Skip to main content
Microorganisms logoLink to Microorganisms
. 2025 Nov 12;13(11):2584. doi: 10.3390/microorganisms13112584

Establishment of Specific Multiplex PCR Detection Methods for the Predominant tet(X)-Positive Acinetobacter Species

Chong Chen 1,2, Jing Liu 1,2, Jie Gao 1,2, Taotao Wu 1,2, Jinlin Huang 1,2,*
Editor: Maurizio Ciani
PMCID: PMC12654350  PMID: 41304269

Abstract

The increasing prevalence of the mobile tigecycline resistance gene tet(X) poses a severe global health threat, and the genus Acinetobacter is a major reservoir. This study aimed to develop a rapid and specific multiplex PCR assay for detecting the predominant tet(X)-positive Acinetobacter species. Through pan-genome analyses of 390 tet(X)-positive Acinetobacter genomes, a total of 20 tet(X) variants were identified in 24 Acinetobacter species, including 17 published lineages and seven taxonomically unresolved Taxa. Acinetobacter indicus (30.8%), Acinetobacter amyesii (17.2%), and Acinetobacter towneri (16.1%) were the top three hosts of diverse tet(X) variants. Species-specific signature genes were identified and used for primer design, yielding amplicons of 267 bp (tet(X)), 424 bp (A. indicus), 690 bp (A. amyesii), and 990 bp (A. towneri). The assay was rigorously adjusted for an optimal annealing temperature of 52.8 °C and a primer ratio of 1:1:1:1, demonstrating high sensitivity with a detection limit of 0.3 ng/μL DNA and excellent stability under −20 °C, 4 °C, 20 °C storage conditions. Validation experiments on 151 bacterial strains showed high accuracy for DNA templates (≥97.8%) and bacterial suspensions (≥93.5%) within two hours. This cost-effective and highly accurate multiplex PCR provides a powerful tool for proactive surveillance and control of the critical Acinetobacter sp. pathogens.

Keywords: A. indicus, A. amyesii, A. towneri, tet(X), multiplex PCR detection

1. Introduction

Among clinically important pathogens, Acinetobacter sp. isolates have drawn considerable attention due to their strong pathogenicity, adaptability, and adhesive capacity. Bacteria of this genus can survive on both biological and non-biological surfaces, and represent causative agents of ventilator-associated pneumonia, bloodstream infections, and surgical site infections [1,2]. The genomic DNA is prone to mutation and recombination, leading to 90 officially reported species and more than 70 unknown species to be named (https://lpsn.dsmz.de/genus/acinetobacter (accessed on 6 November 2025)) [3]. Acinetobacter baumannii is one of the most important pathogenic bacteria in the clinical setting, followed by Acinetobacter calcoaceticus, Acinetobacter pittii, Acinetobacter junii, Acinetobacter lwoffii, Acinetobacter nosocomialis, and Acinetobacter seifertii [4,5,6,7,8,9]. With the widespread use of antibiotics, the problem of antimicrobial resistance in Acinetobacter spp. has become increasingly prominent. In 2019, the median proportion of patients with bloodstream infections caused by carbapenem-resistant Acinetobacter spp. was 70.3% in the Eastern Mediterranean Region, and the infections from carbapenem-resistant Acinetobacter baumannii (CRAb) were responsible for global 57,770 deaths [9,10]. Highlighting its grave threat, the World Health Organization classified CRAb as a critical-priority pathogen on its 2024 Bacterial Priority Pathogens List [11].

Tigecycline, a third-generation tetracycline antibiotic derived from the structural basis of minocycline, exhibits broad-spectrum antimicrobial activities against Gram-negative and Gram-positive bacteria by inhibiting protein synthesis [12]. Subsequently, a mobile tigecycline resistance gene tet(X3) was first reported in porcine A. baumannii in 2019 in China [13]. This gene conferred a broader resistance profile than the previously identified tet(X) (GenBank accession number: M37699) and tet(X2) (AJ311171), even posing a threat to the latest generation of tetracycline antibiotics such as eravacycline and omadacycline [14]. To date, the tet(X2), tet(X3), tet(X4), tet(X5), tet(X6), tet(X7), tet(X13), and tet(X15) variants have been identified in multiple Acinetobacter species, especially in China [1]. They were particularly prevalent in carbapenemase NDM-producing strains such as A. baumannii, A. indicus, A. lwoffii, Acinetobacter schindleri, A. towneri, and Acinetobacter johnsonii, further exacerbating the challenges in clinical treatment [13,15,16,17].

Now there is an urgent need in the fields of clinical microbiology and public health to develop rapid and accurate detection technologies for multidrug-resistant (MDR) pathogens. Among these, the PCR technology has become one of the most powerful tools in pathogenic microbe detection due to its high sensitivity and specificity. Conventional PCR can identify a variety of bacterial pathogens, such as Acinetobacter spp., Escherichia coli, Klebsiella pneumoniae, and Salmonella enterica, by 16S rRNA sequencing and alignment [18,19]. Multiplex PCR, developed based on conventional PCR, further enhances detection efficiency. For example, five pairs of primers were designed to establish a multiplex PCR method capable of simultaneously detecting Vibrio alginolyticus, Vibrio parahaemolyticus, Vibrio vulnificus, and Vibrio cholerae [20]. The other techniques, such as biochemical experiments, quantitative real-time PCR (qPCR), whole genome-based Average Nucleotide Identity (ANI), microfluidic chips, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), also play important roles in pathogenic identification [21,22,23,24,25]. Despite continuous advancements in existing technologies, there remains a lack of specific, rapid, and cost-effective methods for detecting tet(X)-positive Acinetobacter sp. strains. To solve the limitation, a multiplex PCR amplification system targeting three predominant tet(X)-positive Acinetobacter species was explored in this study.

2. Materials and Methods

2.1. Genome Collection and Quality Evaluation

With the complete nucleotide sequence of tet(X3) (MK134375) as a query template, all non-duplicate tet(X)-carrying Acinetobacter genomes and related bacterial information were retrieved from the public National Center for Biotechnology Information (NCBI) database (accessed on 5 January 2025). Then they were subject to quality evaluation by QUAST version 5.2.0 and CheckM version 1.1.6 for the next analyses [26,27]. The filter parameters included the number of contigs (<300), N50 (>40 kb), completeness (>95%), contamination (<2%), and heterogeneity (≤50%).

