High matrix stiffness triggers the YAP-OPA1-TET1/3 loop to drive chemoresistance via enhanced nuclear-mitochondrial communication

Peng Wu; Sicheng Wang; Zanmin Hu; Haoyan Zhang; Yuqing Lin; Zizhao Li; Jiahong Wu; Yani Chen; Yujie Chen; Yuandong Xu; Jun Li; Yupeng Guan

doi:10.1016/j.isci.2025.113996

. 2025 Nov 10;28(12):113996. doi: 10.1016/j.isci.2025.113996

High matrix stiffness triggers the YAP-OPA1-TET1/3 loop to drive chemoresistance via enhanced nuclear-mitochondrial communication

Peng Wu ^2,⁴, Sicheng Wang ^2,⁴, Zanmin Hu ², Haoyan Zhang ², Yuqing Lin ³, Zizhao Li ², Jiahong Wu ², Yani Chen ², Yujie Chen ², Yuandong Xu ^1,^∗, Jun Li ^1,^∗∗, Yupeng Guan ^1,^2,^3,^5,^∗∗∗

PMCID: PMC12682049 PMID: 41362610

Summary

Chemoresistance remains a major obstacle in prostate cancer therapy. This study demonstrates that high extracellular matrix stiffness promotes chemoresistance by disrupting mitochondrial-nuclear communication. Culturing prostate cancer cells on polyacrylamide hydrogels of varying stiffness revealed that a high-stiffness environment promotes mitochondrial fusion and enhances function. Mechanistic investigations revealed that high matrix stiffness activates YAP, leading to dysregulation of the Hippo signaling pathway, which subsequently upregulates the expression of OPA1 and induces mitochondrial fusion. This fusion triggers a reprogramming of glutamine metabolism. The resulting metabolite, α-ketoglutarate, activated DNA demethylases TET1 and TET3, causing epigenetic modifications of YAP target genes and further exacerbating Hippo pathway dysregulation. Together, this establishes a YAP-OPA1-TET1/3-mediated positive feedback loop between the nucleus and mitochondria that drives drug resistance. Crucially, targeting OPA1 disrupted this loop and reversed stiffness-induced chemoresistance. These findings reveal a novel mitochondrial-nuclear communication, offering new insights for overcoming chemoresistance in prostate cancer.

Subject areas: biological sciences, molecular biology, cell biology, bioinformatics

Graphical abstract

Highlights

•
Clinical specimens show chemoresistance correlates with high matrix stiffness
•
High stiffness induces Hippo pathway dysregulation, driving mitochondrial fusion
•
YAP-OPA1-TET1/3 loop mediates nuclear-mitochondrial communication and reprogramming
•
MYLS22 targets OPA1, overcoming paclitaxel resistance in prostate cancer

Biological sciences; Molecular biology; Cell biology; Bioinformatics

Introduction

Prostate cancer represents the second most commonly diagnosed malignancy in men worldwide and ranks as the fifth leading cause of cancer-related mortality, accounting for approximately 15% of all cancer cases globally.¹ Chemotherapy remains a cornerstone and one of the primary modalities in the therapeutic arsenal against prostate cancer. Nevertheless, the emergence of chemoresistance presents a principal obstacle to successful treatment outcomes. The etiology of such chemoresistance is multifactorial and highly intricate. Accumulating evidence indicates that androgens and their receptors, epithelial-mesenchymal transition, cancer stem cells, inflammatory cytokines, and the tumor microenvironment (TME) collectively contribute to the acquisition of resistance mechanisms.²^,³^,⁴^,⁵ Among these factors, the role of the TME in driving chemoresistance has garnered increasing attention in various cancer types. Deciphering these mechanisms is of paramount importance for the rational development of optimized therapeutic strategies and for the exploration of novel interventions aimed at preventing or overcoming disease recurrence.

The extracellular matrix (ECM), a critical component of the TME, serves as the primary mediator of biomechanical signaling. However, for a prolonged period, alterations in the ECM during cancer progression were largely underappreciated. In reality, the ECM is a dynamic pericellular structure that has been demonstrated to play essential roles in diverse organs, including the provision of environmental cues, mechanical support, and tissue protection.⁶ The interplay between cells and the ECM is both precise and reciprocal: while cells deposit, degrade, and remodel the ECM, the ECM reciprocally governs diverse cellular behaviors. This bidirectional regulation is conceptualized as “dynamic reciprocity.”⁷ Recent studies have highlighted the strong influence of ECM mechanical properties—particularly stiffness—on fundamental cellular processes such as migration and proliferation. Growing attention has been paid to the role of ECM stiffness in pathological contexts, especially in tumor initiation and progression.⁸ In the majority of solid tumors, both compositional and mechanical alterations of the ECM are frequently observed. These changes modulate a wide array of cellular functions through mechanisms including, but not limited to, energy metabolism reprogramming, mitochondrial dynamics, mitophagy, and stem cell fate determination, thereby promoting tumor cell proliferation, invasion, and resistance to cell death.⁸^,⁹^,¹⁰^,¹¹ Although previous studies have demonstrated the critical role of ECM in tumor progression, the specific mechanisms by which its stiffness contributes to chemoresistance in prostate cancer warrant further investigation. Focal adhesions, which are complex assemblies comprising integrins, cytoskeletal proteins, and associated molecules, serve as critical mechanical linkages between the intracellular cytoskeleton and the ECM. Among these, integrin-linked kinase (ILK) functions as a key regulatory component. Notably, ILK has been implicated in the progression of multiple malignancies, including breast, prostate, and colorectal cancers.¹²^,¹³

Yes-associated protein (YAP), a major effector of the mammalian Hippo signaling pathway, also acts as a key mechanotransducer activated by mechanical cues from ECM.¹⁴ It orchestrates a broad spectrum of biological processes, with prominent involvement in cellular energy metabolism.¹⁵ Studies have revealed a non-canonical role for YAP in cellular adaptation to glutamine metabolic perturbations: under conditions of glutamine deprivation, YAP undergoes rapid dephosphorylation and activation, though the precise regulatory mechanisms remain unclear.¹⁶ Since the Hippo pathway generally suppresses tumor growth and is often dysregulated in cancers, targeting this pathway has emerged as a promising therapeutic approach.¹⁷ Therefore, modulation of the Hippo signaling pathway may represent an important strategy for countering chemoresistance.

Mitochondria are semi-autonomous, highly dynamic organelles composed of four distinct compartments: the outer mitochondrial membrane (OMM), intermembrane space, inner mitochondrial membrane (IMM), and mitochondrial matrix. Beyond their well-established role in energy production, mitochondria are crucial regulators of diverse cellular processes. Indeed, recent studies have even identified two functionally distinct mitochondrial subpopulations.¹⁸ There is growing evidence linking mitochondrial alterations in cancer cells to tumor progression, migration, and chemoresistance, with altered mitochondrial dynamics being a key factor.¹⁹^,²⁰ Mitochondrial dynamics refers to the continuous processes of mitochondrial fission and fusion, which occur under physiological or stimulated conditions to regulate mitochondrial distribution, quantity, size, and morphology within the cell, maintaining a dynamic balance.²¹ Notably, mitochondrial fusion has been strongly associated with tumor progression. Fusion-related proteins such as MFN1/MFN2 and OPA1 are widely involved in regulating the proliferation, metastasis, recurrence, and chemoresistance of various cancer cells, holding significant clinical therapeutic potential.²²^,²³^,²⁴ Glutamine metabolic reprogramming is another critical adaptation for tumor proliferation and is closely tied to mitochondrial integrity. Through the mitochondrion-driven tricarboxylic acid (TCA) cycle, glutamine is converted into α-ketoglutarate (α-KG), which not only replenishes energy and biosynthetic precursors but also activates the expression of oncogenes.²⁵ Certain therapies targeting glutamine metabolic reprogramming, when combined with immunotherapy, have demonstrated synergistic effects in inhibiting tumor progression and improving therapeutic outcomes, suggesting that glutamine metabolism may represent an effective target for cancer treatment.²⁶ We aim to intervene in the structure and function of mitochondria in cancer cells and regulate glutamine metabolism, thereby restoring chemosensitivity.

This study elucidates the critical role of matrix stiffness in taxane resistance in prostate cancer and identifies it as a potential therapeutic target. Elevated matrix stiffness, observed during the progression of prostate cancer, activates the YAP-OPA1-TET1/3 loop, thereby inducing nuclear-mitochondrial communication. Upon entering the nucleus, YAP enhances the transcriptional regulation of OPA1, which promotes mitochondrial fusion. Concurrently, glutamine metabolic reprogramming in mitochondria activates TET1/3-mediated epigenetic regulation, which further amplifies YAP transcriptional activity. Both in vivo and in vitro experiments corroborate that targeting OPA1 effectively inhibits mitochondrial fusion, thereby disrupting this aberrant nuclear-mitochondrial communication, ultimately restoring chemotherapy sensitivity in tumor cells. A combined therapeutic approach using paclitaxel (PTX)-based agents and OPA1 inhibition may offer a novel strategy to improve clinical outcomes in prostate cancer.

Results

Chemoresistance in prostate cancer is associated with high matrix stiffness

To validate the changes in matrix stiffness during prostate cancer progression, we performed Masson staining, Sirius Red staining, and atomic force microscopy (AFM) measurements on clinical samples with different Gleason scores. The results showed that, whether assessed by Masson staining or Sirius Red staining, samples with Gleason score = 9 exhibited more collagen fibers than those with Gleason score = 7 (Figures 1A and 1B). Additionally, there was a significant difference in the Young’s modulus between the two groups (Figures 1A and 1B). This indicates that prostate cancer progression is associated with high matrix stiffness. To simulate the pathophysiological increase in ECM stiffness during prostate cancer progression, PC3, DU145, and LNCaP cells were cultured on polyacrylamide hydrogels with different stiffness levels: 10 kPa for the soft matrix and 100 kPa for the stiff matrix. The hydrogels were stable, and the surface coating was uniform (Figure S1). Cell viability assays revealed that compared to cells cultured on the soft matrix, those on the stiff matrix exhibited significantly increased IC₅₀ values for PTX (Figures 1C and 1D), suggesting that high matrix stiffness promotes chemoresistance in prostate cancer cells. Additionally, we performed 5-ethynyl-2′-deoxyuridine (EdU) staining to assess the effect of matrix stiffness on the proliferation of PC3, DU145, and LNCaP cells. We observed that in the stiff group, after PTX treatment, the number of EdU-positive cells significantly increased, indicating reduced sensitivity to PTX inhibition (Figures 1E and 1F). Furthermore, Annexin V/propidium iodide (PI) double staining followed by flow cytometry showed that the apoptosis rates in the soft and stiff groups were 19.83% ± 2.48% and 11.63% ± 1.03% for PC3 cells, and 17.90% ± 1.95% and 11.70% ± 2.19% for DU145 cells, respectively (Figures 1G and 1H). This suggests that cancer cells cultured under high matrix stiffness better resist apoptosis-inducing stimuli. During the development of drug resistance, cells often reduce reactive oxygen species (ROS) production to suppress apoptosis.²⁷ We further assessed intracellular ROS levels and found that cells cultured on the stiff matrix had lower ROS levels (Figures 1I and 1J), indicating that high matrix stiffness-induced chemoresistance may be related to ROS modulation. These results collectively suggest that increased ECM stiffness promotes chemoresistance in prostate cancer, although the underlying mechanisms remain unclear.

