen Y, et al. TFG-Maintaining stability of overlooked FANCD2 confers early DNA-Damage response. Aging. 2020;12(20):20268-20284. doi: 10.18632/aging.103782 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Rai SK, Du W, Zhang J, Yu H, Deng Y, Fei P. Somatic gene mutations involved in DNA damage response/Fanconi anemia signaling are tissue- and cell-type specific in human solid tumors. Front Med. 2024;11:1462810. doi: 10.3389/fmed.2024.1462810 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Roh YG, Mun JY, Kim SK, et al. Fanconi anemia pathway activation by FOXM1 is critical to bladder cancer recurrence and anticancer drug resistance. Cancers. 2020;12(6):1417. doi: 10.3390/cancers12061417 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Haq IU, Imran M, Nadeem M, Tufail T, Gondal TA, Mubarak MS. Piperine: a review of its biological effects. Phytother Res. 2021;35(2):680-700. doi: 10.1002/ptr.6855 [DOI] [PubMed] [Google Scholar]
- 17.Mohamed MA, Elgayar SF, Abd Elaziz EAE. Piperine enhances the anticancer effects of cisplatin on tongue squamous cell carcinoma cell line by inducing cell apoptosis. Asian Pac J Cancer Prev APJCP. 2024;25(9):3219-3228. doi: 10.31557/APJCP.2024.25.9.3219 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Han J, Zhang S, He J, Li T. Piperine: chemistry and biology. Toxins. 2023;15(12):696. doi: 10.3390/toxins15120696 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Fattah A, Morovati A, Niknam Z, et al. The synergistic combination of Cisplatin and piperine induces apoptosis in MCF-7 cell line. Iran J Public Health. 2021;50(5):1037-1047. doi: 10.18502/ijph.v50i5.6121 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Panneerselvam J, Park HK, Zhang J, et al. FAVL impairment of the Fanconi anemia pathway promotes the development of human bladder cancer. Cell Cycle. 2012;11(15):2947-2955. doi: 10.4161/cc.21400 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Nijman SM, Huang TT, Dirac AM, et al. The deubiquitinating enzyme USP1 regulates the Fanconi anemia pathway. Mol Cell. 2005;17(3):331-339. doi: 10.1016/j.molcel.2005.01.008 [DOI] [PubMed] [Google Scholar]
- 22.Han D, Wang L, Chen B, et al. USP1-WDR48 deubiquitinase complex enhances TGF-beta induced epithelial-mesenchymal transition of TNBC cells via stabilizing TAK1. Cell Cycle. 2021;20(3):320-331. doi: 10.1080/15384101.2021.1874695 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Turrini E, Sestili P, Fimognari C. Overview of the anticancer potential of the King of Spices Piper nigrum and its main constituent piperine. Toxins. 2020;12(12):747. doi: 10.3390/toxins12120747 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li F, Zheng Z, Chen W, et al. Regulation of cisplatin resistance in bladder cancer by epigenetic mechanisms. Drug Resist Updates. 2023;68:100938. doi: 10.1016/j.drup.2023.100938 [DOI] [PubMed] [Google Scholar]
- 25.Zhang Y, Li Z, Zhang Y, et al. circSOBP inhibits bladder cancer proliferation and metastasis by regulating the miR-200a-3p/PTEN axis and participating in the immune response. Cell Transplant. 2023;32:9636897231165874. doi: 10.1177/09636897231165874 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yin W, Wang Y, Qing G, et al. Hematopoietic stem cell transplantation in the management of myelodysplastic syndrome: a retrospective, current, and future perspective. Cell Transplant. 2024;33:9636897241284283. doi: 10.1177/09636897241284283 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Lord CJ, Ashworth A. PARP inhibitors: synthetic lethality in the clinic. Science. 2017;355(6330):1152-1158. doi: 10.1126/science.aam7344 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Peake JD, Noguchi E. Fanconi anemia: current insights regarding epidemiology, cancer, and DNA repair. Hum Genet. 2022;141(12):1811-1836. doi: 10.1007/s00439-022-02462-9 [DOI] [PubMed] [Google Scholar]