2.2. Identification of Acinetobacter Species, Antibiotic Resistance Genes, and Sequence Types (STs)

An ANI analysis was conducted for precise bacterial identification of Acinetobacter species. ANI values between each of the qualified tet(X)-positive genomes and type strains of Acinetobacter spp. were calculated using FastANI version 1.33, and a cutoff of >95% was used to define the same bacterial species [24]. The tet(X) subtypes were manually analyzed by multiple sequence alignment with previously reported variants, with the threshold values of 100% amino acid identity and 100% amino acid coverage [28]. The other antibiotic resistance genes were detected in the Comprehensive Antibiotic Resistance Database (CARD) using ABRicate version 1.0.1, with the threshold values of >98% nucleotide identity and >98% nucleotide coverage (https://github.com/tseemann/abricate (accessed on 6 November 2025)). STs were analyzed against the PubMLST abaumannii_2 scheme by MLST version 2.22.0, with the threshold values of 100% nucleotide identity and 100% nucleotide coverage (https://github.com/tseemann/mlst (accessed on 6 November 2025)).

2.3. Primer Design Based on Pan-Genome Analyses

Pan-genomes of three predominant tet(X)-positive Acinetobacter species were analyzed under default parameters by IPGA version 1.09, respectively [29]. Core gene clusters were selected for online species-specific primer design by the section of Primers common for a group of sequences in Primer-BLAST using Primer3 version 2.5.0, respectively, with melting temperatures ranging from 48 °C to 60 °C in the nt database (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 16 May 2024)). Similarly, a pair of primers for tet(X) variants in Acinetobacter sp. strains was also designed. Particularly, the above primers were all designed to generate PCR products of significantly different sizes for bacterial detection (Table 1).

Table 1.

PCR primers of predominant tet(X)-positive Acinetobacter species.

Primer Sequence (5′-3′) Size (bp) Target
tetX-F GCGGGATTGTTACAAACTTA 267 tet(X)
tetX-R ATCTGCTGTTTCACTCG
indicus-F ATGCAATTAACCGATTATCCAG 424 A. indicus
indicus-R CCAGATAATGCCCCACACT
amyesii-F GCCTATGTTTTTGACCCAAT 690 A. amyesii
amyesii-R GCACCATAAAACCAATACC
towneri-F TGGGTAGATGTGTCACAGG 990 A. towneri
towneri-R GGTATTCAAACCAATGACTGC

2.4. Primer Confirmation

To verify the primers, bacterial genomes of tet(X)-positive A. indicus C20230218, A. amyesii YH16040, and A. towneri TT6-2 were extracted using a TIANamp Bacteria DNA Kit (Tiangen, Beijing, China). Genomic DNA was then adjusted to a concentration of 30 ng/μL, respectively, of which 1 μL was used as a template for PCR amplification, agarose gel electrophoresis, Sanger sequencing, and sequence alignment. The PCR reaction system and procedure using 2 × Taq Master Mix (Vazyme, Nanjing, China) were shown in Tables S1 and S2, and A. baumannii ATCC 19606 was used as the negative control group.

2.5. Determination of the Optimal Annealing Temperature

Genomic DNA from tet(X)-positive A. indicus C20230218, A. amyesii YH16040, and A. towneri TT6-2 were mixed in equal proportions at the same concentration and used as the PCR template. PCR amplification was performed using an equimolar primer mixture at different annealing temperatures of 47.0 °C, 48.5 °C, 49.9 °C, 51.4 °C, 52.8 °C, 54.3 °C, 55.7 °C, 57.2 °C, 58.6 °C, 60.1 °C, 61.5 °C, and 63.0 °C, with three replicates per group, to determine the optimal annealing temperature for the multiplex PCR system. Additionally, ImageJ version 1.8.0 was used to analyze the grayscale intensity of DNA bands.

2.6. Determination of the Optimal Primer Ratio

Four pairs of primers tetX-F/R, indicus-F/R, amyesii-F/R, and towneri-F/R (each at a concentration of 10 μM) were mixed in different ratios of 1:1:1:1, 1:2:1:1, 1:1:2:1, 1:1:1:2, or 1:1:1:3 with a total volume of 4 μL. Using mixed genomic DNA from three tet(X)-positive Acinetobacter sp. strains as the PCR template, PCR amplification was performed under the optimal annealing temperature, with three replicates for each group, to determine the optimal primer ratio for the multiplex PCR system. Additionally, ImageJ version 1.8.0 was used to analyze the grayscale intensity of DNA bands.

2.7. Determination of the Minimum Detection Limit

Sterile water was used to prepare a two-fold serial dilution of the mixed genomic DNA extracted from three tet(X)-positive Acinetobacter sp. strains, which served as the PCR template. Subsequently, PCR amplification was performed under the optimal primer ratio and optimal annealing temperature, with three replicates per group, to determine the limit of detection of the multiplex PCR system.

2.8. Primer Stability Under Different Storage Temperatures

The specific primers were mixed at the optimal ratio and aliquoted into nine tubes. These aliquots were stored under three temperature conditions of −20 °C, 4 °C, and 20 °C, with three biological replicates per group, to evaluate the stability of multiplex PCR primers targeting tet(X)-positive Acinetobacter species. PCR amplification was performed at the predetermined optimal annealing temperature at five time points of day 1, day 3, day 7, day 10, and day 15. Simultaneously, DNA band intensity was quantitatively analyzed using ImageJ version 1.8.0 for the grayscale measurement.

2.9. Determination of the Multiplex PCR Detection Accuracy

A total of 151 bacterial strains preserved in our laboratory were tested for the accuracy of the multiplex PCR method, consisting of 145 tet(X)-positive strains and six tet(X)-negative control strains. The tet(X)-positive strains contained A. indicus (n = 46), A. amyesii (n = 17), A. towneri (n = 8), Acinetobacter variabilis (n = 28), A. schindleri (n = 5), Acinetobacter pseudolwoffii (n = 5), Acinetobacter sichuanensis (n = 2), A. lwoffii (n = 1), Acinetobacter defluvii (n = 1), E. coli (n = 9), Aeromonas caviae (n = 1), Empedobacter stercoris (n = 13), Myroides tengzhouensis (n = 1), Myroides odoratimimus (n = 5), Myroides zaozhuangensis (n = 1), and Myroides faecalis (n = 2). In addition, the tet(X)-negative control strains included E. coli C600, E. coli ATCC 25922, A. baumannii ATCC 19606, Acinetobacter baylyi ADP1, S. enterica ATCC 14028, and K. pneumoniae ATCC 700603. PCR amplification was performed using their genomic DNA as templates at the optimal annealing temperature and optimal primer ratio. Meanwhile, the bacterial suspensions before genome extraction were also detected under the same conditions.