High matrix stiffness promotes mitochondrial fusion and enhances mitochondrial function

Mitochondria are the most important organelles for cellular ROS production, and mitochondrial structure and function are closely associated with chemoresistance in cancer cells.¹⁹^,²⁰ Therefore, we examined the changes in mitochondria under stiff matrix conditions using multiple approaches. COX IV and VDAC are conserved proteins on the mitochondrial membrane. Western blot analysis showed no significant differences in the protein levels of COX IV and VDAC under different matrix stiffness conditions, indicating that there were no significant changes in the total mitochondrial content between the two culture conditions (Figures 2A–2C). At the same time, we assessed the expression levels of mitochondrial biosynthesis-related genes by quantitative reverse-transcription PCR (RT-qPCR). The results showed no significant difference in the expression levels of mitochondrial biosynthesis-related genes between the soft and stiff groups (Figures S2A–S2C). However, in terms of ATP synthesis, the stiff group unexpectedly exhibited higher ATP levels (Figure S2D). To further explore the changes in mitochondria, we used MitoTracker to selectively label mitochondria. Confocal fluorescence imaging showed that mitochondria in cells cultured on the stiff matrix were predominantly long and tubular, with increased length, while mitochondria in cells cultured on the soft matrix formed many small and short structures (Figure 2D). Statistical analysis revealed that the mitochondrial length in the stiff group (PC3: 2.42 ± 0.35 μm, LNCaP: 2.47 ± 0.43 μm, DU145: 2.30 ± 0.38 μm) was significantly longer than that in the soft group (PC3: 1.25 ± 0.31 μm, LNCaP: 1.31 ± 0.28 μm, DU145: 1.17 ± 0.29 μm), and the area also increased correspondingly (Figures 2D–2F and S2E–S2G). These observations suggest that mitochondria fuse and elongate on the stiff matrix. Additionally, the reduction in mtDNA loss under stiff matrix conditions further supports enhanced mitochondrial function (Figure 2G). Next, we assessed changes in mitochondrial membrane potential using JC-1 probe staining followed by flow cytometry. In the soft group, the proportion of JC-1 monomers was 20.00% ± 1.81% in PC3 cells and 17.57% ± 0.65% in DU145 cells, whereas in the stiff group, it was 9.57% ± 0.68% in PC3 cells and 8.73% ± 0.97% in DU145 cells (Figures 2H and 2I). This indicates that mitochondria in the stiff group maintain a more normal membrane potential compared to the soft group. Transmission electron microscopy (TEM) also revealed that mitochondria in the stiff group had longer lengths, more defined mitochondrial cristae, and larger areas (Figures 2J–2L). These results suggest that higher matrix stiffness promotes mitochondrial fusion and helps maintain mitochondrial function.

High matrix stiffness activates YAP nuclear translocation and regulates the Hippo signaling pathway

To investigate the specific mechanisms underlying chemoresistance and mitochondrial changes induced by changes in matrix stiffness, we performed next-generation transcriptomic sequencing on cells cultured under different matrix stiffness conditions (Figure 3A). Further Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis revealed that the Hippo signaling pathway was the most significantly enriched pathway (Figure 3B). Here, we present all differentially expressed genes in the Hippo signaling pathway (Figure 3C). At the protein level, more YAP was dephosphorylated and activated in PC3 and DU145 cells cultured on the stiff matrix (Figures 3D, 3E, and S3A). Meanwhile, confocal fluorescence imaging showed a significant difference in the proportion of YAP co-localized with the nucleus between the soft (PC3: 27.01% ± 7.49%, DU145: 31.00% ± 8.63%) and stiff groups (PC3: 73.46% ± 9.88%, DU145: 76.14% ± 8.23%). This indicates that more YAP translocates to the nucleus in cells cultured on the stiff matrix, confirming the effective activation of YAP (Figures 3F and 3G). Nuclear-cytoplasmic fractionation results revealed that the expression of YAP in the cytoplasm showed little difference between the different matrix stiffness conditions, but the YAP expression in the nucleus of the stiff matrix group was significantly higher compared to the soft matrix group (Figures 3H and 3I). To further explore whether YAP nuclear translocation has biological significance, we assessed the mRNA levels of YAP downstream target genes and found that the expression of Hippo signaling pathway target genes ANKRD1 and CTGF was significantly increased (Figures S3B and S3C). These results indicate that the YAP signaling pathway is effectively activated. Detection of TEAD, the binding molecule of YAP, also revealed a significant increase in TEAD transcriptional activity in the stiff group (Figure S3D). All these results suggest that increased ECM stiffness activates YAP by dephosphorylation, leading to its nuclear translocation, thereby regulating the Hippo signaling pathway.

Functional screening identifies ILK as a mediator of YAP dephosphorylation

Although it has been found that high matrix stiffness can activate YAP nuclear translocation to regulate the Hippo signaling pathway, the specific mechanism by which YAP is activated is still unclear. We further mined the transcriptomic data and found that Focal Adhesion is one of the most significantly enriched KEGG pathways (Figure 4A). This suggests that Focal Adhesion may play a key role in the biological behavior changes of prostate cancer induced by high matrix stiffness. As an important pathway mediating cell adhesion, which regulates the cell’s perception and response to the ECM, it is understandable that Focal Adhesion is enriched here. To investigate the specific role of Focal Adhesion, we further screened the molecules related to this pathway and found that ILK expression significantly increased under stiff matrix conditions (Figures 4B and 4C). Additionally, given that YAP activation is closely related to dephosphorylation and kinases, we hypothesized that ILK might be the upstream molecule activating YAP in prostate cancer cells.²⁸ Western blot analysis confirmed that ILK expression was significantly increased in cells cultured on the stiff matrix, indicating that Focal Adhesion is indeed activated (Figures 4D, 4E, S4A, and S4B). Next, we added the ILK inhibitor QLT0267 to cells cultured on the stiff matrix and found that the YAP dephosphorylation induced by the stiff matrix was significantly reduced, suggesting that ILK is a key molecule regulating YAP activation (Figures 4F, 4G, and S4C–S4G). Similarly, confocal fluorescence imaging showed that inhibiting ILK reduced the level of YAP nuclear translocation, thereby relieving the regulation of YAP on the Hippo signaling pathway (Figures 4H, 4I, S4H, and S4I). These data suggest that the YAP activation induced by higher matrix stiffness is mediated by ILK.

YAP-OPA1-mediated communication from the nucleus to the mitochondria

Gene Ontology (GO) pathway enrichment related to mitochondria showed that both mitochondrial dynamics and their regulatory mechanisms undergo dramatic changes in response to alterations in matrix stiffness (Figure 5A). The differentially expressed genes involved in key mitochondrial dynamics pathways are shown in Figures S5A and S5B. To further investigate whether the changes in mitochondrial dynamics are mediated by YAP and to explore the underlying regulatory mechanisms, we used RT-qPCR to examine the mRNA levels of key molecules involved in mitochondrial dynamics: OPA1, MFN1, MFN2, DRP1, and FIS1. In cells cultured on a stiff matrix, the mRNA level of OPA1 was significantly increased, and this increase was suppressed by the YAP inhibitor verteporfin. In contrast, the mRNA levels of MFN1, MFN2, DRP1, and FIS1 showed no significant changes in response to either high matrix stiffness or verteporfin treatment (Figures 5B and 5C). Further quantitative analysis using western blotting showed that OPA1 expression was significantly elevated in both the cytosolic and mitochondrial fractions of cells in the stiff group, and this increase was partially inhibited by verteporfin (Figures 5D and 5E). Notably, OPA1 expression was higher in the mitochondria and was more enriched under high matrix stiffness conditions, indicating that OPA1 is functionally localized to the mitochondria. Using MitoTracker Red to label mitochondria, we observed, as previously shown in Figure 2D, that cells cultured on a stiff matrix exhibited significantly fewer mitochondria with increased length, indicating extensive mitochondrial fusion. Upon the addition of verteporfin, mitochondrial fusion was markedly reduced in cells cultured on the stiff matrix, while no significant changes were observed in cells on the soft matrix (Figures 5F–5H and S5C–S5E). Furthermore, TEM analysis of cells under four different culture conditions revealed that mitochondrial length and area increased under stiff matrix conditions, and this effect was similarly suppressed by verteporfin (Figures 5I–5K and S5F–S5H). To further confirm that these mitochondrial alterations are regulated by YAP, we knocked down YAP using small interfering RNA (Figures S6A and S6B). Mitochondrial morphology analysis showed that YAP knockdown partially reversed the stiff matrix-induced mitochondrial fusion (Figures S6C–S6G). Additionally, the mtDNA preservation effect associated with mitochondrial fusion was also inhibited upon YAP knockdown (Figure S6H). Therefore, these data indicate that YAP mediates nucleus-to-mitochondria communication by activating OPA1, thereby promoting mitochondrial fusion.

Mitochondrial metabolite α-KG activates TET1/3, mediating reverse mitochondrial-to-nuclear communication

Given that biological changes in the nucleus can regulate mitochondrial fusion, we became interested in whether mitochondria can, in turn, regulate the nucleus. Glutamine metabolism reprogramming is a key metabolic bypass in cancer.²⁵ Emerging evidence suggests that YAP and glutamine metabolic reprogramming influence each other, although the exact mechanism remains unclear.¹⁶ Mitochondria are critical organelles for glutamine conversion (Figure 6A). To verify whether the glutamine metabolic reprogramming induced by YAP is regulated by mitochondrial fusion, we used the OPA1 inhibitor MYLS22 to suppress mitochondrial fusion. Our data showed that under stiff matrix culture conditions, glutamine uptake was significantly increased and the activity of the key glutamine-metabolizing enzyme glutaminase (GLS) was markedly enhanced. However, MYLS22 was able to inhibit these metabolic changes (Figures 6B and 6C). Moreover, the gene expression levels of GLS and the glutamine transporter SLC1A5 were also significantly upregulated under stiff matrix conditions, and this was similarly inhibited by MYLS22 (Figure S7A). The Seahorse mitochondrial stress test measuring oxygen consumption rate (OCR) revealed that under stiff matrix conditions, the cells exhibited an increase in OCR. This increase was inhibited by treatment with either MYLS22 or the glutamine metabolism inhibitor BPTES (Figures 6D–6F). These results suggest a close relationship between mitochondrial fusion and glutamine metabolic reprogramming. To explore whether glutamine regulates YAP transcription, we examined YAP nuclear localization after treatment with MYLS22 or BPTES. We found that YAP nuclear translocation was not affected by MYLS22 (Figures S7B–S7E). However, paradoxically, the transcription of key YAP downstream target genes was significantly affected by both MYLS22 and BPTES (Figures 6G and 6H). Since glutamine metabolism reprogramming does not regulate YAP nuclear localization but does affect downstream YAP transcription, we hypothesize that this is mediated via epigenetic mechanisms. Through RNA array screening of epigenetically related enzyme systems, we found that TET1 and TET3 were significantly upregulated under stiff matrix conditions (Figure 6I). Western blot analysis revealed that the protein expression levels of TET1 and TET3 were significantly increased in the stiff group, and this increase was inhibited by MYLS22. Supplementation with α-KG, a glutamine metabolic intermediate, reversed this suppression (Figures 6J and 6K). Therefore, we propose that these epigenetic changes are caused by α-KG-induced activation of TET enzymes (Figure 6L). Assays for TET activity showed that changes in TET activity followed a similar trend to changes in protein expression (Figure 6M). Likewise, DNA methylation levels correlated with changes in TET expression and activity (Figures S7F and S7G). To further confirm that the metabolic reprogramming and changes in TET activity are induced by OPA1, we knocked down OPA1 (Figures S7H and S7I). The measurements of GLS activity and TET activity indicated that knocking down OPA1 suppressed GLS and TET activity on the stiff matrix, while no significant effect was observed on these activities under soft matrix conditions (Figures S7J and S7K). Together, these data indicate that mitochondrial fusion-induced glutamine metabolic reprogramming leads to the conversion of glutamine to α-KG, which activates TET1/3 to mediate reverse mitochondria-to-nucleus communication.