- 29.Ishiai M. Regulation of the Fanconi anemia DNA repair pathway by phosphorylation and monoubiquitination. Genes. 2021;12(11):1763. doi: 10.3390/genes12111763 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Alcon P, Kaczmarczyk AP, Ray KK, et al. FANCD2-FANCI surveys DNA and recognizes double-to single-stranded junctions. Nature. 2024;632(8027):1165-1173. doi: 10.1038/s41586-024-07770-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Kupculak M, Bai F, Luo Q, et al. Phosphorylation by ATR triggers FANCD2 chromatin loading and activates the Fanconi anemia pathway. Cell Rep. 2023;42(7):112721. doi: 10.1016/j.celrep.2023.112721 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Loh YY, Anantharajan J, Huang Q, et al. Identification of small-molecule binding sites of a ubiquitin-conjugating enzyme-UBE2T through fragment-based screening. Protein Sci. 2024;33(3):e4904. doi: 10.1002/pro.4904 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Anantharajan J, Tan QW, Fulwood J, et al. Identification and characterization of inhibitors covalently modifying catalytic cysteine of UBE2T and blocking ubiquitin transfer. Biochem Biophys Res Commun. 2023;689:149238. doi: 10.1016/j.bbrc.2023.149238 [DOI] [PubMed] [Google Scholar]
- 34.Tan W, van Twest S, Leis A, et al. Monoubiquitination by the human Fanconi anemia core complex clamps FANCI:FANCD2 on DNA in filamentous arrays. eLife. 2020;9:e54128. doi: 10.7554/eLife.54128 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Lemonidis K, Rennie ML, Arkinson C, et al. Structural and biochemical basis of interdependent FANCI-FANCD2 ubiquitination. EMBO J. 2023;42(3):e111898. doi: 10.15252/embj.2022111898 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Zhang Y, Li J, Zhou Y, et al. And-1 coordinates with the FANCM complex to regulate Fanconi anemia signaling and Cisplatin resistance. Cancer Res. 2022;82(18):3249-3262. doi: 10.1158/0008-5472.CAN-22-0769 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Cornwell MJ, Thomson GJ, Coates J, et al. Small-Molecule inhibition of UBE2T/FANCL-Mediated ubiquitylation in the Fanconi anemia pathway. ACS Chem Biol. 2019;14(10):2148-2154. doi: 10.1021/acschembio.9b00570 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Yang D, Bai F, Lopez Martinez D, et al. PP2A licenses the FANCD2/FANCI complex for chromosome loading. Cell Rep. 2024;43(11):114971. doi: 10.1016/j.celrep.2024.114971 [DOI] [PubMed] [Google Scholar]
- 39.WeiDelta LM, Hugle M, Fulda S. Eribulin alone or in combination with the PLK1 inhibitor BI 6727 triggers intrinsic apoptosis in ewing sarcoma cell lines. Oncotarget. 2017;8(32):52445-52456. doi: 10.18632/oncotarget.17190 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Sheth AS, Chan KK, Liu S, et al. PLK1 inhibition induces synthetic lethality in Fanconi anemia pathway-deficient acute myeloid leukemia. Cancer Res Commun. 2025;5(4):648-667. doi: 10.1158/2767-9764.CRC-24-0260 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Rennie ML, Lemonidis K, Arkinson C, et al. Differential functions of FANCI and FANCD2 ubiquitination stabilize ID2 complex on DNA. EMBO Rep. 2020;21(7):e50133. doi: 10.15252/embr.202050133 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplemental material for Piperine Targets the FANCL/UBE2T Complex to Inhibit the FA Pathway and Sensitize Bladder Cancer to Cisplatin by Chen Li, Guanglin Lv, Ying Yue, Gui Ma, Bing Lu in Dose-Response.