3. Results

3.1. Distribution of tet(X) and Associated Genes in Acinetobacter Species

According to the query and evaluation, 390 tet(X)-positive Acinetobacter genomes were collected in the NCBI database, of which 63 strains harbored two or more tet(X) variants (Table S3). Then the precise distribution of tet(X) variants on Acinetobacter genomes in China (n = 351), USA, (n = 7), Pakistan (n = 6), Czech Republic (n = 4), Thailand (n = 4), Germany (n = 3), Canada (n = 2), Colombia (n = 2), Ghana (n = 2), Ireland (n = 2), Netherlands (n = 2), Argentina (n = 1), Israel (n = 1), Peru (n = 1), Philippines (n = 1), and Viet Nam (n = 1) was systematically delineated. A total of 20 tet(X) variants were identified in 24 ANI-based Acinetobacter species, including 17 published lineages and seven taxonomically unresolved Taxa (Figure 1). The variants exhibited pronounced inter-species heterogeneity, and A. indicus (30.8%), A. amyesii (17.2%), and A. towneri (16.1%) emerged as the principal hosts, accounting for 64.1% of all tet(X)-positive isolates. For A. indicus, the main tet(X) variant carried by these strains was tet(X3) (84.2%), while tet(X6) (15%), tet(X3.10) (0.8%), tet(X3.12) (2.5%), tet(X4) (5.8%), tet(X5.4) (0.8%), tet(X6.4) (3.3%), and tet(X27.3) (2.5%) were sporadically detected. For A. amyesii, the main tet(X) variant was tet(X3) (100%), followed by tet(X6) (17.9%). For A. towneri, tet(X3) (87.3%) was the main variant, followed by tet(X6) (19%), while tet(X4) and tet(X7) were sporadically detected (1.6% each). For all the other 21 species, tet(X3) was also dominant (85%), followed by tet(X6) (25.7%), tet(X2) (0.7%), tet(X3.3) (0.7%), tet(X3.4) (0.7%), tet(X3.5) (0.7%), tet(X3.6) (0.7%), tet(X3.11) (0.7%), tet(X5) (1.4%), tet(X5.3) (3.6%), tet(X6.5) (0.7%), tet(X15) (0.7%), and tet(X27.4) (0.7%).

Figure 1.

Figure 1

Distribution of the tet(X) variants in Acinetobacter species. Bacterial information (n = 390) is detailed in Table S3.

As shown in Figure S1, 21 different antibiotic resistance genes, belonging to aminoglycosides, carbapenems, lincosamides, macrolides, phenicols, polypeptides, sulfonamides, and tetracyclines, were analyzed in 390 tet(X)-positive Acinetobacter sp. bacteria. The detection rate of sul2 was the highest (94.9%), followed by floR (62.8%), mph(E) (60%), aph(6)-Id (58.7%), aph(3″)-Ib (58.5%), msr(E) (55.1%), aac(3)-IId (26.2%), and tet(39) (21%), and those of the remaining genes were <20%. It is noted that the detection rates of carbapenem resistance genes blaOXA-58, blaNDM-1, and blaNDM-3 were 15.1%, 11.3%, and 0.5%, respectively. Results of the ST analysis revealed 85 out of 390 strains were successfully typed, consisting of 39 different STs (Table S3). ST2012 was the most prevalent type (n = 13) of them, with <10 for each of the other STs, and the unclassified Acinetobacter sp. strains urgently needed further research.

3.2. Optimized Primers of Three Predominan tet(X)-Positive Acinetobacter Species

Strains of A. indicus, A. amyesii, and A. towneri, the three most prevalent tet(X)-positive species in the NCBI database, were selected as target organisms. By contrast, PPanGGOLiN was the best analytical model in this study. A. amyesii exhibited a higher genomic diversity (pan-gene clusters, n = 11,558; core-gene clusters, n = 2288) than those of A. indicus (n = 10,403; n = 2083) and A. towneri (n = 8238; n = 1995; Figure 2). Conserved signature genes of each species were extracted for tet(X)-positive Acinetobacter species-specific primers. Consequently, the core gene clusters of tet(X) in all strains, thioesterase-coding acyl-CoA in A. indicus, Major Facilitator Superfamily transporter gene in A. amyesii, and flagellar-encoding filF in A. towneri were successfully applied for primer design by NCBI Primer-BLAST, with the theoretical products of 267 bp, 424 bp, 690 bp, and 990 bp, respectively (Table 1).

Figure 2.

Figure 2

Pan-genome analyses of three predominant tet(X)-positive Acinetobacter species. Core- and pan-genome profiles of A. indicus (A), A. amyesii (B), and A. towneri (C) are presented in red and blue colors, respectively.

PCR and agarose gel electrophoresis results showed clear and expected bands for the representative strains, including tet(X)-positive A. indicus C20230218, A. amyesii YH16040, and A. towneri TT6-2 (Figure 3A). They were confirmed by Sanger sequencing and sequence alignment. A multiplex PCR regime was further optimized with respect to the annealing temperature and primer ratio. As illustrated in Figure 3B, amplicons corresponding to each Acinetobacter species were obtained across the 47.0–57.2 °C range; however, maximal band sharpness was achieved at 52.8 °C, with the grayscale intensity of 22,950.4 ± 884.7 (A. indicus), 22,536.6 ± 838.7 (A. amyesii), and 22,761.7 ± 283.9 (A. towneri), respectively. Elevating the temperature to ≥58.6 °C resulted in complete loss of amplification for A. indicus and A. amyesii, whereas the A. towneri signal vanished at ≥60.1 °C. Consequently, 52.8 °C was adopted as the optimal annealing temperature for the multiplex PCR assay. To optimize the primer ratio, equimolar mixtures of genomic DNA from the three target species were amplified at the previously determined optimal annealing temperature of 52.8 °C. Densitometric quantification of the resulting amplicons (Figure 3C) revealed that a 1:1:1:1 ratio of four primer pairs produced the smallest inter-band variation in gray-level intensity (15,691.7 ± 2231.4, A. indicus; 16,306.0 ± 1705.1, A. amyesii; 14,596.8 ± 1120.4, A. towneri), indicating optimal amplification balance. This proportion was therefore adopted as the optimal primer ratio for the multiplex PCR.