Targeting OPA1 disrupts nuclear-mitochondrial communication and restores tumor chemotherapy sensitivity

Based on the above data, we propose using MYLS22 to target OPA1 to disrupt nucleus-mitochondria communication induced by high matrix stiffness, thereby restoring tumor chemosensitivity. To validate the efficacy of combined therapy, we performed CCK-8 assays to measure cell viability after MYLS22 treatment. The IC₅₀ values of both cell lines to PTX were effectively reduced (Figures 7A and 7B). Additionally, we conducted EdU staining to assess the impact of combined therapy on cell proliferation. We observed a significant difference in EdU positivity between PTX monotherapy (PC3: 54.38% ± 3.53%, DU145: 42.08% ± 3.67%, LNCaP: 45.44% ± 8.64%) and PTX+MYLS22 combination therapy (PC3: 37.20% ± 2.50%, DU145: 31.50% ± 3.65%, LNCaP: 28.15% ± 2.83%) under high matrix stiffness culture conditions (Figures 7C and 7D). This indicates that the combined therapy effectively reduced the proliferation rate of cancer cells and inhibited chemotherapy resistance induced by high matrix stiffness. Furthermore, Annexin V/PI staining followed by flow cytometry analysis revealed that the combined therapy significantly increased apoptosis rates in both cell lines (Figures 7E and 7F). JC-1 fluorescent probe staining and flow cytometry results showed that the combined therapy led to an increase in mitochondrial monomer numbers and a significant decrease in mitochondrial membrane potential (Figures 7G and 7H). ROS fluorescent probe staining results demonstrated that, compared to PTX monotherapy (PC3: 61.73% ± 5.71%, DU145: 66.53% ± 6.79%, LNCaP: 71.63% ± 2.47%), PTX+MYLS22 combination therapy (PC3: 87.24% ± 3.00%, DU145: 85.85% ± 3.47%, LNCaP: 84.25% ± 2.50%) significantly increased cellular ROS accumulation (Figures 7I and 7J). The increased loss of mtDNA copies following combined therapy further validated the enhanced efficacy (Figure 7K). Collectively, these results indicate that targeting OPA1 with PTX and MYLS22 combination therapy disrupts mitochondrial structure, causing severe impairment of mitochondrial biological functions. Targeting OPA1 with MYLS22 may be an effective approach to restore tumor chemosensitivity.

Targeting OPA1 inhibits high matrix stiffness-induced chemoresistance in vivo

In vitro experiments have demonstrated that high matrix stiffness induces chemotherapy resistance through YAP-OPA1-TET1/3-mediated mitochondria-nucleus communication and MYLS22 can disrupt this communication, restoring chemotherapy sensitivity. Therefore, we further explored whether MYLS22 could also affect prostate cancer chemotherapy resistance induced by high matrix stiffness in vivo. To further validate the therapeutic effect, we used subcutaneous tumor-bearing male BALB/c mice to examine the impact of matrix stiffness on prostate cancer resistance and the efficacy of combination treatment. Starting from the successful tumor establishment in mice, we injected the lysyl oxidase inhibitor BAPN intratumorally to reduce the stiffness of the tumor matrix (Figure 8A). By inhibiting lysyl oxidase with BAPN, the crosslinking of collagen fibers was disrupted, resulting in a significant decrease in tumor hardness in the mice.²⁹ Histological staining, including H&E, Masson, and Sirius Red staining, revealed that after BAPN injection, the number of collagen fibers was reduced (Figures 8B and 8C). After 14 days of tumor growth, we began treatment with either PTX or PTX+MYLS22 in the mice (Figure 8D). Tumor growth curves are shown in Figure 8E. Under conditions of higher matrix stiffness in vivo, the tumors exhibited greater resistance to PTX, and the treatment effect was poorer. In mice with PC3 xenografts, on day 42, tumors collected from the Soft group had a size of 379.82 ± 51.42 mm³, while tumors from the Stiff group measured 807.48 ± 64.95 mm³ and those from the Stiff+MYLS22 group measured 606.77 ± 52.70 mm³. In DU145 xenograft-bearing mice, the Soft group tumors measured 403.34 ± 36.85 mm³, the Stiff group tumors measured 816.85 ± 62.54 mm³, and the Stiff+MYLS22 group tumors measured 614.82 ± 57.75 mm³ (Figures 8E–8G). This indicates that, similar to the cellular experiments, the combined treatment with PTX and MYLS22 effectively delayed chemotherapy resistance induced by high matrix stiffness. Western blot analysis showed that under the influence of a stiff ECM, the expression of ILK and YAP in the tumors was significantly increased (Figures 8H and 8I). The mRNA expression levels of YAP downstream genes ANKRD1 and CTGF were also increased, but treatment with MYLS22 was able to suppress their upregulation (Figures S8A and S8B). Additionally, metabolic reprogramming analysis showed that the expression trends of SLC1A5 and GLS in the in vivo experiments were similar to those observed in the in vitro experiments, suggesting that high matrix stiffness promotes mitochondrial fusion to enhance glutamine metabolic reprogramming (Figure S8C). Furthermore, TET expression analysis revealed that the levels of TET1 and TET3 were higher under stiff matrix conditions and MYLS22 treatment could inhibit these changes in expression (Figures S8D and S8E). Furthermore, immunohistochemical staining revealed that in vivo combination treatment effectively reduced the Ki-67 positivity rate of chemotherapy-resistant prostate cancer cells, suggesting that targeting mitochondrial fusion can effectively delay prostate cancer resistance (Figures 8J and 8K). Together, these results demonstrate that the combination of PTX and MYLS22 can delay chemotherapy resistance induced by stiff matrix stiffness both in vitro and in vivo.

Discussion

Prostate cancer is the most commonly diagnosed cancer in men in over half of the countries or regions worldwide.³⁰ Taxanes, such as PTX, docetaxel, and cabazitaxel, represent first-line chemotherapeutic agents for advanced prostate cancer. However, treatment often leads to the emergence of chemoresistance over time. Although the mechanisms underlying this resistance are not yet fully understood, alterations in the TME have been recognized as a significant contributing factor.³¹ As a core component of the TME, the ECM stiffness in many malignancies, and this mechanical change is considered a key contributor to chemoresistance.³² In this study, we demonstrate that increased matrix stiffness activates intracellular communication between the nucleus and mitochondria, which in turn disrupts the Hippo signaling pathway, promotes mitochondrial fusion, reprograms glutamine metabolism, and induces epigenetic modifications—ultimately driving the development of chemoresistance.

KEGG and GO pathway enrichment analyses suggest that high matrix stiffness can activate focal adhesion, inhibit the Hippo signaling pathway, and enhance changes in mitochondrial dynamics. The enrichment of focal adhesion in response to stiffness is expected, given its well-established role in mechanosensing. Previous studies have widely acknowledged the Hippo signaling pathway as a critical pathway for transmitting mechanical signals.¹⁰^,¹⁴ Mechanical signals can regulate the small GTPase Rho, which influences the cytoskeleton, thereby maintaining the nuclear localization of YAP/TAZ.¹⁴ In contrast to previous findings, we found that high matrix stiffness activates ILK through focal adhesion, leading to YAP dephosphorylation and nuclear translocation. This process then initiates the regulation of a series of downstream biological events, including mitochondrial fusion. Moreover, as a key molecule in the Hippo signaling pathway regulated by high matrix stiffness, YAP has been reported to be closely involved in mitochondrial quality control in cardiomyocytes, renal tubular cells, and the basolateral amygdala.³³^,³⁴^,³⁵ Nevertheless, the precise mechanisms by which YAP regulates mitochondrial quality, especially in the context of cancer progression, remain incompletely understood.

Mitochondria, often termed the powerhouses of the cell, are central to metabolism and participate in key quality control processes such as fusion, fission, and mitophagy—all of which contribute significantly to chemoresistance.³⁶ Our transcriptomic data and in vitro experiments indicate that mitochondrial dynamics undergo dramatic changes under stiff matrix conditions. Among these, mitochondrial fusion and its related regulation are particularly significant. Mitochondrial fusion, an essential biological process, effectively preserves the mitochondrial membrane potential, maintains the level of mtDNA, reduces ROS production, and inhibits PTX-induced apoptosis. Previous studies have suggested that mitochondrial fusion is one of the key mechanisms for mitochondrial quality control.³⁷ OPA1 primarily mediates the fusion of the IMM, while molecules such as MFN1 and MFN2 are more involved in outer membrane fusion.³⁸ Theoretically, mitochondrial fusion is characterized by the coordinated upregulation of MFN1, MFN2, and OPA1, which facilitates the simultaneous fusion of the OMM and IMM. However, our results indicate that matrix stiffness has little effect on MFN1 or MFN2 levels but significantly upregulates OPA1 expression. Furthermore, multiple studies have highlighted the importance of OPA1 in cancer.²²^,³⁹ We propose that in prostate cancer cells, where MFN1/2 are already highly expressed, OPA1 may act as the rate-limiting factor for fusion. Notably, it is essential to mention that key regulatory molecules of mitochondrial fusion in cancer cells may vary in their activation depending on the type of cancer and research perspective.²²^,²³^,²⁴^,⁴⁰ For instance, from the perspective of immune cell interactions, neutrophil extracellular traps have been shown to increase the expression of MFN2 in metastatic colorectal cancer, influencing mitochondrial behavior and promoting tumor growth.⁴⁰ This suggests that mitochondrial fusion is a context-dependent process shaped by the complex TME. To systematically decipher how mitochondrial dynamics are rewired in tumors, future studies should employ integrated models incorporating ECM components, immune cells, and vascular elements to better capture the dynamic crosstalk between tumors and their microenvironment.

Moreover, alterations in mitochondrial structure and function profoundly influence cellular metabolic behavior.⁴¹ The TCA cycle is the central metabolic pathway for mitochondrial energy production, and reprogramming of glutamine metabolism is a hallmark of malignant tumors.²⁵ Glutamine is converted into α-KG, which enters the TCA cycle, serving not only as a key energy source but also as a modulator of various cellular processes. Our data demonstrate that high matrix stiffness promotes glutamine metabolism. Previous studies have linked this metabolic reprogramming to the Hippo signaling pathway.⁴² We further found that this stiffness-induced metabolic shift is dependent on mitochondrial fusion and can be effectively suppressed by the OPA1 inhibitor MYLS22. Through RNA array screening, we identified that α-KG generated from glutamine metabolism can regulate the demethylases TET1 and TET3, thereby enhancing the transcription of downstream targets in the Hippo signaling pathway mediated by YAP. The TET family enzymes catalyze the oxidation of 5-methylcytosine to 5-hydroxymethylcytosine, promoting DNA demethylation—a mechanism increasingly recognized for its roles in cancer biology in recent years.⁴³ In both hematologic malignancies and solid tumors, TET family members have been implicated in tumorigenesis and progression.⁴⁴^,⁴⁵^,⁴⁶ For instance, TET2 can activate the cGAS-STING pathway in hepatocellular carcinoma, thereby modulating vascular remodeling and influencing the efficacy of anti-PD-L1 immunotherapy. Our findings demonstrate that TET1/3 activation enhances YAP transcriptional activity after its nuclear entry. However, it is plausible that TET enzymes broadly demethylate and activate transcription of genes in other signaling pathways as well—an area warranting further investigation. Importantly, the YAP-OPA1-TET1/3 loop we identified represents a form of bidirectional communication between mitochondria and the nucleus. In our review of critical mechanisms underlying chemoresistance, we noted that mitochondrial interactions with various organelles—such as the endoplasmic reticulum and lipid droplets—are closely associated with chemoresistance.⁴⁷^,⁴⁸^,⁴⁹ However, the link between mitochondrial-nuclear communication and chemoresistance remains poorly understood. Our work provides new insights into how mitochondrial-nuclear crosstalk contributes to cancer progression.

Within this YAP-OPA1-TET1/3 loop, mitochondrial fusion emerges as a central regulatory event. It not only safeguards mitochondrial function but also bridges metabolic reprogramming with Hippo pathway signaling. In other studies exploring mitochondrial-nuclear communication, mitochondrial regulation of metabolism has frequently been identified as a pivotal mechanism.⁵⁰^,⁵¹^,⁵²^,⁵³ These mechanisms include the mitochondrial unfolded protein response,⁵⁰ the Warburg effect,⁵¹ and epigenetic alterations,⁵² challenging the traditional notion that mitochondria are merely downstream effectors of nuclear signaling. Our data indicate that the upregulation of OPA1 under the regulation of YAP triggers mitochondrial fusion, which further enhances TET1/3 activity through glutamine metabolism reprogramming, thereby exacerbating the dysregulation of the Hippo signaling pathway. In other words, OPA1 is a critical component of the YAP-OPA1-TET1/3 loop, triggered by increased matrix stiffness, which plays a key role in nuclear-mitochondrial communication. Targeting OPA1 thus represents a promising strategy to disrupt this pathogenic cycle and overcome chemoresistance associated with high matrix stiffness. MYLS22, a selective inhibitor of OPA1, has previously been reported to suppress embryonic development and tumor angiogenesis.⁵⁴ Here, we investigated the role of MYLS22 in restoring the sensitivity of prostate cancer cells to taxane-based chemotherapy. Both in vitro and in vivo experiments yielded promising results. Nevertheless, further data and clinical trials are needed to establish its safety and efficacy in clinical settings. Additionally, targeting OPA1 may have broader applications in combating chemoresistance in other tumor types, which could be explored in future studies.

