FIG. 6.

(A) DNA sequence from the upstream region of hutU of P. syringae containing the promoter elements and other putative regulatory sequences. The dashed arrow shown below the sequence at beginning of the hutU-specific ORF was used for mapping the transcription start sites. The temperature (4°C and 4 or 22°C) specific transcription start sites have been indicated by shaded arrows. The characteristic CAAAA sequence in the promoters is shown within the boxes. The putative ς ⁵⁴-specific promoter sequence [GG-(N₁₀)-GC] and the corresponding transcription start site (vertical open arrow) are marked on the sequence. The putative repressor HutC-binding sequence (CTTGTATGTACAAG) and CAP binding sequence (AAGTGTGCGTCGACCCTCTTGT) have been marked by shaded boxes. The translation initiation codon (GTG), the Shine-Dalgarno (SD) sequence, a putative cold box-like sequence, and a cold-shock protein binding sequence (ATTGG) downstream of the translational initiation site of hutU are marked. The sequence of the 3′ end of orfII of hutC are underlined and in lowercase. The nucleotide numbers refer to the number in the DNA sequence of the region from P. syringae (accession no. AF326719). (B) Putative regulatory sequence with the potential hairpin structure in the promoter region of hutU. The location of the hairpin is marked by two opposing arrows below the sequence in panel A.