Figure 3.

Figure 3

Validation and optimization of PCR primers. Single species-specific PCR detection (A), multiplex PCR detection gray values under different annealing temperatures (B), multiplex PCR detection gray values under different primer combinations (C), and multiplex PCR detection accuracy (D) are presented, respectively. Four pairs of primers tetX-F/R, indicus-F/R, amyesii-F/R, and towneri-F/R are mixed in different ratios of 1:1:1:1, 1:2:1:1, 1:1:2:1, 1:1:1:2, and 1:1:1:3. M, DL 2000 DNA Marker; A1, tet(X)-positive A. indicus; A2, tet(X)-positive A. amyesii; A3, tet(X)-positive A. towneri; A4, tet(X)-negative control (A. baumannii ATCC 19606); D1, 10−0 dilution; D2, 10−1 dilution; D3, 10−2 dilution; D4, 10−3 dilution; D5, blank control (without genomic DNA).

3.3. Evaluation of Specific Detection Primers

Sensitivity was assessed by a two-fold serial dilution of a mixed genomic DNA template (initial concentration, 30 ng/µL) prepared from the three tet(X)-positive Acinetobacter species. As shown in Figure 3D, four specific amplicons of approximately 267 bp, 424 bp, 690 bp, and 990 bp were clearly visible at template concentrations ≥0.3 ng/µL. Below this threshold, the 424 bp, 690 bp, and 990 bp fragments were consistently undetectable. Consequently, the limit of detection for the multiplex PCR was established at 0.3 ng/µL genomic DNA, demonstrating satisfactory analytical sensitivity. To evaluate primer stability (Figure 4), the intensity of target amplicons was quantified during 15 days of storage at −20 °C (ranging from 14,596.8 ± 1120.4 to 16,366.4 ± 1728.1), 4 °C (ranging from 15,311.5 ± 1559.7 to 17,814.3 ± 2376.9), and 20 °C (ranging from 14,963.4 ± 1924.1 to 17,445.3 ± 2130.0). No significant decline in band intensity was observed under any condition, indicating that the multiplex-specific primers retain full activity across the tested temperature range and are sufficiently robust for routine deployment under varied storage scenarios.

Figure 4.

Figure 4

Primer stability under −20 °C, 4 °C, and 20 °C storages. Primer stability for detection of A. towneri, A.amyesii, and A. indicus under −20 °C (A), 4 °C (B), and 20 °C (C) storage conditions is presented, respectively.

Both genomic DNA and bacterial suspensions were applied for the next analyses. Briefly, screening of 151 non-duplicate bacterial genomes by the established multiplex PCR confirmed 45 tet(X)-positive A. indicus, 17 tet(X)-positive A. amyesii, and 8 tet(X)-positive A. towneri isolates, with the detection accuracy of 97.8%, 100%, and 100%, respectively (Table 2). All the others were negative except one tet(X)-positive A. variabilis (3.6%) misdiagnosed as A. amyesii. In addition, results of bacterial suspensions were highly consistent with those of genomic DNA, giving the accuracy of 93.5%, 100%, and 100% within two hours (Table 2). These data validate the practicability for the rapid and accurate identification of tet(X)-positive A. indicus, A. amyesii, and A. towneri by multiplex specific PCR.

Table 2.

Multiplex PCR detection results.

Species Number Percentage (Positive Strains/Samples)
Bacterial Suspensions Genomic DNA
tet(X)-positive strains 145 47.6% (69/145) 49% (71/145)
A. indicus 46 93.5% (43/46) 97.8% (45/46)
A. amyesii 17 100% (17/17) 100% (17/17)
A. towneri 8 100% (8/8) 100% (8/8)
A. variabilis 28 3.6% (1/28) 3.6% (1/28)
A. schindleri 5 0% (0/5) 0% (0/5)
A. pseudolwoffii 5 0% (0/5) 0% (0/5)
A. sichuanensis 2 0% (0/2) 0% (0/2)
A. lwoffii 1 0% (0/1) 0% (0/1)
A. defluvii 1 0% (0/1) 0% (0/1)
E. coli 9 0% (0/9) 0% (0/9)
A. caviae 1 0% (0/1) 0% (0/1)
E. stercoris 13 0% (0/13) 0% (0/13)
M. tengzhouensis 1 0% (0/1) 0% (0/1)
M. odoratimimus 5 0% (0/5) 0% (0/5)
M. zaozhuangensis 1 0% (0/1) 0% (0/1)
M. faecalis 2 0% (0/2) 0% (0/2)
tet(X)-negative strains 6 0% (0/6) 0% (0/6)
E. coli 2 0% (0/2) 0% (0/2)
A. baumannii 1 0% (0/1) 0% (0/1)
A. baylyi 1 0% (0/1) 0% (0/1)
S. enterica 1 0% (0/1) 0% (0/1)
K. pneumoniae 1 0% (0/1) 0% (0/1)

4. Discussion

A major concern for global public health is the alarming propensity of Acinetobacter sp. pathogens to acquire genetic determinants for multidrug resistance and limited treatment options [4,6,30]. The bioinformatic findings of this study demonstrated that Acinetobacter species served as a reservoir for the mobile tigecycline resistance gene tet(X), with 20 variants (predominantly tet(X3)) having been detected therein. A. indicus, A. amyesii, and A. towneri were the predominant species among 390 tet(X)-mediated tigecycline-resistant Acinetobacter sp. isolates. In the era of One Health, A. indicus have been frequently identified in human, pig, chicken, goose, duck, pigeon, cattle, cow, migratory bird, water, soil, and waste materials since its first report in 2012 [14,31,32,33]. A. towneri has been detected in human, pig, chicken, cattle, water, soil, and activated sludge samples since its first report in 2003 [14,34,35,36,37,38]. A. amyesii has been sporadically found in pig, cow, water, soil, and dust samples since its first report in 2022 [14,39,40]. Despite the lack of detailed clinical infection data, A. indicus, A. amyesii, and A. towneri strains represent potential pathogenic microorganisms.