In conclusion, we have found that taxane chemoresistance in prostate cancer is associated with matrix stiffness, which may serve as a crucial target for overcoming chemoresistance. Mechanistically, high matrix stiffness activates a YAP-OPA1-TET1/3 signaling loop, establishing a positive feedback cycle between the nucleus and mitochondria that ultimately drives chemoresistance. The nucleus primarily promotes mitochondrial fusion by upregulating OPA1 transcription, thereby maintaining mitochondrial function, while mitochondria, through glutamine metabolism reprogramming, activate TET1/3 to enhance YAP’s transcriptional activity (Figure 9). In this study, we identified OPA1 as a key target for disrupting this mitochondrial-nuclear communication and demonstrated that targeting OPA1 to disrupt mitochondrial fusion can restore chemotherapy sensitivity.

Matrix stiffness triggers the YAP-OPA1-TET1/3 loop to drive chemoresistance via nuclear-mitochondrial communication

High matrix stiffness activates YAP, leading to dysregulation of the Hippo signaling pathway, which subsequently upregulates the expression of OPA1 and induces mitochondrial fusion. Furthermore, mitochondrial fusion is followed by a reprogramming of glutamine metabolic pathways. The metabolite α-KG generated from glutamine metabolism activates the DNA demethylases TET1 and TET3, resulting in epigenetic modifications of YAP downstream targets and further exacerbating Hippo pathway dysregulation. Thus, the YAP-OPA1-TET1/3 loop triggered by high matrix stiffness mediates a positive feedback loop in nuclear-mitochondrial communication, which, in turn, drives chemoresistance.

Limitations of the study

We acknowledge that there are certain limitations in this study. In the in vitro experiments, we used polyacrylamide hydrogels to simulate microenvironments with varying matrix stiffness. While this approach effectively mimics the mechanical properties of the TME, it may not fully replicate the complex biophysical and biochemical conditions present in vivo. Additionally, apart from the communication between mitochondria and the nucleus, the role of other organelles in chemotherapy resistance induced by matrix stiffness remains to be further explored. Furthermore, we targeted OPA1 to disrupt the YAP-OPA1-TET1/3 loop in order to restore chemotherapy sensitivity. However, targeting OPA1 as a therapeutic strategy may lead to unintended side effects, and further studies are needed to evaluate its safety and efficacy.

Resource availability

Lead contact

Requests for further information and resources should be directed to and will be fulfilled by the lead contact, Yupeng Guan (guanyp9@mail.sysu.edu.cn).

Materials availability

This study did not generate new unique materials.

Data and code availability

•
Data: The RNA-seq data are deposited on National Genomics Data Center (NGDC) database (NGDC accession number: OMIX012389).
•
Code: This paper does not report original code.
•
Any additional information required to re-analyze the data reported in this paper is available from the lead contact, Yupeng Guan (guanyp9@mail.sysu.edu.cn).

Acknowledgments

This work was supported by National Natural Science Foundation of China (grant no. 32400649), Guangdong Basic and Applied Basic Research Foundation (grant no. 2023A1515110507), Shenzhen Science and Technology Program (no. JCYJ20240813150301003), China Postdoctoral Science Foundation (grant no. 2023M744019), and Shenzhen Medical Research Fund (grant no. A2401005).

Author contributions

P.W., writing – original draft, investigation, conceptualization; S.W., writing – original draft, investigation; Z.H., investigation; H.Z., writing – original draft; Y.L., writing – review & editing; Z.L., writing – review & editing; J.W., methodology; Yani Chen, writing – original draft; Yujie Chen, methodology; Y.X., data curation; J.L., validation; Y.G., funding acquisition, conceptualization, and validation.

Declaration of interests

The authors have no conflicts of interest to declare.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies

COXIV Polyclonal antibody	proteintech	Cat#11242-1-AP
VDAC1/2 Polyclonal antibody	proteintech	Cat#10866-1-AP
GAPDH Polyclonal antibody	proteintech	Cat#10494-1-AP
YAP1 Polyclonal antibody	proteintech	Cat#13584-1-AP
YAP (Phospho-Ser127) Antibody	SAB	Cat#11952-1
ILK Polyclonal antibody	proteintech	Cat#12955-1-AP
OPA1 Polyclonal antibody	proteintech	Cat#32465-1-AP
TET1 antibody	SAB	Cat#38243-1
TET3 antibody	SAB	Cat#25532
Ki-67 Polyclonal antibody	proteintech	Cat#27309-1-AP
Fibronectin Polyclonal antibody	proteintech	Cat#15613-1-AP
Goat anti-Rabbit IgG (H+L) Secondary Antibody, Alexa Fluor™ 488	Invitrogen	Cat#A32731

Chemicals, peptides, and recombinant proteins

verteporfin	TargetMol	Cat#T3112
MYLS22	TargetMol	Cat#T9127
QLT0267	TargetMol	Cat#T84998
acrylamide	Sigma	Cat#A9099
bis-acrylamide	Sigma	Cat#A2792
HEPES	Sigma	Cat#H4034
Ammonium persulfate	Sangon Biotech	Cat#A500857
TEMED	Sigma	Cat#T9281
sulfosuccinimidyl 6-(4’-azido-2’-nitrophe-nylamino) hexanoate	Thermo Fisher	Cat#22589
Human Fibronectin	Sigma	Cat#F2006
Cell Counting Kit-8	Beyotime	Cat#C0038
MitoTracker^TM Red FM	Invitrogen	Cat#A66444
MitoTracker^TM Green FM	Invitrogen	Cat#A66441
Fluoroshield^TM with DAPI	Sigma	Cat#F6057

Deposited data

Transcriptomic Analysis of Chemoresistance in Prostate Cancer Cells under Different Stiffness Conditions	This paper	OMIX012389

Experimental models: Cell lines

PC3	Procell	Cat#CL-0304
DU145	Procell	Cat#CL-0075
LNCaP	Procell	Cat#CL-0143

Software and algorithms

ZEISS ZEN 3.9	Zeiss	N/A
ImageJ 1.54f	NIH	N/A
GraphPad Prism 10	GraphPad	N/A
R 4.4.2	CRAN	N/A
FlowJo 10.8.1	FlowJo	N/A

Open in a new tab

Experimental model and study participant details

Patients and samples

Six patients diagnosed with prostate cancer were enrolled from the Department of Urology, The Seventh Affiliated Hospital, Sun Yat-sen University. Clinical specimens were obtained via laparoscopic or da Vinci robotic-assisted radical prostatectomy. Histopathological examination confirmed three cases with a Gleason score of 7 and three cases with a Gleason score of 9. This study was reviewed and approved by the Medical Ethics Committee of The Seventh Affiliated Hospital, Sun Yat-sen University (Accreditation number: KY-2025-034-01). All patients provided written informed consent in accordance with the principles of the Declaration of Helsinki.

Cell culture

Prostate cancer cell lines PC3, DU145 and LNCaP were purchased from Procell. The cell culture media were RPMI 1640 (Gibco), respectively, supplemented with 10% fetal bovine serum (FBS; Gibco), 1% penicillin and streptomycin (Sigma). For experimental groups requiring α-ketoglutarate supplementation, the culture medium was further enriched with 2 mM dimethyl α-ketoglutarate (α-KG) (Sigma).

Preparation of polyacrylamide gels of different stiffness levels

Polyacrylamide hydrogel was obtained with 40% w/v acrylamide (Acr; Sigma) + 2% w/v bis-acrylamide (Bis; Sigma), adding the coagulant 10% ammonium persulfate (APS; Sangon Biotech) and tetramethylethylenediamine (TEMED; PHYGENE). Different stiffness was obtained by changing the final concentration of Acr/Bis, which expected stiffness of 10 and 100 kPa. Acr (40%), 2% Bis in a HEPES-buffered solution (pH=8), 10% APS (1/100 volume) and TEMED (1/100 volume) were mixed and polymerized to make 1 mm-thick uniform flat PAGE gels with different stiffness levels. Then, a gel was cut into squares that fit the size of culture dish. The coverslips were washed twice for 20 min each in PBS and 500 μL of heterobifunctional sulfosuccinimidyl 6-(4’-azido-2’-nitrophe-nylamino) hexanoate was added and photoactivated for 60 min with UV light. After being rinsed with a PBS solution, coated with 2 mL fibronectin (100 μg mL⁻¹), overnight at 37°C, UV disinfection for 1 h the next day, and rinsed before cells seeding.

Method details

Testing of tissue for mechanical properties

We used an AFM (BRUKER, Billerica, MA, USA) to detect the spatial variation of mechanical properties of prostate cancer samples at different developmental stages. Tissue sections were mounted on a cantilever holder and platform, immersed in PBS at 25°C. The interaction between the microcantilever tip and the sample caused a change in the position of the reflected light, leading to a deflection. The spring constant (kc) of each cantilever was measured using the thermal fluctuation method (the final value of kc ranged from 0.112 to 0.148 N/m, with an uncertainty of ∼0.002 N/m). Force spectroscopy analysis was performed at each point in a 64 × 16 grid over an area of 5 μm × 1.25 μm (∼80 nm pixel size).

RNA sequencing

Total RNA was extracted from cells using TRIzol reagent (Life Technologies) according to the manufacturer's protocol. The concentration and purity of RNA were measured using a NanoDrop spectrophotometer, and RNA integrity was assessed using an Agilent 2100 Bioanalyzer. Only samples with an A260/A280 ratio between 1.8-2.0 and an RNA Integrity Number (RIN) greater than 7.0 were used for downstream processing. RNA-seq libraries were constructed using the NEBNext Ultra II Directional RNA Library Prep Kit with the Ribo-off rRNA Depletion Kit (Vazyme) to remove ribosomal RNA. The constructed libraries were quantified by Qubit and validated for insert size distribution using an Agilent 2100 Bioanalyzer. The libraries were then sequenced on the BGISEQ-500 platform (BGI Co., Ltd., Shenzhen, China) to generate 100 bp paired-end reads. An average of 40 million raw reads per sample was obtained. The obtained sequencing data were further analyzed by R Language.

Differentially expressed genes (DEGs) analysis

The FindMarkers function was used to identify DEGs across the conditions, and the default Wilcoxon rank test was used. Genes were ranked by absolute log2 fold-change (log₂FC), and those with P-values > 0.05 (adjusted for multiple comparisons), min.pct <0.05, or log₂FC <0.1 were removed.

Enrichment analysis

Gene Ontology enrichment analysis of DEGs was implemented by the clusterProfiler R package. KEGG terms and GO terms with corrected P value less than 0.05 were considered significantly enriched by DEGs. ClusterProfiler R package was used to test the statistical enrichment of DEGs in KEGG pathways and GO pathways.

Animal study

The mouse experiments were carried out according to protocols approved by the Institutional Animal Care and Use Committee (IACUC), Sun Yat-sen University (Approval No. SYSU-IACUC-2025-000472). Mice were housed under specific pathogen-free (SPF) conditions at 23 ± 2°C ambient temperature with 40% humidity and a 12 h light/dark cycle (8 am on and 8 pm off).

In order to establish a syngeneic mouse prostate cancer model in male BALB/c mice, mice were randomly assigned subjects to three groups. PC3 or DU145 cells (5 × 10⁶ cells in 100 μL medium) were injected in the right hip of 5∼8-week-old male mice subcutaneously. According to different experimental requirements, the corresponding concentrations of compounds used were as follows: BAPN (100 mg kg^-1), PTX (15 mg kg⁻¹); MYLS22 (10 mg kg⁻¹).

Cell viability assay measured by CCK8

Cells were cultured in a 96-well plate. The medium was then replaced with a serum-free medium to induce starvation of the cells for 12 h, followed by treatment with various concentrations of PTX (0–80 μM) for 24 h. Cell viability was measured using the CCK-8 assay (Beyotime) according to the manufacturer's instructions.

5-Ethynyl-2′-deoxyuridine (EdU) assay

EdU assay was undertaken with BeyoClick™ EdU Cell Proliferation Kit (Beyotime). After washing in PBS, EdU solution was used to incubate cells for 2 h. Cell nuclei were then stained by DAPI solution. After washing, samples were observed with the Leica DMi8 inverted microscope.

Annexin V/PI flow cytometry analysis

Cells were harvested by centrifugation and then stained with Annexin V/PI (BioLegend) according to the manufacturer's instruction. The apoptotic population was immediately evaluated by flow cytometry (CytoFLEX). The percentages of apoptotic cells were analyzed and graphed.

Mitochondrial membrane potential (MMP) detection

The Mitochondrial membrane potential assay kit with JC-1 (Beyotime) was used to detect MMP. JC-1 staining working solution and JC-1 buffer were prepared according to the protocol, adding 1 mL to staining, and incubating at 37°C for 20 min. Three times washing with JC-1 buffer. The MMP was immediately evaluated by flow cytometry (CytoFLEX).

ROS

The levels of mitochondrial ROS were detected using Reactive Oxygen Species Assay Kit (Beyotime), and fluorescent intensity was measured by flow cytometry (Beckman). Data were analyzed by Flow Jo Software (Tree Star Inc., Ashland, Oregon).

Immunoblot analysis

Cells were washed twice with cold PBS and lysed in 1X RIPA buffer (Solarbio) with 30 min ice-bath and centrifuged at 13 000 g for 15 min at 4°C to remove cell debris. The total cell protein was located in the supernatant lysate. The total protein concentration was assessed by BCA Protein Assay Kit (Thermo Scientific). Equal amount of protein was resolved by SDS polyacrylamide gel electrophoresis (EpiZyme). Proteins were electrotransferred to a 0.45 μm pore-sized polyvinylidene difluoride membrane (PVDF; Millipore). The membranes were incubated with blocking buffer (5% skimmed milk in TBS-T buffer) for 1 h. After blocking, the target proteins were immunoblotted with specific antibodies. The protein signals were detected by the ChemiDoc imaging system (Bio-Rad). Bands from at least three independent experiments were quantified using ImageJ software.

Immunofluorescence staining (IF)

Samples were fixed in 4% PFA fix solution (Biosharp) for 15 min, and incubated with PBS containing 0.25% Triton X-100 ((Diamond) for 10 min at 4°C. Then the cells were blocked with 10% BSA for 30 min. Following blocking, the cells were incubated with primary antibodies overnight at 4°C. After washing, the cells were incubated with secondary antibodies for 60 min at 37°C and visualized under Zeiss 900 Laser Scanning Confocal Microscope with Airyscan (ZEISS).

Quantification of oxygen consumption

To analyze mitochondrial respiration, a Seahorse XF96 Analyzer (Seahorse Biosciences, USA) was used to measure OCR in the treated cells. The cells were transferred into a 96 well XF96 plate at a density of 5 × 10³ cells/well and incubated overnight. Cartridge plates for metabolic stress injections were hydrated for 24 h at 37°C without CO2 in calibrant solution. One hour prior to the assay, the medium in the XF96 plate was replaced by Seahorse Assay Media and the assay was performed according to the manufacture’s procedure. OCR was normalized by total cellular protein concentrations.

Immunohistochemical staining (IHC)

Sections of the paraffin-embedded tumor samples were kept at 60°C for 3 h in the oven and then followed by dewaxing with xylene and hydrating with an ethanol gradient (100–70%). After soaking in 3% H2O2 for 30 min, the slides were rinsed with PBS and incubated with the primary antibody overnight at 4°C. And then the slides were rinsed and incubated with the corresponding secondary antibody for 30 min followed by DAB and hematoxylin staining, respectively. The slides were then examined and photographed using an Olympus BX53 microscope. The DAB staining was analyzed by ImageJ software.

Masson’s trichrome staining

Trichrome staining was performed using the Sigma Trichrome Stain (Masson) Kit according to the manufacturer’s instructions. To quantitatively evaluate trichrome-stained fibers in each group, representative slides per mouse were chosen, and at least 6 pictures were taken by light microscopy from each slide; then, the percentages of stained area were calculated using Image J software.

SiriusRed staining

SiriusRed staining was performed using the Picro Sirius Red Stain Kit (abcam) according to the manufacturer’s instructions. To quantitatively evaluate postive collagenous fibers in each group, representative slides per mouse were chosen, and at least 6 pictures were taken by light microscopy from each slide; then, the percentages of stained area were calculated using Image J software.

MitoTracker staining

MitoTracker Red (Invitrogen) and MitoTracker Green (Invitrogen) were used to label mitochondria. PC3, DU145 or LNCaP cells were incubated with 200 nM MitoTracker Red or MitoTracker Green in culture media for 30 min at 37°C. Excess of the dye was washed out with cell culture media. After washing, the cells were visualized under Zeiss 900 Laser Scanning Confocal Microscope with Airyscan (ZEISS).

Transmission electron microscopy

Cells were fixed with 2% paraformaldehyde and 2.5% glutaraldehyde in PBS at 4°C for 24 h, and then washed with PBS three times at room temperature for 15 min each time. After washing, the samples were post-fixed with 1% osmium acid and 1.5% potassium ferricyanide for 1 h and rinsed with ultrapure water three times for 15 min each time. Samples were stained with 1% uranyl acetate overnight, followed by washing with ultra-pure water three times for 15 min each time. Stained cells were dehydrated in an ice box through a series of ethanol and propylene oxide baths, followed by infiltration with EMbed-812 resin and embedding at 60°C. Thin sections on grids were observed in a Tecnai 12 BioTwin transmission electron microscope (FEI) at 80 kV. For analysis, the length and area of each mitochondrion were determined in ImageJ following a manual drawing of single organelles.

Measurement of ATP content

To measure the release of ATP, the supernatant from each group was collected. ATP was quantified using an ATP assay kit (Beyotime) according to the manufacturer's protocols on a microplate reader (Biotek SynergyH1).

RNA isolation and quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from cells using TRIzol reagent (Life Technologies) according to the manufacturer's protocol. Quantification was performed on a NanoDrop 8000 spectrophotometer (Thermo scientific), and 500 ng of total RNA per sample was reverse transcribed into complementary DNA (cDNA) using PrimeScript RT reagent Kit (Takara). cDNA was amplified using SYBR kits (Takara) on Bio-rad CFX96 Touch Real-Time PCR System. All samples were run in duplicate, and the results were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a relative mRNA level.

Transfections

The small interfering RNAs (siRNAs) for YAP and OPA1 were synthesized by GenePharma (GenePharma, Shanghai, China). The sense sequence of siRNA against YAP is GGUCAGAGAUACUUCUUAAAU, and the antisense sequence is UUAAGAAGUAUCUCUGACCAG. The sense sequence of siRNA against OPA1 is GGACCUUAGUGAAUAUAAAUG, and the antisense sequence is UUUAUAUUCACUAAGGUCCGG.The day before transfection, the medium was changed to complete medium without penicillin and streptomycin. When cells reached 80% confluence, 10 nM siRNA was diluted in RPMI 1640 (Gibco), and transfected into cells with RNAiMAX (Thermo Fisher Scientific). Cells were used for subsequent experiments after 48 h of transfection, and the transfection efficiency was assessed by western blotting.

Glutamine assay

The glutamine level was measured from the medium using a glutamine enzyme immunoassay (EIA) kit (TW-REAGENT). Cells were cultured in the same volume of normal medium containing 2 mM glutamine. The uptake of glutamine by cells was inversely proportional to the concentration of glutamine in the medium. The supernatant was collected by centrifugation at 1000 g for 5 min, and the enzyme-linked immunosorbent assay was performed according to the manufacturer's instructions. The optical density (OD) was measured with a plate reader (Varioskan Flash Multimode Reader, Thermo Fisher Scientific), and the glutamine level was normalized to cell number.

GLS activity assay

The glutaminase activity of cells was measured using the glutaminase (GLS) activity assay kit (Solarbio) according the manufacturer's instructions. Cells cultured on gels were digested and sonicated at 32% power for 3 min (3 s per time, 7 s per interval) in an ice bath. Extracts were centrifuged at 12000 g for 15 min at 4°C, and the supernatants were combined to the reaction solution. The absorbance at 630 nm was recorded for each sample against a water blank, and the enzyme activity was calculated. Glutaminase activity was normalized to cell number.

5-methylcytosine and 5-hydroxymethylcytosine global level quantification

Genomic DNA extraction from cells. 5mC and 5hmC global levels were evaluated using the ELISA-based MethylFlash Methylated DNA Quantification Colorimetric Kit (Epigentek) and the MethylFlash Hydroxymethylated DNA Quantification Colorimetric Kit (Epigentek) respectively.

Quantification and statistical analysis

All data are presented as the mean ± SD from at least three independent experiments. The sample size (n) for each experiment, indicating the number of biological replicates, is provided in the corresponding figure legend. All statistical analyses were conducted using GraphPad Prism software (version 10). Statistical comparisons between two groups were performed using unpaired two-tailed Student’s t-test. For comparisons among multiple groups, one-way analysis of variance (ANOVA) was applied, followed by Tukey’s post hoc test for multiple comparisons. A two-sided P-value of less than 0.05 was considered statistically significant. Significance levels were defined as P < 0.05 (∗), P < 0.01 (∗∗), P < 0.001 (∗∗∗). Detailed statistical results, including the exact n values, statistical tests used, and measures of center and dispersion, are reported in the figure legends.

Published: November 10, 2025

Footnotes

Supplemental information can be found online at https://doi.org/10.1016/j.isci.2025.113996.

Contributor Information

Yuandong Xu, Email: xuyuandong@sysush.com.

Jun Li, Email: lijun273@mail.sysu.edu.cn.

Yupeng Guan, Email: guanyp9@mail.sysu.edu.cn.