Furthermore, multiple antibiotic resistance genes conferring resistance to eight classes of antibiotics were collected in tet(X)-positive Acinetobacter spp. in this study, especially A. indicus, A. amyesii, and A. towneri. As previously reported, they were commonly resistant to tetracycline, tigecycline, eravacycline, omadacycline, florfenicol, trimethoprim/sulfamethoxazole, and ciprofloxacin [14,41]. Concurrently, the carbapenem resistance genes blaNDM-1 and blaNDM-3 were also identified in tet(X)-positive A. indicus and A. towneri strains from cow, pig, duck, goose, chicken, soil, and hospital wastewater samples in China and the Philippines [13,14,15,16,17,42]. Therefore, the development of rapid detection methods for monitoring tet(X)-positive MDR A. indicus, A. amyesii, and A. towneri is justified.

Given the urgent threat posed by the growing number of tet(X) variants, a series of multifaceted approaches has been undertaken to tackle this challenge. Specific primers against tet(X1), tet(X2), tet(X3), tet(X4), and tet(X5) were designed, enabling the development of multiplex PCR, SYBR green-based qPCR, and TaqMan-based qPCR assays [43,44,45]. Notably, a highly sensitive loop-mediated isothermal amplification assay with a visual orange to green dye was implemented for simultaneous detection of these variants [46]. A phenotypic detection method was established by coupling an acid-base indicator, bromocresol purple, with the degradation of eravacycline by tet(X3)- and tet(X4)-positive bacterial strains [47]. A one-tube recombinase polymerase amplification (RPA)-CRISPR-Cas12b system was developed for tet(X4)-positive strains [48]. Moreover, MALDI-TOF MS-based tests were utilized for rapid identification of Tet(X)-producing strains [49,50]. A liquid chromatography-tandem mass spectrometry (LC-MS/MS) method of metabolite ratios was developed to detect tet(X) in Enterobacteriaceae bacteria [51]. Continuous evolution of tet(X) variants highlights the need for ongoing methodological updates to ensure the detection coverage and accuracy, especially in diverse Acinetobacter species.

Traditional methods for Acinetobacter identification typically rely on the 16S rRNA sequencing, rpoB sequencing, gyrB-based multiplex PCR, ANI, phenotypic system VITEK 2, and MALDI-TOF MS, which often entail high economic costs and database dependencies [18,52,53]. In contrast, the multiplex PCR method established in this study demonstrated high specificity, sensitivity, and stability, while also being cost-effective, thereby facilitating rapid monitoring of the top three tet(X)-positive species (namely A. indicus, A. amyesii, and A. towneri). It cannot be ignored that tet(X)-positive A. variabilis may interfere with the detection accuracy of tet(X)-positive A. amyesii. Inevitably, several limitations may also exist in the clinical and environmental application. For example, false negatives or non-target results can occur with degraded nucleic acids or multiple bacterial templates in the complex background [54]. PCR sensitivity is limited in low-abundance pathogens within large-volume samples [55]. The detection technology cannot clearly differentiate live from dead microbes [56]. On the other hand, the diversity of tet(X)-positive Acinetobacter species is considerable, including clinically important A. baumannii, A. pittii, and A. junii [5,7,16,57]. To the best of our knowledge, the specific detection method targeting tet(X)-positive A. indicus, A. amyesii, and A. towneri was first reported, and the techniques for the remaining Acinetobacter species warrant further exploration.

5. Conclusions

In summary, this study emphasized the global prevalence status of tigecycline resistance tet(X) variants in complex Acinetobacter genomes. Combined pan-genome analyses with experimental validation, a multiplex PCR method was successfully established and optimized for the specific detection of three predominant tet(X)-positive Acinetobacter species, namely A. indicus, A. amyesii, and A. towneri. The experimental protocol demonstrated high sensitivity, high accuracy, and robust primer stability across different storage temperatures. According to clarifying the distribution landscape of tet(X) variants and enabling rapid identification, this method will provide a reliable and cost-effective tool for the future surveillance of tet(X)-mediated tigecycline-resistant Acinetobacter sp. pathogens.

Abbreviations

The following abbreviations are used in this manuscript:

CRAb Carbapenem-resistant Acinetobacter baumannii
MDR Multidrug-resistant
qPCR Quantitative real-time PCR
ANI Average Nucleotide Identity
MALDI-TOF MS Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry
NCBI National Center for Biotechnology Information
STs Sequence Types
CARD Comprehensive Antibiotic Resistance Database
RPA Recombinase polymerase amplification
LC-MS/MS Liquid chromatography-tandem mass spectrometry

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms13112584/s1. Figure S1: Distribution of multiple antibiotic resistance genes in tet(X)-positive Acinetobacter sp. bacteria; Table S1: PCR reaction system in this study; Table S2: PCR reaction procedure in this study; Table S3: Bacterial information of tet(X)-positive Acinetobacter sp. strains.

Author Contributions

Conceptualization, C.C. and J.H.; methodology, C.C. and J.L.; formal analysis, J.L., J.G., and T.W.; writing—original draft preparation, C.C. and J.L.; writing—review and editing, C.C.; visualization, J.L. and J.G.; funding acquisition, C.C. and J.H. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This research was jointly funded by the National Key Research and Development Program of China (grant number 2024YFC2310300), the National Natural Science Foundation of China (grant number 32402890), and the China Postdoctoral Science Foundation (grant number 2023M732993).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Chen C., Wu T., Liu J., Gao J. Threat and Control of tet(X)-Mediated Tigecycline-Resistant Acinetobacter sp. Bacteria. Foods. 2025;14:3374. doi: 10.3390/foods14193374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Harding C.M., Hennon S.W., Feldman M.F. Uncovering the mechanisms of Acinetobacter baumannii virulence. Nat. Rev. Microbiol. 2017;16:91–102. doi: 10.1038/nrmicro.2017.148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Qin J., Feng Y., Lu X., Zong Z. Precise Species Identification for Acinetobacter: A Genome-Based Study with Description of Two Novel Acinetobacter Species. mSystems. 2021;6:e0023721. doi: 10.1128/mSystems.00237-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wong D., Nielsen T.B., Bonomo R.A., Pantapalangkoor P., Luna B., Spellberg B. Clinical and Pathophysiological Overview of Acinetobacter Infections: A Century of Challenges. Clin. Microbiol. Rev. 2017;30:409–447. doi: 10.1128/CMR.00058-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Wang S., Zhou Y., Wang Y., Tang K., Wang D., Hong J., Wang P., Ye S., Yan J., Li S., et al. Genetic landscape and evolution of Acinetobacter pittii, an underestimated emerging nosocomial pathogen. Commun. Biol. 2025;8:738. doi: 10.1038/s42003-025-08156-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Li S., Jiang G., Wang S., Wang M., Wu Y., Zhang J., Liu X., Zhong L., Zhou M., Xie S., et al. Emergence and global spread of a dominant multidrug-resistant clade within Acinetobacter baumannii. Nat. Commun. 2025;16:2787. doi: 10.1038/s41467-025-58106-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Aguilar-Vera A., Bello-López E., Pantoja-Nuñez G.I., Rodríguez-López G.M., Morales-Erasto V., Castillo-Ramírez S., Tringe S.G. Acinetobacter junii: An emerging One Health pathogen. mSphere. 2024;9:e0016224. doi: 10.1128/msphere.00162-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Lee Y.-T., Sun J.-R., Li L.-H., Yang Y.-S., Chang H.-M., Lin P.-Y., Liao P.-H., Kang F.-Y., Chang Y.-Y., Yang Y.-S., et al. Comparison of clinical manifestations, antimicrobial susceptibility patterns, and carbapenem resistance determinants between Acinetobacter seifertii and Acinetobacter nosocomialis isolated in Taiwan. J. Microbiol. Immunol. Infect. 2025;Online ahead of print doi: 10.1016/j.jmii.2025.08.025. [DOI] [PubMed] [Google Scholar]
  • 9.Murray C.J.L., Ikuta K.S., Sharara F., Swetschinski L., Robles Aguilar G., Gray A., Han C., Bisignano C., Rao P., Wool E., et al. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet. 2022;399:629–655. doi: 10.1016/S0140-6736(21)02724-0. Correction in Lancet 2022, 400, 1102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Talaat M., Zayed B., Tolba S., Abdou E., Gomaa M., Itani D., Hutin Y., Hajjeh R. Increasing Antimicrobial Resistance in World Health Organization Eastern Mediterranean Region, 2017–2019. Emerg. Infect. Dis. 2022;28:717–724. doi: 10.3201/eid2804.211975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.World Health Organization (WHO) WHO Bacterial Priority Pathogens List, 2024: Bacterial Pathogens of Public Health Importance to Guide Research, Development and Strategies to Prevent and Control Antimicrobial Resistance. [(accessed on 6 November 2025)]. Available online: https://www.who.int/publications/i/item/9789240093461.
  • 12.Grossman T.H. Tetracycline Antibiotics and Resistance. Cold Spring Harb. Perspect. Med. 2016;6:a025387. doi: 10.1101/cshperspect.a025387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.He T., Wang R., Liu D.J., Walsh T.R., Zhang R., Lv Y., Ke Y.B., Ji Q.J., Wei R.C., Liu Z.H., et al. Emergence of plasmid-mediated high-level tigecycline resistance genes in animals and humans. Nat. Microbiol. 2019;4:1450–1456. doi: 10.1038/s41564-019-0445-2. [DOI] [PubMed] [Google Scholar]
  • 14.Chen C., Cui C.Y., Yu J.J., He Q., Wu X.T., He Y.Z., Cui Z.H., Li C., Jia Q.L., Shen X.G., et al. Genetic diversity and characteristics of high-level tigecycline resistance Tet(X) in Acinetobacter species. Genome Med. 2020;12:111. doi: 10.1186/s13073-020-00807-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Cui C.Y., Chen C., Liu B.T., He Q., Wu X.T., Sun R.Y., Zhang Y., Cui Z.H., Guo W.Y., Jia Q.L., et al. Co-occurrence of Plasmid-Mediated Tigecycline and Carbapenem Resistance in Acinetobacter spp. from Waterfowls and Their Neighboring Environment. Antimicrob. Agents Chemother. 2020;64:e02502-19. doi: 10.1128/AAC.02502-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zheng X.R., Zhu J.H., Zhang J., Cai P., Sun Y.H., Chang M.X., Fang L.X., Sun J., Jiang H.X. A novel plasmid-borne tet(X6) variant co-existing with blaNDM-1 and blaOXA-58 in a chicken Acinetobacter baumannii isolate. J. Antimicrob. Chemoth. 2020;75:3397–3399. doi: 10.1093/jac/dkaa342. [DOI] [PubMed] [Google Scholar]
  • 17.Mallonga Z., Tokuda M., Yamazaki R., Tsuruga S., Nogami I., Sato Y., Tarrayo A.G., Fuentes R., Parilla R., Kimbara K., et al. Emergence of Acinetobacter towneri harbouring a novel plasmid with blaNDM-1 and tet(X7) from hospital wastewater in the Philippines. J. Glob. Antimicrob. Resist. 2025;41:287–289. doi: 10.1016/j.jgar.2025.01.017. [DOI] [PubMed] [Google Scholar]
  • 18.Lee M.J., Jang S.J., Li X.M., Park G., Kook J.K., Kim M.J., Chang Y.H., Shin J.H., Kim S.H., Kim D.M., et al. Comparison of rpoB gene sequencing, 16S rRNA gene sequencing, gyrB multiplex PCR, and the VITEK2 system for identification of Acinetobacter clinical isolates. Diagn. Microbiol. Infect. Dis. 2014;78:29–34. doi: 10.1016/j.diagmicrobio.2013.07.013. [DOI] [PubMed] [Google Scholar]