Supplemental information

Document S1. Figures S1–S8

mmc1.pdf^{(1.8MB, pdf)}

References

1.Sung H., Ferlay J., Siegel R.L., Laversanne M., Soerjomataram I., Jemal A., Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021;71:209–249. doi: 10.3322/caac.21660. [DOI] [PubMed] [Google Scholar]
2.Shafi A.A., Yen A.E., Weigel N.L. Androgen receptors in hormone-dependent and castration-resistant prostate cancer. Pharmacol. Ther. 2013;140:223–238. doi: 10.1016/j.pharmthera.2013.07.003. [DOI] [PubMed] [Google Scholar]
3.Graham T.R., Zhau H.E., Odero-Marah V.A., Osunkoya A.O., Kimbro K.S., Tighiouart M., Liu T., Simons J.W., O'Regan R.M. Insulin-like growth factor-I-dependent up-regulation of ZEB1 drives epithelial-to-mesenchymal transition in human prostate cancer cells. Cancer Res. 2008;68:2479–2488. doi: 10.1158/0008-5472.Can-07-2559. [DOI] [PubMed] [Google Scholar]
4.Shalapour S., Font-Burgada J., Di Caro G., Zhong Z., Sanchez-Lopez E., Dhar D., Willimsky G., Ammirante M., Strasner A., Hansel D.E., et al. Immunosuppressive plasma cells impede T-cell-dependent immunogenic chemotherapy. Nature. 2015;521:94–98. doi: 10.1038/nature14395. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Gu Q., He Y., Ji J., Yao Y., Shen W., Luo J., Zhu W., Cao H., Geng Y., Xu J., et al. Hypoxia-inducible factor 1α (HIF-1α) and reactive oxygen species (ROS) mediates radiation-induced invasiveness through the SDF-1α/CXCR4 pathway in non-small cell lung carcinoma cells. Oncotarget. 2015;6:10893–10907. doi: 10.18632/oncotarget.3535. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Chaudhuri O., Cooper-White J., Janmey P.A., Mooney D.J., Shenoy V.B. Effects of extracellular matrix viscoelasticity on cellular behaviour. Nature. 2020;584:535–546. doi: 10.1038/s41586-020-2612-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Cox T.R. The matrix in cancer. Nat. Rev. Cancer. 2021;21:217–238. doi: 10.1038/s41568-020-00329-7. [DOI] [PubMed] [Google Scholar]
8.Jiang Y., Zhang H., Wang J., Liu Y., Luo T., Hua H. Targeting extracellular matrix stiffness and mechanotransducers to improve cancer therapy. J. Hematol. Oncol. 2022;15:34. doi: 10.1186/s13045-022-01252-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Chen Y., Li P., Chen X., Yan R., Zhang Y., Wang M., Qin X., Li S., Zheng C., You F., et al. Endoplasmic reticulum-mitochondrial calcium transport contributes to soft extracellular matrix-triggered mitochondrial dynamics and mitophagy in breast carcinoma cells. Acta Biomater. 2023;169:192–208. doi: 10.1016/j.actbio.2023.07.060. [DOI] [PubMed] [Google Scholar]
10.Na J., Yang Z., Shi Q., Li C., Liu Y., Song Y., Li X., Zheng L., Fan Y. Extracellular matrix stiffness as an energy metabolism regulator drives osteogenic differentiation in mesenchymal stem cells. Bioact. Mater. 2024;35:549–563. doi: 10.1016/j.bioactmat.2024.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Romani P., Nirchio N., Arboit M., Barbieri V., Tosi A., Michielin F., Shibuya S., Benoist T., Wu D., Hindmarch C.C.T., et al. Mitochondrial fission links ECM mechanotransduction to metabolic redox homeostasis and metastatic chemotherapy resistance. Nat. Cell Biol. 2022;24:168–180. doi: 10.1038/s41556-022-00843-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Chen S., He T., Zhong Y., Chen M., Yao Q., Chen D., Shao Z., Xiao G. Roles of focal adhesion proteins in skeleton and diseases. Acta Pharm. Sin. B. 2023;13:998–1013. doi: 10.1016/j.apsb.2022.09.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Serrano I., McDonald P.C., Lock F., Muller W.J., Dedhar S. Inactivation of the Hippo tumour suppressor pathway by integrin-linked kinase. Nat. Commun. 2013;4 doi: 10.1038/ncomms3976. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Dupont S., Morsut L., Aragona M., Enzo E., Giulitti S., Cordenonsi M., Zanconato F., Le Digabel J., Forcato M., Bicciato S., et al. Role of YAP/TAZ in mechanotransduction. Nature. 2011;474:179–183. doi: 10.1038/nature10137. [DOI] [PubMed] [Google Scholar]
15.Moya I.M., Halder G. Hippo–YAP/TAZ signalling in organ regeneration and regenerative medicine. Nat. Rev. Mol. Cell Biol. 2019;20:211–226. doi: 10.1038/s41580-018-0086-y. [DOI] [PubMed] [Google Scholar]
16.Kim M., Hwang S., Kim B., Shin S., Yang S., Gwak J., Jeong S.M. YAP governs cellular adaptation to perturbation of glutamine metabolism by regulating ATF4-mediated stress response. Oncogene. 2023;42:2828–2840. doi: 10.1038/s41388-023-02811-6. [DOI] [PubMed] [Google Scholar]
17.Lv L., Zhou X. Targeting Hippo signaling in cancer: novel perspectives and therapeutic potential. MedComm. 2023;4 doi: 10.1002/mco2.375. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Ryu K.W., Fung T.S., Baker D.C., Saoi M., Park J., Febres-Aldana C.A., Aly R.G., Cui R., Sharma A., Fu Y., et al. Cellular ATP demand creates metabolically distinct subpopulations of mitochondria. Nature. 2024;635:746–754. doi: 10.1038/s41586-024-08146-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Qi M., Dai D., Liu J., Li Z., Liang P., Wang Y., Cheng L., Zhan Y., An Z., Song Y., et al. AIM2 promotes the development of non-small cell lung cancer by modulating mitochondrial dynamics. Oncogene. 2020;39:2707–2723. doi: 10.1038/s41388-020-1176-9. [DOI] [PubMed] [Google Scholar]
20.Lightowlers R.N., Taylor R.W., Turnbull D.M. Mutations causing mitochondrial disease: What is new and what challenges remain? Science. 2015;349:1494–1499. doi: 10.1126/science.aac7516. [DOI] [PubMed] [Google Scholar]
21.Pernas L., Scorrano L. Mito-Morphosis: Mitochondrial Fusion, Fission, and Cristae Remodeling as Key Mediators of Cellular Function. Annu. Rev. Physiol. 2016;78:505–531. doi: 10.1146/annurev-physiol-021115-105011. [DOI] [PubMed] [Google Scholar]
22.Zamberlan M., Boeckx A., Muller F., Vinelli F., Ek O., Vianello C., Coart E., Shibata K., Christian A., Grespi F., et al. Inhibition of the mitochondrial protein Opa1 curtails breast cancer growth. J. Exp. Clin. Cancer Res. 2022;41:95. doi: 10.1186/s13046-022-02304-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Li S., Han S., Zhang Q., Zhu Y., Zhang H., Wang J., Zhao Y., Zhao J., Su L., Li L., et al. FUNDC2 promotes liver tumorigenesis by inhibiting MFN1-mediated mitochondrial fusion. Nat. Commun. 2022;13:3486. doi: 10.1038/s41467-022-31187-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Luo L., Wei D., Pan Y., Wang Q.X., Feng J.X., Yu B., Kang T., Luo J., Yang J., Gao S. MFN2 suppresses clear cell renal cell carcinoma progression by modulating mitochondria-dependent dephosphorylation of EGFR. Cancer Commun. 2023;43:808–833. doi: 10.1002/cac2.12428. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Cluntun A.A., Lukey M.J., Cerione R.A., Locasale J.W. Glutamine Metabolism in Cancer: Understanding the Heterogeneity. Trends Cancer. 2017;3:169–180. doi: 10.1016/j.trecan.2017.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Ma G., Zhang Z., Li P., Zhang Z., Zeng M., Liang Z., Li D., Wang L., Chen Y., Liang Y., Niu H. Reprogramming of glutamine metabolism and its impact on immune response in the tumor microenvironment. Cell Commun. Signal. 2022;20:114. doi: 10.1186/s12964-022-00909-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Mosca L., Ilari A., Fazi F., Assaraf Y.G., Colotti G. Taxanes in cancer treatment: Activity, chemoresistance and its overcoming. Drug Resist. Updat. 2021;54 doi: 10.1016/j.drup.2020.100742. [DOI] [PubMed] [Google Scholar]
28.Guo P., Wan S., Guan K.L. The Hippo pathway: Organ size control and beyond. Pharmacol. Rev. 2025;77 doi: 10.1016/j.pharmr.2024.100031. [DOI] [PubMed] [Google Scholar]
29.Zheng Y., Zhou R., Cai J., Yang N., Wen Z., Zhang Z., Sun H., Huang G., Guan Y., Huang N., et al. Matrix Stiffness Triggers Lipid Metabolic Cross-talk between Tumor and Stromal Cells to Mediate Bevacizumab Resistance in Colorectal Cancer Liver Metastases. Cancer Res. 2023;83:3577–3592. doi: 10.1158/0008-5472.Can-23-0025. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Bergengren O., Pekala K.R., Matsoukas K., Fainberg J., Mungovan S.F., Bratt O., Bray F., Brawley O., Luckenbaugh A.N., Mucci L., et al. 2022 Update on Prostate Cancer Epidemiology and Risk Factors-A Systematic Review. Eur. Urol. 2023;84:191–206. doi: 10.1016/j.eururo.2023.04.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Junttila M.R., de Sauvage F.J. Influence of tumour micro-environment heterogeneity on therapeutic response. Nature. 2013;501:346–354. doi: 10.1038/nature12626. [DOI] [PubMed] [Google Scholar]
32.Dzobo K., Dandara C. The Extracellular Matrix: Its Composition, Function, Remodeling, and Role in Tumorigenesis. Biomimetics. 2023;8 doi: 10.3390/biomimetics8020146. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Wu W., Ziemann M., Huynh K., She G., Pang Z.D., Zhang Y., Duong T., Kiriazis H., Pu T.T., Bai R.Y., et al. Activation of Hippo signaling pathway mediates mitochondria dysfunction and dilated cardiomyopathy in mice. Theranostics. 2021;11:8993–9008. doi: 10.7150/thno.62302. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Ye S., Zhang M., Zheng X., Li S., Fan Y., Wang Y., Peng H., Chen S., Yang J., Tan L., et al. YAP1 preserves tubular mitochondrial quality control to mitigate diabetic kidney disease. Redox Biol. 2024;78 doi: 10.1016/j.redox.2024.103435. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Zhao Y., Chen Y., Guo C., Li P., Cheng Z., Zheng L., Sha B., Xu H., Su X., Wang Y. Chronic stress dysregulates the Hippo/YAP/14-3-3η pathway and induces mitochondrial damage in basolateral amygdala in a mouse model of depression. Theranostics. 2024;14:3653–3673. doi: 10.7150/thno.92676. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Jin P., Jiang J., Zhou L., Huang Z., Nice E.C., Huang C., Fu L. Mitochondrial adaptation in cancer drug resistance: prevalence, mechanisms, and management. J. Hematol. Oncol. 2022;15:97. doi: 10.1186/s13045-022-01313-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Gao S., Hu J. Mitochondrial Fusion: The Machineries In and Out. Trends Cell Biol. 2021;31:62–74. doi: 10.1016/j.tcb.2020.09.008. [DOI] [PubMed] [Google Scholar]
38.Quintana-Cabrera R., Scorrano L. Determinants and outcomes of mitochondrial dynamics. Mol. Cell. 2023;83:857–876. doi: 10.1016/j.molcel.2023.02.012. [DOI] [PubMed] [Google Scholar]
39.Liang F.G., Zandkarimi F., Lee J., Axelrod J.L., Pekson R., Yoon Y., Stockwell B.R., Kitsis R.N. OPA1 promotes ferroptosis by augmenting mitochondrial ROS and suppressing an integrated stress response. Mol. Cell. 2024;84:3098–3114.e6. doi: 10.1016/j.molcel.2024.07.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Yazdani H.O., Roy E., Comerci A.J., van der Windt D.J., Zhang H., Huang H., Loughran P., Shiva S., Geller D.A., Bartlett D.L., et al. Neutrophil Extracellular Traps Drive Mitochondrial Homeostasis in Tumors to Augment Growth. Cancer Res. 2019;79:5626–5639. doi: 10.1158/0008-5472.Can-19-0800. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Wai T., Langer T. Mitochondrial Dynamics and Metabolic Regulation. Trends Endocrinol. Metab. 2016;27:105–117. doi: 10.1016/j.tem.2015.12.001. [DOI] [PubMed] [Google Scholar]
42.Zhang X., Zhao H., Li Y., Xia D., Yang L., Ma Y., Li H. The role of YAP/TAZ activity in cancer metabolic reprogramming. Mol. Cancer. 2018;17:134. doi: 10.1186/s12943-018-0882-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.López-Moyado I.F., Ko M., Hogan P.G., Rao A. TET Enzymes in the Immune System: From DNA Demethylation to Immunotherapy, Inflammation, and Cancer. Annu. Rev. Immunol. 2024;42:455–488. doi: 10.1146/annurev-immunol-080223-044610. [DOI] [PubMed] [Google Scholar]
44.Li Z., Cai X., Cai C.L., Wang J., Zhang W., Petersen B.E., Yang F.C., Xu M. Deletion of Tet2 in mice leads to dysregulated hematopoietic stem cells and subsequent development of myeloid malignancies. Blood. 2011;118:4509–4518. doi: 10.1182/blood-2010-12-325241. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Lv H., Zong Q., Chen C., Lv G., Xiang W., Xing F., Jiang G., Yan B., Sun X., Ma Y., et al. TET2-mediated tumor cGAS triggers endothelial STING activation to regulate vasculature remodeling and anti-tumor immunity in liver cancer. Nat. Commun. 2024;15:6. doi: 10.1038/s41467-023-43743-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Deng M., Zhang R., He Z., Qiu Q., Lu X., Yin J., Liu H., Jia X., He Z. TET-Mediated Sequestration of miR-26 Drives EZH2 Expression and Gastric Carcinogenesis. Cancer Res. 2017;77:6069–6082. doi: 10.1158/0008-5472.Can-16-2964. [DOI] [PubMed] [Google Scholar]
47.Wu H., Chen W., Chen Z., Li X., Wang M. Novel tumor therapy strategies targeting endoplasmic reticulum-mitochondria signal pathways. Ageing Res. Rev. 2023;88 doi: 10.1016/j.arr.2023.101951. [DOI] [PubMed] [Google Scholar]
48.You J.H., Lee J., Roh J.L. PGRMC1-dependent lipophagy promotes ferroptosis in paclitaxel-tolerant persister cancer cells. J. Exp. Clin. Cancer Res. 2021;40:350. doi: 10.1186/s13046-021-02168-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Zhang H., Wang S., Wu P., Hu Z., Chen Y., Guan Y., Pang J. Revealing the landscape of targeting mitochondrial functions and behaviors to overcome cancer chemoresistance. J. Natl. Cancer Cent. 2025;5:453–473. doi: 10.1016/j.jncc.2025.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Ying Z., Xin Y., Liu Z., Tan T., Huang Y., Ding Y., Hong X., Li Q., Li C., Guo J., et al. The mitochondrial unfolded protein response inhibits pluripotency acquisition and mesenchymal-to-epithelial transition in somatic cell reprogramming. Nat. Metab. 2025;7:940–951. doi: 10.1038/s42255-025-01261-6. [DOI] [PubMed] [Google Scholar]
51.Jiang H., Ye J. The Warburg effect: The hacked mitochondrial-nuclear communication in cancer. Semin. Cancer Biol. 2025;112:93–111. doi: 10.1016/j.semcancer.2025.03.006. [DOI] [PubMed] [Google Scholar]
52.Zhu D., Li X., Tian Y. Mitochondrial-to-nuclear communication in aging: an epigenetic perspective. Trends Biochem. Sci. 2022;47:645–659. doi: 10.1016/j.tibs.2022.03.008. [DOI] [PubMed] [Google Scholar]
53.Gao F., Liang T., Lu Y.W., Fu X., Dong X., Pu L., Hong T., Zhou Y., Zhang Y., Liu N., et al. A defect in mitochondrial protein translation influences mitonuclear communication in the heart. Nat. Commun. 2023;14:1595. doi: 10.1038/s41467-023-37291-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Herkenne S., Ek O., Zamberlan M., Pellattiero A., Chergova M., Chivite I., Novotná E., Rigoni G., Fonseca T.B., Samardzic D., et al. Developmental and Tumor Angiogenesis Requires the Mitochondria-Shaping Protein Opa1. Cell Metab. 2020;31:987–1003.e8. doi: 10.1016/j.cmet.2020.04.007. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Document S1. Figures S1–S8

mmc1.pdf^{(1.8MB, pdf)}

Data Availability Statement

•
Data: The RNA-seq data are deposited on National Genomics Data Center (NGDC) database (NGDC accession number: OMIX012389).
•
Code: This paper does not report original code.
•
Any additional information required to re-analyze the data reported in this paper is available from the lead contact, Yupeng Guan (guanyp9@mail.sysu.edu.cn).

[bib1] 1.Sung H., Ferlay J., Siegel R.L., Laversanne M., Soerjomataram I., Jemal A., Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021;71:209–249. doi: 10.3322/caac.21660. [DOI] [PubMed] [Google Scholar]

[bib2] 2.Shafi A.A., Yen A.E., Weigel N.L. Androgen receptors in hormone-dependent and castration-resistant prostate cancer. Pharmacol. Ther. 2013;140:223–238. doi: 10.1016/j.pharmthera.2013.07.003. [DOI] [PubMed] [Google Scholar]

[bib3] 3.Graham T.R., Zhau H.E., Odero-Marah V.A., Osunkoya A.O., Kimbro K.S., Tighiouart M., Liu T., Simons J.W., O'Regan R.M. Insulin-like growth factor-I-dependent up-regulation of ZEB1 drives epithelial-to-mesenchymal transition in human prostate cancer cells. Cancer Res. 2008;68:2479–2488. doi: 10.1158/0008-5472.Can-07-2559. [DOI] [PubMed] [Google Scholar]

[bib4] 4.Shalapour S., Font-Burgada J., Di Caro G., Zhong Z., Sanchez-Lopez E., Dhar D., Willimsky G., Ammirante M., Strasner A., Hansel D.E., et al. Immunosuppressive plasma cells impede T-cell-dependent immunogenic chemotherapy. Nature. 2015;521:94–98. doi: 10.1038/nature14395. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib5] 5.Gu Q., He Y., Ji J., Yao Y., Shen W., Luo J., Zhu W., Cao H., Geng Y., Xu J., et al. Hypoxia-inducible factor 1α (HIF-1α) and reactive oxygen species (ROS) mediates radiation-induced invasiveness through the SDF-1α/CXCR4 pathway in non-small cell lung carcinoma cells. Oncotarget. 2015;6:10893–10907. doi: 10.18632/oncotarget.3535. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib6] 6.Chaudhuri O., Cooper-White J., Janmey P.A., Mooney D.J., Shenoy V.B. Effects of extracellular matrix viscoelasticity on cellular behaviour. Nature. 2020;584:535–546. doi: 10.1038/s41586-020-2612-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib7] 7.Cox T.R. The matrix in cancer. Nat. Rev. Cancer. 2021;21:217–238. doi: 10.1038/s41568-020-00329-7. [DOI] [PubMed] [Google Scholar]

[bib8] 8.Jiang Y., Zhang H., Wang J., Liu Y., Luo T., Hua H. Targeting extracellular matrix stiffness and mechanotransducers to improve cancer therapy. J. Hematol. Oncol. 2022;15:34. doi: 10.1186/s13045-022-01252-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib9] 9.Chen Y., Li P., Chen X., Yan R., Zhang Y., Wang M., Qin X., Li S., Zheng C., You F., et al. Endoplasmic reticulum-mitochondrial calcium transport contributes to soft extracellular matrix-triggered mitochondrial dynamics and mitophagy in breast carcinoma cells. Acta Biomater. 2023;169:192–208. doi: 10.1016/j.actbio.2023.07.060. [DOI] [PubMed] [Google Scholar]

[bib10] 10.Na J., Yang Z., Shi Q., Li C., Liu Y., Song Y., Li X., Zheng L., Fan Y. Extracellular matrix stiffness as an energy metabolism regulator drives osteogenic differentiation in mesenchymal stem cells. Bioact. Mater. 2024;35:549–563. doi: 10.1016/j.bioactmat.2024.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib11] 11.Romani P., Nirchio N., Arboit M., Barbieri V., Tosi A., Michielin F., Shibuya S., Benoist T., Wu D., Hindmarch C.C.T., et al. Mitochondrial fission links ECM mechanotransduction to metabolic redox homeostasis and metastatic chemotherapy resistance. Nat. Cell Biol. 2022;24:168–180. doi: 10.1038/s41556-022-00843-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib12] 12.Chen S., He T., Zhong Y., Chen M., Yao Q., Chen D., Shao Z., Xiao G. Roles of focal adhesion proteins in skeleton and diseases. Acta Pharm. Sin. B. 2023;13:998–1013. doi: 10.1016/j.apsb.2022.09.020. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib13] 13.Serrano I., McDonald P.C., Lock F., Muller W.J., Dedhar S. Inactivation of the Hippo tumour suppressor pathway by integrin-linked kinase. Nat. Commun. 2013;4 doi: 10.1038/ncomms3976. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib14] 14.Dupont S., Morsut L., Aragona M., Enzo E., Giulitti S., Cordenonsi M., Zanconato F., Le Digabel J., Forcato M., Bicciato S., et al. Role of YAP/TAZ in mechanotransduction. Nature. 2011;474:179–183. doi: 10.1038/nature10137. [DOI] [PubMed] [Google Scholar]

[bib15] 15.Moya I.M., Halder G. Hippo–YAP/TAZ signalling in organ regeneration and regenerative medicine. Nat. Rev. Mol. Cell Biol. 2019;20:211–226. doi: 10.1038/s41580-018-0086-y. [DOI] [PubMed] [Google Scholar]

[bib16] 16.Kim M., Hwang S., Kim B., Shin S., Yang S., Gwak J., Jeong S.M. YAP governs cellular adaptation to perturbation of glutamine metabolism by regulating ATF4-mediated stress response. Oncogene. 2023;42:2828–2840. doi: 10.1038/s41388-023-02811-6. [DOI] [PubMed] [Google Scholar]

[bib17] 17.Lv L., Zhou X. Targeting Hippo signaling in cancer: novel perspectives and therapeutic potential. MedComm. 2023;4 doi: 10.1002/mco2.375. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib18] 18.Ryu K.W., Fung T.S., Baker D.C., Saoi M., Park J., Febres-Aldana C.A., Aly R.G., Cui R., Sharma A., Fu Y., et al. Cellular ATP demand creates metabolically distinct subpopulations of mitochondria. Nature. 2024;635:746–754. doi: 10.1038/s41586-024-08146-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib19] 19.Qi M., Dai D., Liu J., Li Z., Liang P., Wang Y., Cheng L., Zhan Y., An Z., Song Y., et al. AIM2 promotes the development of non-small cell lung cancer by modulating mitochondrial dynamics. Oncogene. 2020;39:2707–2723. doi: 10.1038/s41388-020-1176-9. [DOI] [PubMed] [Google Scholar]

[bib20] 20.Lightowlers R.N., Taylor R.W., Turnbull D.M. Mutations causing mitochondrial disease: What is new and what challenges remain? Science. 2015;349:1494–1499. doi: 10.1126/science.aac7516. [DOI] [PubMed] [Google Scholar]

[bib21] 21.Pernas L., Scorrano L. Mito-Morphosis: Mitochondrial Fusion, Fission, and Cristae Remodeling as Key Mediators of Cellular Function. Annu. Rev. Physiol. 2016;78:505–531. doi: 10.1146/annurev-physiol-021115-105011. [DOI] [PubMed] [Google Scholar]

[bib22] 22.Zamberlan M., Boeckx A., Muller F., Vinelli F., Ek O., Vianello C., Coart E., Shibata K., Christian A., Grespi F., et al. Inhibition of the mitochondrial protein Opa1 curtails breast cancer growth. J. Exp. Clin. Cancer Res. 2022;41:95. doi: 10.1186/s13046-022-02304-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib23] 23.Li S., Han S., Zhang Q., Zhu Y., Zhang H., Wang J., Zhao Y., Zhao J., Su L., Li L., et al. FUNDC2 promotes liver tumorigenesis by inhibiting MFN1-mediated mitochondrial fusion. Nat. Commun. 2022;13:3486. doi: 10.1038/s41467-022-31187-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib24] 24.Luo L., Wei D., Pan Y., Wang Q.X., Feng J.X., Yu B., Kang T., Luo J., Yang J., Gao S. MFN2 suppresses clear cell renal cell carcinoma progression by modulating mitochondria-dependent dephosphorylation of EGFR. Cancer Commun. 2023;43:808–833. doi: 10.1002/cac2.12428. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib25] 25.Cluntun A.A., Lukey M.J., Cerione R.A., Locasale J.W. Glutamine Metabolism in Cancer: Understanding the Heterogeneity. Trends Cancer. 2017;3:169–180. doi: 10.1016/j.trecan.2017.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib26] 26.Ma G., Zhang Z., Li P., Zhang Z., Zeng M., Liang Z., Li D., Wang L., Chen Y., Liang Y., Niu H. Reprogramming of glutamine metabolism and its impact on immune response in the tumor microenvironment. Cell Commun. Signal. 2022;20:114. doi: 10.1186/s12964-022-00909-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib27] 27.Mosca L., Ilari A., Fazi F., Assaraf Y.G., Colotti G. Taxanes in cancer treatment: Activity, chemoresistance and its overcoming. Drug Resist. Updat. 2021;54 doi: 10.1016/j.drup.2020.100742. [DOI] [PubMed] [Google Scholar]

[bib28] 28.Guo P., Wan S., Guan K.L. The Hippo pathway: Organ size control and beyond. Pharmacol. Rev. 2025;77 doi: 10.1016/j.pharmr.2024.100031. [DOI] [PubMed] [Google Scholar]

[bib29] 29.Zheng Y., Zhou R., Cai J., Yang N., Wen Z., Zhang Z., Sun H., Huang G., Guan Y., Huang N., et al. Matrix Stiffness Triggers Lipid Metabolic Cross-talk between Tumor and Stromal Cells to Mediate Bevacizumab Resistance in Colorectal Cancer Liver Metastases. Cancer Res. 2023;83:3577–3592. doi: 10.1158/0008-5472.Can-23-0025. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib30] 30.Bergengren O., Pekala K.R., Matsoukas K., Fainberg J., Mungovan S.F., Bratt O., Bray F., Brawley O., Luckenbaugh A.N., Mucci L., et al. 2022 Update on Prostate Cancer Epidemiology and Risk Factors-A Systematic Review. Eur. Urol. 2023;84:191–206. doi: 10.1016/j.eururo.2023.04.021. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib31] 31.Junttila M.R., de Sauvage F.J. Influence of tumour micro-environment heterogeneity on therapeutic response. Nature. 2013;501:346–354. doi: 10.1038/nature12626. [DOI] [PubMed] [Google Scholar]

[bib32] 32.Dzobo K., Dandara C. The Extracellular Matrix: Its Composition, Function, Remodeling, and Role in Tumorigenesis. Biomimetics. 2023;8 doi: 10.3390/biomimetics8020146. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib33] 33.Wu W., Ziemann M., Huynh K., She G., Pang Z.D., Zhang Y., Duong T., Kiriazis H., Pu T.T., Bai R.Y., et al. Activation of Hippo signaling pathway mediates mitochondria dysfunction and dilated cardiomyopathy in mice. Theranostics. 2021;11:8993–9008. doi: 10.7150/thno.62302. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib34] 34.Ye S., Zhang M., Zheng X., Li S., Fan Y., Wang Y., Peng H., Chen S., Yang J., Tan L., et al. YAP1 preserves tubular mitochondrial quality control to mitigate diabetic kidney disease. Redox Biol. 2024;78 doi: 10.1016/j.redox.2024.103435. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib35] 35.Zhao Y., Chen Y., Guo C., Li P., Cheng Z., Zheng L., Sha B., Xu H., Su X., Wang Y. Chronic stress dysregulates the Hippo/YAP/14-3-3η pathway and induces mitochondrial damage in basolateral amygdala in a mouse model of depression. Theranostics. 2024;14:3653–3673. doi: 10.7150/thno.92676. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib36] 36.Jin P., Jiang J., Zhou L., Huang Z., Nice E.C., Huang C., Fu L. Mitochondrial adaptation in cancer drug resistance: prevalence, mechanisms, and management. J. Hematol. Oncol. 2022;15:97. doi: 10.1186/s13045-022-01313-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib37] 37.Gao S., Hu J. Mitochondrial Fusion: The Machineries In and Out. Trends Cell Biol. 2021;31:62–74. doi: 10.1016/j.tcb.2020.09.008. [DOI] [PubMed] [Google Scholar]

[bib38] 38.Quintana-Cabrera R., Scorrano L. Determinants and outcomes of mitochondrial dynamics. Mol. Cell. 2023;83:857–876. doi: 10.1016/j.molcel.2023.02.012. [DOI] [PubMed] [Google Scholar]

[bib39] 39.Liang F.G., Zandkarimi F., Lee J., Axelrod J.L., Pekson R., Yoon Y., Stockwell B.R., Kitsis R.N. OPA1 promotes ferroptosis by augmenting mitochondrial ROS and suppressing an integrated stress response. Mol. Cell. 2024;84:3098–3114.e6. doi: 10.1016/j.molcel.2024.07.020. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib40] 40.Yazdani H.O., Roy E., Comerci A.J., van der Windt D.J., Zhang H., Huang H., Loughran P., Shiva S., Geller D.A., Bartlett D.L., et al. Neutrophil Extracellular Traps Drive Mitochondrial Homeostasis in Tumors to Augment Growth. Cancer Res. 2019;79:5626–5639. doi: 10.1158/0008-5472.Can-19-0800. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib41] 41.Wai T., Langer T. Mitochondrial Dynamics and Metabolic Regulation. Trends Endocrinol. Metab. 2016;27:105–117. doi: 10.1016/j.tem.2015.12.001. [DOI] [PubMed] [Google Scholar]

[bib42] 42.Zhang X., Zhao H., Li Y., Xia D., Yang L., Ma Y., Li H. The role of YAP/TAZ activity in cancer metabolic reprogramming. Mol. Cancer. 2018;17:134. doi: 10.1186/s12943-018-0882-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib43] 43.López-Moyado I.F., Ko M., Hogan P.G., Rao A. TET Enzymes in the Immune System: From DNA Demethylation to Immunotherapy, Inflammation, and Cancer. Annu. Rev. Immunol. 2024;42:455–488. doi: 10.1146/annurev-immunol-080223-044610. [DOI] [PubMed] [Google Scholar]

[bib44] 44.Li Z., Cai X., Cai C.L., Wang J., Zhang W., Petersen B.E., Yang F.C., Xu M. Deletion of Tet2 in mice leads to dysregulated hematopoietic stem cells and subsequent development of myeloid malignancies. Blood. 2011;118:4509–4518. doi: 10.1182/blood-2010-12-325241. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib45] 45.Lv H., Zong Q., Chen C., Lv G., Xiang W., Xing F., Jiang G., Yan B., Sun X., Ma Y., et al. TET2-mediated tumor cGAS triggers endothelial STING activation to regulate vasculature remodeling and anti-tumor immunity in liver cancer. Nat. Commun. 2024;15:6. doi: 10.1038/s41467-023-43743-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib46] 46.Deng M., Zhang R., He Z., Qiu Q., Lu X., Yin J., Liu H., Jia X., He Z. TET-Mediated Sequestration of miR-26 Drives EZH2 Expression and Gastric Carcinogenesis. Cancer Res. 2017;77:6069–6082. doi: 10.1158/0008-5472.Can-16-2964. [DOI] [PubMed] [Google Scholar]

[bib47] 47.Wu H., Chen W., Chen Z., Li X., Wang M. Novel tumor therapy strategies targeting endoplasmic reticulum-mitochondria signal pathways. Ageing Res. Rev. 2023;88 doi: 10.1016/j.arr.2023.101951. [DOI] [PubMed] [Google Scholar]

[bib48] 48.You J.H., Lee J., Roh J.L. PGRMC1-dependent lipophagy promotes ferroptosis in paclitaxel-tolerant persister cancer cells. J. Exp. Clin. Cancer Res. 2021;40:350. doi: 10.1186/s13046-021-02168-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib49] 49.Zhang H., Wang S., Wu P., Hu Z., Chen Y., Guan Y., Pang J. Revealing the landscape of targeting mitochondrial functions and behaviors to overcome cancer chemoresistance. J. Natl. Cancer Cent. 2025;5:453–473. doi: 10.1016/j.jncc.2025.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib50] 50.Ying Z., Xin Y., Liu Z., Tan T., Huang Y., Ding Y., Hong X., Li Q., Li C., Guo J., et al. The mitochondrial unfolded protein response inhibits pluripotency acquisition and mesenchymal-to-epithelial transition in somatic cell reprogramming. Nat. Metab. 2025;7:940–951. doi: 10.1038/s42255-025-01261-6. [DOI] [PubMed] [Google Scholar]

[bib51] 51.Jiang H., Ye J. The Warburg effect: The hacked mitochondrial-nuclear communication in cancer. Semin. Cancer Biol. 2025;112:93–111. doi: 10.1016/j.semcancer.2025.03.006. [DOI] [PubMed] [Google Scholar]

[bib52] 52.Zhu D., Li X., Tian Y. Mitochondrial-to-nuclear communication in aging: an epigenetic perspective. Trends Biochem. Sci. 2022;47:645–659. doi: 10.1016/j.tibs.2022.03.008. [DOI] [PubMed] [Google Scholar]

[bib53] 53.Gao F., Liang T., Lu Y.W., Fu X., Dong X., Pu L., Hong T., Zhou Y., Zhang Y., Liu N., et al. A defect in mitochondrial protein translation influences mitonuclear communication in the heart. Nat. Commun. 2023;14:1595. doi: 10.1038/s41467-023-37291-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib54] 54.Herkenne S., Ek O., Zamberlan M., Pellattiero A., Chergova M., Chivite I., Novotná E., Rigoni G., Fonseca T.B., Samardzic D., et al. Developmental and Tumor Angiogenesis Requires the Mitochondria-Shaping Protein Opa1. Cell Metab. 2020;31:987–1003.e8. doi: 10.1016/j.cmet.2020.04.007. [DOI] [PubMed] [Google Scholar]

PERMALINK

High matrix stiffness triggers the YAP-OPA1-TET1/3 loop to drive chemoresistance via enhanced nuclear-mitochondrial communication

Peng Wu

Sicheng Wang

Zanmin Hu

Haoyan Zhang

Yuqing Lin

Zizhao Li

Jiahong Wu

Yani Chen

Yujie Chen

Yuandong Xu

Jun Li

Yupeng Guan

Summary

Graphical abstract

Highlights

Introduction

Results

Chemoresistance in prostate cancer is associated with high matrix stiffness

Figure 1.

High matrix stiffness promotes mitochondrial fusion and enhances mitochondrial function

Figure 2.

High matrix stiffness activates YAP nuclear translocation and regulates the Hippo signaling pathway

Figure 3.

Functional screening identifies ILK as a mediator of YAP dephosphorylation

Figure 4.

YAP-OPA1-mediated communication from the nucleus to the mitochondria

Figure 5.

Mitochondrial metabolite α-KG activates TET1/3, mediating reverse mitochondrial-to-nuclear communication

Figure 6.

Targeting OPA1 disrupts nuclear-mitochondrial communication and restores tumor chemotherapy sensitivity

Figure 7.

Targeting OPA1 inhibits high matrix stiffness-induced chemoresistance in vivo

Figure 8.

Discussion

Figure 9.

Limitations of the study

Resource availability

Lead contact

Materials availability

Data and code availability

Acknowledgments

Author contributions

Declaration of interests

STAR★Methods

Key resources table

Experimental model and study participant details

Patients and samples

Cell culture

Preparation of polyacrylamide gels of different stiffness levels

Method details

Testing of tissue for mechanical properties

RNA sequencing

Differentially expressed genes (DEGs) analysis

Enrichment analysis

Animal study

Cell viability assay measured by CCK8

5-Ethynyl-2′-deoxyuridine (EdU) assay

Annexin V/PI flow cytometry analysis

Mitochondrial membrane potential (MMP) detection

ROS

Immunoblot analysis

Immunofluorescence staining (IF)

Quantification of oxygen consumption

Immunohistochemical staining (IHC)

Masson’s trichrome staining

SiriusRed staining

MitoTracker staining

Transmission electron microscopy

Measurement of ATP content

RNA isolation and quantitative real-time PCR (qRT-PCR)

Transfections

Glutamine assay

GLS activity assay

5-methylcytosine and 5-hydroxymethylcytosine global level quantification

Quantification and statistical analysis

Footnotes

Contributor Information

Supplemental information