  • 19.Sun J., Chen C., Cui C.Y., Zhang Y., Liu X., Cui Z.H., Ma X.Y., Feng Y., Fang L.X., Lian X.L., et al. Plasmid-encoded tet(X) genes that confer high-level tigecycline resistance in Escherichia coli. Nat. Microbiol. 2019;4:1457–1464. doi: 10.1038/s41564-019-0496-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wei S., Zhao H., Xian Y., Hussain M.A., Wu X. Multiplex PCR assays for the detection of Vibrio alginolyticus, Vibrio parahaemolyticus, Vibrio vulnificus, and Vibrio cholerae with an internal amplification control. Diagn. Microbiol. Infect. Dis. 2014;79:115–118. doi: 10.1016/j.diagmicrobio.2014.03.012. [DOI] [PubMed] [Google Scholar]
  • 21.Hammad M.I., Conrads G., Abdelbary M.M.H. Isolation, identification, and significance of salivary Veillonella spp., Prevotella spp., and Prevotella salivae in patients with inflammatory bowel disease. Front. Cell Infect. Microbiol. 2023;13:1278582. doi: 10.3389/fcimb.2023.1278582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gao D., Yu J., Dai X., Tian Y., Sun J., Xu X., Cai X. Development and evaluation of an indirect enzyme-linked immunosorbent assay based on a recombinant SifA protein to detect Salmonella infection in poultry. Poult. Sci. 2023;102:102513. doi: 10.1016/j.psj.2023.102513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Poveda A., Krell J., Heinz V., Terjung N., Tomasevic I., Gibis M. The Use of MALDI--TOF MS for Microbial Identification of Discolored Vacuum--Packaged Beef. J. Food Sci. 2025;90:e70591. doi: 10.1111/1750-3841.70591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Jain C., Rodriguez-R L.M., Phillippy A.M., Konstantinidis K.T., Aluru S. High throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries. Nat. Commun. 2018;9:5114. doi: 10.1038/s41467-018-07641-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Chatzimichail S., Turner P., Feehily C., Farrar A., Crook D., Andersson M., Oakley S., Barrett L., El Sayyed H., Kyropoulos J., et al. Rapid identification of bacterial isolates using microfluidic adaptive channels and multiplexed fluorescence microscopy. Lab Chip. 2024;24:4843–4858. doi: 10.1039/D4LC00325J. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Gurevich A., Saveliev V., Vyahhi N., Tesler G. QUAST: Quality assessment tool for genome assemblies. Bioinformatics. 2013;29:1072–1075. doi: 10.1093/bioinformatics/btt086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Parks D.H., Imelfort M., Skennerton C.T., Hugenholtz P., Tyson G.W. CheckM: Assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 2015;25:1043–1055. doi: 10.1101/gr.186072.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Chen C., Wu T., Liu J., Lv Y. Genomic Diversity of the tet(X)-Positive Myroides Species. Microorganisms. 2025;13:1180. doi: 10.3390/microorganisms13061180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Liu D., Zhang Y., Fan G., Sun D., Zhang X., Yu Z., Wang J., Wu L., Shi W., Ma J. IPGA: A handy integrated prokaryotes genome and pan--genome analysis web service. iMeta. 2022;1:e55. doi: 10.1002/imt2.55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Xu Q., Mu X., He J., Liu H., Liu X., Wang Y., Hua X., Yu Y., Manning S.D. Phenotypic and genotypic characterization of clinical carbapenem-resistant Acinetobacter species harboring the metallo-beta-lactamases IMP-8 or NDM-1 in China. Microbiol. Spectr. 2025;13:e0115824. doi: 10.1128/spectrum.01158-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Malhotra J., Anand S., Jindal S., Rajagopal R., Lal R. Acinetobacter indicus sp. nov., isolated from a hexachlorocyclohexane dump site. Int. J. Syst. Evol. Microbiol. 2012;62:2883–2890. doi: 10.1099/ijs.0.037721-0. [DOI] [PubMed] [Google Scholar]
  • 32.Bello-Lopez E., Rocha-Gracia R.D.C., Castro-Jaimes S., Cevallos M.A., Vargas-Cruz M., Verdugo-Yocupicio R., Saenz Y., Torres C., Gutierrez-Cazarez Z., Arenas-Hernandez M.M.P., et al. Antibiotic resistance mechanisms in Acinetobacter spp. strains isolated from patients in a paediatric hospital in Mexico. J. Glob. Antimicrob. Resist. 2020;23:120–129. doi: 10.1016/j.jgar.2020.08.014. [DOI] [PubMed] [Google Scholar]
  • 33.Rui Y., Qiu G. Analysis of Antibiotic Resistance Genes in Water Reservoirs and Related Wastewater from Animal Farms in Central China. Microorganisms. 2024;12:396. doi: 10.3390/microorganisms12020396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Carr E.L., Kämpfer P., Patel B.K.C., Gürtler V., Seviour R.J. Seven novel species of Acinetobacter isolated from activated sludge. Int. J. Syst. Evol. Microbiol. 2003;53:953–963. doi: 10.1099/ijs.0.02486-0. [DOI] [PubMed] [Google Scholar]
  • 35.Zou D., Huang Y., Liu W., Yang Z., Dong D., Huang S., He X., Ao D., Liu N., Wang S., et al. Complete sequences of two novel blaNDM-1-harbouring plasmids from two Acinetobacter towneri isolates in China associated with the acquisition of Tn125. Sci. Rep. 2017;7:9405. doi: 10.1038/s41598-017-09624-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Tobin L.A., Jarocki V.M., Kenyon J., Drigo B., Donner E., Djordjevic S.P., Hamidian M., Elkins C.A. Genomic analysis of diverse environmental Acinetobacter isolates identifies plasmids, antibiotic resistance genes, and capsular polysaccharides shared with clinical strains. Appl. Environ. Microbiol. 2024;90:e0165423. doi: 10.1128/aem.01654-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ma J., Wang J., Feng J., Liu Y., Yang B., Li R., Bai L., He T., Wang X., Yang Z. Characterization of Three Porcine Acinetobacter towneri Strains Co-Harboring tet(X3) and blaOXA-58. Front. Cell Infect. Microbiol. 2020;10:586507. doi: 10.3389/fcimb.2020.586507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Maehana S., Kitasato H., Suzuki M., Stewart F.J. Genome Sequence of Acinetobacter towneri Strain DSM 16313, Previously Known as the Proposed Type Strain of Acinetobacter seohaensis. Microbiol. Resour. Announc. 2021;10:e0069021. doi: 10.1128/MRA.00690-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Nemec A., Radolfová-Křížová L., Maixnerová M., Nemec M., Shestivska V., Španělová P., Kyselková M., Wilharm G., Higgins P.G. Acinetobacter amyesii sp. nov., widespread in the soil and water environment and animals. Int. J. Syst. Evol. Microbiol. 2022;72:005642. doi: 10.1099/ijsem.0.005642. [DOI] [PubMed] [Google Scholar]
  • 40.Dede A., Pérez-Valera E., Elhottová D. Genome analysis of manure and soil-dwelling Acinetobacter strains indicates potential health risks associated with antibiotic resistance and virulence factors. Microb. Pathog. 2025;205:107610. doi: 10.1016/j.micpath.2025.107610. [DOI] [PubMed] [Google Scholar]
  • 41.Wang L., Liu D., Lv Y., Cui L., Li Y., Li T., Song H., Hao Y., Shen J., Wang Y., et al. Novel Plasmid-Mediated tet(X5) Gene Conferring Resistance to Tigecycline, Eravacycline, and Omadacycline in a Clinical Acinetobacter baumannii Isolate. Antimicrob. Agents Chemother. 2019;64:e01326-19. doi: 10.1128/AAC.01326-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tang B., Yang H., Jia X., Feng Y. Coexistence and characterization of Tet(X5) and NDM-3 in the MDR-Acinetobacter indicus of duck origin. Microb. Pathog. 2021;150:104697. doi: 10.1016/j.micpath.2020.104697. [DOI] [PubMed] [Google Scholar]
  • 43.Ji K., Xu Y., Sun J., Huang M., Jia X., Jiang C., Feng Y. Harnessing efficient multiplex PCR methods to detect the expanding Tet(X) family of tigecycline resistance genes. Virulence. 2019;11:49–56. doi: 10.1080/21505594.2019.1706913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Fu Y., Liu D., Song H., Liu Z., Jiang H., Wang Y. Development of a Multiplex Real-Time PCR Assay for Rapid Detection of Tigecycline Resistance Gene tet(X) Variants from Bacterial, Fecal, and Environmental Samples. Antimicrob. Agents Chemother. 2020;64:e02292-19. doi: 10.1128/AAC.02292-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Li Y., Shen Z., Ding S., Wang S. A TaqMan-based multiplex real-time PCR assay for the rapid detection of tigecycline resistance genes from bacteria, faeces and environmental samples. BMC Microbiol. 2020;20:174. doi: 10.1186/s12866-020-01813-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Chen G., Chen L., Lin S., Yang C., Liang H., Huang K., Guo Z., Lv F. Sensitive and rapid detection of tet(X2) ~ tet(X5) by loop-mediated isothermal amplification based on visual OTG dye. BMC Microbiol. 2023;23:329. doi: 10.1186/s12866-023-02944-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Cui Z.H., Ni W.N., Tang T., He B., Zhong Z.X., Fang L.X., Chen L., Chen C., Cui C.Y., Liu Y.H., et al. Rapid detection of plasmid-mediated high-level tigecycline resistance in Escherichia coli and Acinetobacter spp. J. Antimicrob. Chemother. 2020;75:1479–1483. doi: 10.1093/jac/dkaa029. [DOI] [PubMed] [Google Scholar]
  • 48.Wang Y., Chen H., Pan Q., Wang J., Jiao X.a., Zhang Y. Development and evaluation of rapid and accurate one-tube RPA-CRISPR-Cas12b-based detection of mcr-1 and tet(X4) Appl. Microbiol. Biotechnol. 2024;108:345. doi: 10.1007/s00253-024-13191-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Cui Z.-H., Zheng Z.-J., Tang T., Zhong Z.-X., Cui C.-Y., Lian X.-L., Fang L.-X., He Q., Wang X.-R., Chen C., et al. Rapid Detection of High-Level Tigecycline Resistance in Tet(X)-Producing Escherichia coli and Acinetobacter spp. Based on MALDI-TOF MS. Front. Cell Infect. Microbiol. 2020;10:583341. doi: 10.3389/fcimb.2020.583341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Zheng Z.J., Cui Z.H., Diao Q.Y., Ye X.Q., Zhong Z.X., Tang T., Wu S.B., He H.L., Lian X.L., Fang L.X., et al. MALDI-TOF MS for rapid detection and differentiation between Tet(X)-producers and non-Tet(X)-producing tetracycline-resistant Gram-negative bacteria. Virulence. 2022;13:77–88. doi: 10.1080/21505594.2021.2018768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Zhang L., Xie J., Qu Z., Duan D., Liu C., Zhang D., Jiang H., Dai X., Jiang Y., Fang X., et al. A rapid liquid chromatography-tandem mass spectrometry based method for the detection of Tet(X) resistance gene in Enterobacteriaceae. Front. Microbiol. 2024;15:1477740. doi: 10.3389/fmicb.2024.1477740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Li W., Wang J., Ruan Z., Feng Y., Fu Y., Jiang Y., Wang H., Yu Y. Species Distribution of Clinical Acinetobacter Isolates Revealed by Different Identification Techniques. PLoS ONE. 2014;9:e104882. doi: 10.1371/journal.pone.0104882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Marinova-Bulgaranova T.V., Hitkova H.Y., Balgaranov N.K. Current Methods for Reliable Identification of Species in the Acinetobacter calcoaceticus–Acinetobacter baumannii Complex. Microorganisms. 2025;13:1819. doi: 10.3390/microorganisms13081819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Rassoulian Barrett S., Hoffman N.G., Rosenthal C., Bryan A., Marshall D.A., Lieberman J., Greninger A.L., Peddu V., Cookson B.T., Salipante S.J., et al. Sensitive Identification of Bacterial DNA in Clinical Specimens by Broad-Range 16S rRNA Gene Enrichment. J. Clin. Microbiol. 2020;58:e01605-20. doi: 10.1128/JCM.01605-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Liu Y., Raymond J.J., Wu X., Chua P.W.L., Ling S.Y.H., Chan C.C., Chan C., Loh J.X.Y., Song M.X.Y., Ong M.Y.Y., et al. Electrostatic microfiltration (EM) enriches and recovers viable microorganisms at low-abundance in large-volume samples and enhances downstream detection. Lab Chip. 2024;24:4275–4287. doi: 10.1039/D4LC00419A. [DOI] [PubMed] [Google Scholar]
  • 56.Jansriphibul K., Krohn C., Ball A.S. Sources of variability for viability PCR using propidium monoazide. Microbiol. Res. 2025;298:128224. doi: 10.1016/j.micres.2025.128224. [DOI] [PubMed] [Google Scholar]
  • 57.Chen C., Cui C.Y., Wu X.T., Fang L.X., He Q., He B., Long T.F., Liao X.P., Chen L., Liu Y.H., et al. Spread of tet(X5) and tet(X6) genes in multidrug-resistant Acinetobacter baumannii strains of animal origin. Vet. Microbiol. 2021;253:108954. doi: 10.1016/j.vetmic.2020.108954. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.


Articles from Microorganisms are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES